close

Вход

Забыли?

вход по аккаунту

?

Recognition of chlamydial antigen by HLA-B27-restricted cytotoxic T cells in HLA-B.178040052705 transgenic CBA H-2k mice

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 40, No. 5, May 1997, pp 945-954
0 1997, American College of Rheumdtology
945
RECOGNITION OF CHLAMYDIAL ANTIGEN BY
HLA-B27-RESTRICTED CYTOTOXIC T CELLS IN
HLA-B*2705 TRANSGENIC CBA (H-2k) MICE
WOLFGANG KUON, ROLAND LAUSTER, UTE BOTTCHER, ARMIN KOROKNAY,
MATTHIAS ULBRECHT, MATTHIAS HARTMA", MARTINA GROLMS, SANJA UGRINOVIC,
JURGEN BRAUN, ELISABETH H. WEISS, and JOACHIM SIEPER
Objective. The association of reactive arthritis
(ReA) with HLA-B27 and the presence of bacterial
antigen in joints with ReA suggest that bacterial peptides might be presented by the HLA-B27 molecule and
thus stimulate CD8 T cells. This study was performed to
investigate the B27-restricted cytotoxic T lymphocyte
(CTL) response to Chlamydia trachomatis, using the
model of HLA-B27 transgenic mice.
Methods. CBA (H-2k) mice homozygous for HLAB*2705 and human &-microglobulin expression were
immunized with C trachomatis or with the chlamydia1
57-kd heat-shock protein (hsp57) coupled to latex
beads. Cytotoxicity of lymphocytes from in vivo-primed
transgenic mice was tested against C trachomatisinfected targets. Blocking experiments were performed
with monoclonal antibodies (MAb) against class I major
histocompatibility complex molecules.
Results. A Chlamydia-specific lysis of both B27transfected and nontransfected target cells was observed. This response could be inhibited by anti-B27
and anti-H2 MAb. CTL from mice immunized with
hsp57 were not able to lyse Chlamydia-infected target
cells, and Chlamydia-specific CTL could not destroy
targets loaded with hsp57.
The work of Drs. Kuon, Sieper, and Braun was supported by
a grant from Eberhard-Bode Stiftung, Germany.
Wolfgang Kuon, PhD, Ute Bottcher, Joachim Sieper, MD:
Universitatsklinikum Benjamin Franklin, and Deutsches RheumaForschungszentrum, Berlin, Germany; Roland Lauster, PhD: Deutsches Rheumaforschungszentrum, Berlin, Germany; Armin Koroknay,
PhD, Matthias Ulbrecht, MD, Elisabeth H. Weiss, PhD: Institut fur
Anthropologie und Humangenetik, Universitat Miinchen, Munich,
Germany; Matthias Hartmann, PhD: Institut fur Medizinische Mikrobiologie, Friedrich Schiller-Universitat Jena, Jena, Germany; Martina
Grolms, Sanja Ugrinovic, MD, Jurgen Braun, MD: Universitatsklinikum Benjamin Franklin, Berlin, Germany.
Address reprint requests to Wolfgang Kuon, PhD, Medizinische Klinik und Poliklinik, Rheumatologie, Klinikum Benjamin
Franklin, Hindenburgdamm 30, D-12200 Berlin, Germany.
Submitted for publication May 29, 1996; accepted in revised
form November 6, 1996.
Conclusion. These results suggest the existence of
a t least 2 CTL populations in this mouse model: one
recognizing peptide of bacteria-infected cells restricted
by HLA-B*2705 and the other recognizing peptide of
bacteria-infected cells restricted by the murine H-2Kk
molecule. It does not appear that hsp57 is a major target
for the CD8 T cell response directed against Chlamydia.
This animal model opens the way for identifying bacterial epitopes presented by HLA-B27, and might thus help
to clarify the pathogenesis of B27-associated diseases.
Most major histocompatibility complex (MHC)
associations with human diseases involve class I1 MHC
antigens. However, the group of related diseases termed
spondylarthropathies, which include reactive arthritis
(ReA) and ankylosing spondylitis, occur in strong association (60-95%) with the human class I MHC antigen
HLA-B27 (1). The basis for this association is unclear
(2,3). Transgenic rats expressing HLA-B*2705 and human P,-microglobulin @,m) develop a disease that
shares clinical and histologic features with B27associated human spondylarthropathies; hence, it is assumed that HLA-B*2705 is itself involved in the pathogenesis of these diseases (4-6). In ReA, the presence of
persistent bacterial antigen in the joints suggests that
bacterial-derived peptides might be presented to CD8positive T cells by HLA-B27 (7). This is further supported by the demonstration of a B27-restricted cytotoxic T lymphocyte (CTL) response to Yersiniu in
Yersiniu-induced ReA (8).
An important pathogen known to trigger ReA is
chlamydia truchomutis (2,9), an obligate intracellular
bacterium with a complex life cycle (10-12). Surprisingly
little is known about the immune response to C truchomutis. Class I MHC molecules present mainly endogenous peptides derived from, e.g., viral proteins. In
contrast, exogenous antigens are internalized by phagocytosis, degraded within phagolysosomes, cleaved into
KUON ET AL
946
peptides, and then presented by class I1 MHC molecules
(13). Extracellular pathogens or intracellular pathogens
residing in vacuoles (such as Chlamydia, Yersinia, and
Salmonella) are normally presented by this pathway.
However, several exceptions to the above rules have
been described (14-17), and CD8-positive T cells are
now considered to play an important role in resistance to
intracellular bacteria (18).
For t h e analysis of CD8 T cell epitopes of viruses,
the model of HLA class I and human Pzm doubletransgenic mice has proved useful (19,20). In t h e present
study, the immune response to C trachomatis was investigated in HLA-B*2705 arid human P2m doubletransgenic (HLA-B*2705hP2rn) mice (21). T h e aim of
this investigation was to determine whether a bacteriaspecific CTL response against C trachomatis could be
raised and whether such a response would be HLA-B27
restricted. We further analyzed the role of the chlamydial57-kd heat-shock protein hsp57, an immunodominant
protein of Chlamydia (22,23), in this CTL response.
MATERIALS AN11 METHODS
Transgenic mice. CBA/J mice (H-2k), ages 6-12 weeks,
were obtained from the animal breeding colony of the Federal
Ministry of Health, Marienfelde, Berlin, Germany. The construction of transgenic mice expressing homozygous HLAB*2705 and human Pzm has been described (24,25). Briefly, a
genomic cosmid library was constructed from white blood cells
of an HLA-A2,2;B5,27;&2,3 positive individual. The HLAB27 gene of subtype B*2705 was isolated as genomic clone. A
25-kb Sal I fragment of this clone containing the B*2705 gene
was then used to establish the B*2705 transgenic mouse line.
Founder mice containing 1 copy of the B*2705 gene were
backcrossed to a human p,m-expressing transgenic mouse line
(26). The double transgene B*2705hpzm was backcrossed onto
CBA mice, and a stable double-transgenic mouse line established (21). Finally, homozygotes for both transgenes, carrying
2 gene copies for HLA-B*2705 and -2-5 copies for human
p2m in addition to the naturally existing mouse pzm genes,
were bred.
Cell lines. The 526 L cell mouse (H-2k)fibroblast line
expressing human &m (J26pz) and the mouse monocyte/
macrophage-like line P388D.1 (H-2d) were obtained from
American Type Culture Collection (Rockville, MD) (27,28).
J26pz-B*2705 cells were constructed by double transfection.
Line P388D.l-B*2705 was obtained by transfection with
HLA-B*2705. The cell lines were maintained in RPMI 1640
medium containing 10% fetal calf serum (FCS; Gibco/BRL,
Eggenstein, Germany). Medium for transfectants was supplemented with 0.5 mglml G418 (GibcoBRL).
L cell transfection. For transfection, monolayer cultures of L cells were plated on dishes (10 cm in diameter;
Nunc, Wiesbaden, Germany) and grown in Dulbecco’s modified Eagle’s medium-10% FCS. For transfection with Lipofectin (Gibco/BRL), the medium was replaced by Opti-MEM
(GibcoiBRL). DNA transfections were performed with some
modifications to the manufacturer’s instructions. Briefly, a
suspension of 10 pg of 7.2-kb vector pTM (29) containing the
gene for HLA-B27 in 3 ml Opti-MEM was mixed with 80 p g
Lipofectin reagent in 3 ml Opti-MEM and incubated in a
polystyrene tube for 15 minutes at room temperature. Each
culture plate with growing J26pz cells was incubated overnight
with 6 ml of DNA-Lipofectin complex suspension. The same
protocol was used for transfecting P388D.1 cells, except that
the 6-kb Barn HI fragment, containing the HLA-B*2705 gene
of the pTM vector, was cloned into the eukaryotic vector
pREP9 (Invitrogen, Leek, The Netherlands). After 48 hours,
selection for transfected cells with 1.2 mg/ml G418 was started.
Growing cell clones were picked up from the plates, separately
cultured, and HLA-B27 expression investigated by
fluorescence-activated cell sorter (FACS) analysis.
FACS analysis and monoclonal antibodies (MAb).
Single-cell suspensions were prepared from mouse spleen cells
or from the cell lines J26pz and J26Pz-B*2705. Samples of 5 X
lo5 cells were incubated with saturating amounts of antibodies.
Unconjugated hybridoma supernatants MCA 1063 (IgG2a;
anti H-2Kk) and MCA 1059 (IgM; anti H-2Dk) were obtained
from Serotec (Wiesbaden, Germany). MAb supernatants
141-11 (IgM; anti H-2Kk, anti H-2Db, anti H-2Dk) and ME1
(IgG1; anti-B27, anti-B7, anti-B22), were kindly provided by J.
Johnson, (Munich, Germany); supernatant of hybridoma line
BBM.l (IgG2b; anti-human p,m) was obtained from ATCC.
Fluorescein isothiocyanate (F1TC)-conjugated anti-B27 MAb
for direct staining was obtained from Behring (Marburg,
Germany), while the FITC-conjugated goat anti-mouse IgG +
IgM F(ab’)z fragment for second-step reagent was purchased
from Dianova (Hamburg, Germany). Antibody-stained cells
were analyzed with a FACScan (Becton Dickinson, Heidelberg, Germany). Rat anti-mouse CD8 (IgG2a) clone
YTS105.18 (30) was obtained from Serotec.
C trachomatis propagation. In the present study, C
trachomatis of serotype L2 was propagated in HEp-2 cells
(ATCC) (31). The number of infectious units of C trachomatis
elementary bodies was determined by titration on HEp-2 cells,
and aliquots were stored at -70°C. Infectious medium for C
trachomatis propagation consisted of RPMI 1640, 1%glucose
(Braun, Melsungen, Germany), 0.1% vancomycin HCI (Eli
Lilly, Indianapolis, IN), 0.1% gentamicin (Merck, Darmstadt,
Germany), 1% L-glutamine (GibcoDRL), 10% FCS, and
cycloheximide (Sigma, Deisenhofen, Germany), at a concentration of 1 pg/ml.
Bacterial strains and media. Escherichia coli strains
were grown on solid LB-agar medium (Sigma). Bacterial
strains DH5u and M15 (PREP 4) (Invitrogen), containing
recombinant plasmid pRC57, were supplemented with ampicillin (100 pg/ml) and kanamycin (10 pg/ml).
Gene expression and protein purification of hsp57.
The complete open reading frame of the chlamydia1 57-kd
heat-shock protein hsp57 was amplified with Pwo I polymerase
(Boehringer Mannheim, Mannheim, Germany), by polymerase
chain reaction (PCR) using the primers GATCCCATGGTCGCTAAAAAC and GATCAGATCTATAGTCCATTCCTGC. Amplification conditions were 94°C for 5 minutes,
followed by 35 cycles at 94°C for 1.5 minutes, 56°C for 1.5
minutes, and 72°C for 2 minutes. The amplified fragment was
isolated from agarose gel with a Jet Sorb Kit (Genome, Bad
Oeynhausen, Germany), digested with Nco I and Bgl I1 endonucleases (Boehringer Mannheim), and ligated into Nco Iand Bgl II-digested vector pQE 60 (Qiagen, Hilden, Germa-
IMMUNE RESPONSE TO C TRACHOM4TIS IN HLA-B2705hp2m MICE
A
normal splenocytes
D,
El
7
947
transgenic splenocytes
21
ME1
ME1
BBM. 1
BBM. 1
B
QI
4
E
Fluorescence intensity (log)
Figure 1. Cell surface expression of human HLA-B"2705 and human P,-microglobulin (h/3,m) by FACScan analysis. Reactivity of normal CBA
splenocytes (A and B) and B*2705h&m double transgenic splenocytes (D and E) with monoclonal antibody (MAb) ME1 (anti-B27) and MAb
BBM.l (anti-p,m) at 1:lO dilutions is shown. Goat anti-mouse F(ab'), IgG + IgM fluorescein isothiocyanate (F1TC)-labeled Fab fragment (1:lOO)
was used as second-step reagent. Background staining of FITC-labeled F(ab'), fragment on normal and transgenic splenocytes is shown (C and F).
ny). A positive clone was selected after transformation of
electrocompetent E coli strain M15 (pREp 4) and named pRC
57. Identity of the PCR product was confirmed by restriction
enzyme analysis (results not shown).
Expression of the cloned gene was induced by addition
of 1 mM IPTG. Cells were harvested in a French press after 2
hours, and the fusion protein was separated from crude extract
on an Ni-NTA-resin column using imidazole, according to the
instructions of the manufacturer (Qiagen).
Bead microspheres and protein adsorption. Purified
chlamydia1 hsp57 protein was adsorbed onto 3-pm latex beads
(Polybeads) purchased from Polysciences (Eppelheim, Germany), according to the supplier's instructions. After washing, the
amount of protein bound to the beads was determined from
the difference in optical density in the protein solution before
and after incubation with beads.
Cytoplasmic loading of mouse splenocytes and the
transfectant 526 cell lines with purified hsp57 from C trachornatis. Purified protein was introduced into the cytoplasm of
transgenic mouse splenocytes, J26P2, and J26P2-B27 by os-
motic shock treatment (32). Cells (5 X lo6) were resuspended
in 0.5 ml phosphate buffered saline (PBS)-hsp57 solution
containing 0.5 mg protein and mixed in a conical tube with an
equal volume of prewarmed hypertonic medium. The suspension was incubated for 10 minutes at 37°C. Then the mixture
was diluted with 10 ml prewarmed hypotonic medium and
incubated for 2-3 minutes at 37°C. The cells were centrifuged,
and the pellet was resuspended in RPMI 1640-10% FCS and
rested for at least 1 hour in the incubator at 37"C, before use.
Infection of mice with C trachomatis, CTL induction,
and in vivo priming with protein-adsorbed beads. For the in
vivo priming of transgenic mice, cultured J26P2-B*2705 cells
were infected in vitro for 48 hours with purified infectious
elementary bodies of C truchornutis. Then 3 X lo7 infected
cells in 150 p.1 PBS were injected subcutaneously into mice at
the base of the tail. After 2 weeks, the procedure was repeated
twice by weekly intraperitoneal injection. Three days later,
spleen cells from immunized mice were harvested and restimulated in vitro. By this time the mice did not show signs of
infection. For the in vitro stimulation, 3 X lo7 primed spleno-
KUON ET AL
948
I
:
anti H-ZKk
anti H-ZDk
anti
human 02m
...__....J2602
F(ab')P
.
- J2602
-... J2602-BZ7
Fluorescence I n t e n s i t y ( L o g )
Figure 2. A-E, Cell surface expression of human HLA-B"2705 and human P2m, determined by indirect immunofluorescence on L cell lines J26p,
and J26p2-B*2705 stained with MAb MCA 1063 (anti H-2Kk) at a 1:20 dilution (A), MCA 1059 (anti H-2Dk) at a 1:20 dilution (B), 141-11 (anti
H-2Kk,Dk) (C), BBM.l (anti human &m) (D), and ME.1 (anti HLA-B27) (E). The reaction was developed with goat anti-mouse F(ab'),
FITC-labeled IgG + IgM fragment (1:lOO) as second-step reagent. Reactivity of the FITC-labeled F(ab')z fragment alone with cell line J26& is
indicated as F(ab'), control. The relative cell number is shown on the y-axis, the fluorescence intensity (FL; log) on the x-axis. F, Cell surface
expression of human HLA-B*2705 on P388D.1 cells, determined by direct immunofluorescence with FITC-conjugated anti-HLA-B27 MAb at a
dilution of 1:30. See Figure 1 for definitions.
cytes and 3 X 10' irradiated (200 Gy) C trachomatis-infected
J26P2-B*2705 L cells were incubated in 10 ml of RPMI
1640-10% FCS in upright 25-cm flasks (Nunc). After 5 days,
the cells were harvested and assayed for cytotoxicity.
For priming of transgenic mice with protein, beads
loaded with 100 pg hsp57 were inijected subcutaneously at the
base of the tail. After 2 more intraperitoneal injections,
splenocytes were restimulated in vitro with protein-loaded
syngeneic spleen cells from CBA-B*2705hp2m mice. Primed
cells (3 x lo') were incubated with 3 X 106irradiated (20 Gy)
hsp57 protein-loaded (by osmotic shock) syngeneic splenocytes from naive transgenic mice. The cell suspensions were
cultured in 10 ml RPMI 1640-10%7 FCS in upright 25-cm flasks
and harvested, after 5 days of incubation, in 5% co2/95% air
at 37°C.
Blocking of CTL responses by MAb. The pellet of 1 X
10' "Cr-labeled target cells W B S incubated on ice for 1
additional hour with the respective supernatants of MAb.
Thereafter, the cells were distributed in 96-well roundbottomed microtiter plates (Nunc) and assayed for cytotoxicity. Inhibition with anti-mouse CD8 MAb (1 mgiml) was performed by incubating the CTL cell pellet resuspension in 100
pl PBS with 20 pl antibody of a 1:20 dilution for 1 hour on ice.
Cytotoxicity assay ("CK-release). A 4-hour "Crrelease assay was used to determine the cytolytic activity.
Target cells (1 X 10') were labeled with 100 pCi "Cr
(Amersham, Braunschweig, Germany) in 5% C02/95% air for
1hour at 37°C. Labeled target cellis (1 X lo4 in a volume of 100
p1 culture medium) were added lo the experimental wells of
96-well round-bottomed microtiter plates (Nunc) containing
100 pl of serial dilutions of CTL. Spontaneous chromium
release was measured in wells with target cells and medium
alone. Maximal release was determined by incubating the
target cells in wells with 2% Triton X-100. After 4 hours of
incubation, the supernatants were harvested onto filters (Scattron, Oslo, Norway) and "Cr counts measured as triplicates on
a gamma counter (LKB/Pharmacia, Freiburg, Germany). Percentage of specific lysis was calculated as follows:
Counts per minute release
effector CTL - spontaneous release
x 100
% specific lysis =
cpm maximal release - spontaneous release
Data are presented as the mean
determinations.
?
SD of triplicate
RESULTS
HLA-B27 and human &m expression on transgenic splenocytes and L cell transfectants. Transgenic
mouse splenocytes and J26p2 L cells were monitored for
stable expression of HLA-B"2705 and human P2m, by
FACScan analysis. As expected, no HLA-B*2705 (MAb
ME1) or human pzm (MAb BBM.l) expression was
observed on normal CBA splenocytes (Figures 1A and
B), in contrast to the findings with spleen cells derived
from double-transgenic mice (Figures 1D and E). FITCconjugated goat anti-mouse IgG + IgM F(ab'), fragment alone stained normal and transgenic splenocytes
(Figures 1C and F), but distinct staining for B27 and
IMMUNE RESPONSE TO C TRACHOMATIS IN HLA-B2705hp2m MICE
human Pzm after addition of MAb ME1 and BBM.l
could be observed on the transgenic splenocytes.
In a further experiment, HLA-B27 and human
P2m expression on L cell line J260, and its double
transfectant was determined (Figure 2). H-2k molecules
could be detected on both lines with MAb MCA 1063,
MCA 1059, and 141-11 (Figures 2A-C). Staining with
MAb BBM.l (human P2m) revealed stable expression of
the molecule on J26P2 and on the double transfectant
line (Figure 2D), while MAb ME1 (B27) reacted only
with the double transfectant J26Pz-B*2705 (Figure 2E).
There was no staining in experiments using anti H-2d
and anti H-2b MAb (results not shown). Reactivity of
FITC-labeled second antibody goat anti-mouse IgG +
IgM F(ab'), fragment alone was determined on J26& L
cells and is shown in Figure 2 as the J26P2-F(ab'),
control. Direct staining for HLA-B27 expression on
P388D.1 cells with FITC-conjugated anti-B27 MAb
(Behring) at a 1:30 dilution revealed expression of B27
antigen (Figure 2F).
C truchomutis-specific CTL response in HLAB*2705h&m double-transgenic CBA mice. To examine
whether the double-transgenic mice could raise a CD8
response to C trachomatis, we cultured the bacteria for
48 hours in J26Pz-B*2705-expressing L cell transfectants, and then injected the washed cells into mice. The
mice were boosted as described, and the primed spleen
cells were then tested for cytotoxicity in a standard
4-hour "Cr-release assay using infected L cells as targets. Lysis was obtained only with Chlamydia-infected
J26P2 or J26Pz-B*2705 cells; less cytotoxicity was obtained on uninfected target cells (Figure 3). As observed,
the amount of lysis produced by bulk culture-derived
CTL was higher in B27-expressing double-transfected
and Chlamydia-infected targets than in infected but
non-B27-transfected J26P2 cells. This suggests that the
bulk cultures contain at least 2 CTL populations, one
restricted by murine H-2k and the other by the human
HLA-B27 molecules. The existence of a B27-restricted
population is supported by the finding that the C
trachomatis-infected line P388D.l-B27 of H-2d type was
also recognized by the CTL. In contrast to ChlarnydiainEected H-2k-matched J26Pz targets, no lysis of
Chlamydia-infected but non-MHC-matched P388D.1
targets was found.
Inhibition of the CTL response to C truchomutis
by anti-H-2-and antbB27-directed MAb. In a further
step, blocking studies with a panel of MAb directed
against H-2k and HLA-B27 were performed to determine whether lysis by the bulk culture-derived CTL
could be prevented, at least in part. The experiments
again showed lysis of C trachornatis-infected targets,
949
J26p2
J26P2/Chl
o J26p2-B27
J26P2-B27/Chl
0 P38801Khl
Q P388DI-B27/Chl
80 -
EN
*
60
-
G 40
-
.B
v)
V
E
5t
w
20
-
0'
100
50
25
12.5
E/T ratio
6.25
3.125
Figure 3. Lysis of Chlamydia truehornatis (Ch1)-infected and uninfected J26P, and J26P2-B*2705 (J26PZ-B27)and Chlamydia-infected
P388D1 and P388Dl-B27 L cell targets by C traehomatis-specific cytotoxic T lymphocytes (CI'L)measured in a 4-hour "Cr release assay. CTL
were obtained from in vivo-primed HLA-B*2705P2m transgenic mice
and restimulated in vitro for S days with C trachomutis-infected, irradiated
(200 Gy)J26P2-B*270SL cells. Values are the mean 2 SD of triplicate
cultures (SD not shown if too small). E F ratio = effectortarget ratio. See
Figure 1 for other definitions.
with increased lysis of B27 double-transfected cells
(Figure 4A). Blocking of target cells with MAb ME1
clearly reduced lysis of the latter targets compared with
the controls without antibody treatment (Figure 4B).
The same antibodies did not inhibit lysis of nontransfected but infected targets (Figure 4C). Incubation of
target cells with MAb 141-11 (anti-H-2Kk and anti-H2Dk) strongly blocked lysis of infected J26P2 targets
(Figure 4C), but was less effective in blocking for the
B27 double-transfectant target (Figure 4B). Finally, we
investigated lysis inhibition with 2 murine antibodies
directed at either Kkor Dk molecules alone (Figures 4D
and E). On J26Pz-infected L cells without B27 expression, the anti-Kk MAb clearly inhibited lysis of the
infected target, while the anti Dk antibody did not (lysis
was comparable with that seen using the untreated J26&
control target) (Figure 4E). However, this difference in
inhibitory activity of the 2 MAb was not seen on the
double transfectant target J26P2-B*2705. From these
inhibition experiments, we infer the existence of 2 CTL
populations.
Findings of studies using hsp57 protein-bound
latex beads for priming of an in vivo CTL response. We
next addressed the question of which protein from C
KUON ET AL
950
A
50
401
:!
B
z
50
4o
c
4
4 J26j32-W/Chl
o J26&?-W/Chl+MEl
J26&?-BZ'/ChI+l41-11
+
-20
10
5
2.5
_J
40
0-
I
20
E/T ratii
D
50
4 J26p2-B27/chl
o J2682-B27/Chl+antl Kk
0
I
I
10
5
I
2.5
-
1 -10 -I
1.25
40
I
20
VT ratio
J2@3Z-B27/Chlmnri Dk
E
25
-
20
-
15
-
J26F12/CH+141-11
5-
-5
1.25
+
20-
10 -
-10
20
A JEj32/Chl
J26P2/CH+MEl
-
15 -
30
0
40
25
I
10
I
I
5
2.5
I
1.25
VT ratio
10 -
5-
0-
-20 -I - 7 1
40
20
10
5
2.5
1.25
-5
-
-10
40
20
VT ratio
10
5
2.5
1.25
E/T ratio
Figure 4. Effect of blocking of CTL-mediated lysis with murine anti-H-2k and anti-B27 MAb on Chlamydia trachomatis-infected and uninfected
L cell targets. A, Lysis of infected and uninfected L cells without incubation of the targets with MAb. B and C, Incubation of infected J26P2-B*2705
(B) and J26& (C) cells with MAb isupernatants 141-11 (anti-H-2Kk [anti Kk], anti-H-2Dk [anti Dk]) and ME1 (anti-HLA-B27). D and E,
Prevention of target lysis of J26P2-B8*2705 (D) and J26/3, (E) of C trachornatis-infected L cells with MCA 1063 (anti-H-2Kk) and MCA 1059
(anti-H-2Dk) MAb. Percent specific lysis is shown as the mean ? SD of triplicate cultures. See Figures 1 and 3 for definitions.
trachomatis might be responsible for priming of CTL in
vivo. One chlamydia1 candidate protein could be hsp57,
which appears to play a role during C trachomatis
infection (22). The recombinant protein was evaluated
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Figure 5 ) , with pr'otein-loaded latex beads
used for priming as described. Osmotically loaded syngeneic naive CBA-B27h&m splenocytes were then used
as targets in a "Cr-release assay. Lysis was observed only
with CBA-HSP or CBA-B2'7h&,m-hsp57-loaded targets, and not with unloaded murine cells (Figure 6). We
then investigated whether the hsp57-specific CTL could
also lyse infected or uninfected J26pz and J26PZ-B*2705
L cell targets, as had been observed in studies of lysing
by Chlamydia-specific CTL (Figures 3 and 4A). None of
the J26pz or J26pz-B*2705 L cell targets, whether
infected with C trachomutis or not, could in fact be lysed
by hsp57-reactive CTL (Figure 6). Furthermore, while
Chlamydiu-specific CTL destroyed infected targets, no
lysis could be observed when the same target cells were
loaded with the Chlumydiu-derived 57-kd heat-shock
protein (Figure 7A).
Blocking of CTL to C truchomutis by an anti-CDS
MAb. In a final experiment, we addressed the question
of whether C truchomatis-specific CTL could be inhibited by incubation with an anti-CD8 h4Ab. As shown in
Figure 7B, lysis of both infected targets was inhibited.
DISCUSSION
In the present study, the immune response to the
intracellular pathogen C trachomutis in HLA-
IMMUNE RESPONSE TO C TRACHOMATIS IN HLA-B2705h&m MICE
A
€3 C
D
-
94
-67
c-
43
-30
-
20
Figure 5. Coomassie blue-stained sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE 12.5%) of purified
chlamydial 57-kd heat-shock protein (hsp57). Lane A, Eschen'chiu coli
protein extracts before induction with IPTG. Lane B, Expression of
hsp57 after induction with IPTG. Lane C, Test of 1 kg of purified
hsp57 on SDS-PAGE. Lane D, Low molecular weight marker proteins.
B*2705hp2m double-transgenic mice was investigated
and the question raised as to whether bacterial peptide
could be presented by class I MHC molecules in B27
transgenic mice. We found that both a B27- and an
H-2-restricted cytotoxic T cell response to C trachomatis
could be obtained. These CTL do not recognize the
chlamydial 57-kd heat-shock protein.
The underlying mechanism for the association of
HLA-B27 with the spondylarthropathies remains unknown. At present there appear to be 2 major candidate
hypotheses to explain the association of B27 with certain
aspects of ReA (although others cannot be excluded)
(2,3): 1) the classic arthritogenic-peptide hypothesis,
involving B27-restricted CD8 T cell recognition of self or
bacterial peptides; and 2) a hypothesis based on the
presentation of B27-derived peptides by class I1 MHC
antigens to CD4 cells. If the first hypothesis is correct,
then the animal model presented in this study would be
helpful in elucidating it by identifying bacterial peptides
presented by HLA-B27, and possibly also cross-reacting
self peptides.
The in vivo induction of CTL against Chlamydia
in mice has been controversial. Attempts to induce CTL
specific for C trachomatis were at first unsuccessful (33),
but recent studies have demonstrated a role for CD8 T
cells in resistance to chlamydial infection (34-36). In
another study, adoptive transfer of Chlamydia-specific
CTL protected naive mice against challenge with Chlamydia (37,38). In the present study, we confirmed that a
951
CTL response to C trachomatis can be raised in transgenic mice.
It has proven difficult to detect B27-restricted T
cells in humans with ReA (8,39). This may be partly due
to technical problems, which could be overcome by using
transgenic mice expressing human class I MHC molecules. It has been reported that HLA-B27 transgenic
mice can present influenza-derived peptides to T cells
(19). Furthermore, CTL from mice transgenic for a
particular human HLA molecule recognized the same
HLA-restricted peptide(s) as did CTL of human origin
(40,41). It is therefore likely that species-specific differences in antigen processing by mouse and human cells
have little effect (42-45). This system has not previously
been applied to bacterial epitopes.
The most important finding of our study was the
demonstration of a B27-restricted T cell response to
Chlamydia. CTL from bulk cultures were able to lyse
both infected H-2k-matched J26p2 cells and, to a greater
extent, infected J26P2-B*2705 double transfectants. We
also observed lysis of Chlamydia-infected, but H-2mismatched (H-2d) P388D.l-B27 targets, while the
Chlamydia-infected parent P388D.1 cells (not transfected with HLA-B27) were not recognized. We there-
35
EI J26p2
A J26P2/Chl
o J26/32-B27
J26j32-B27/Chl
30
*
o
CBA-HSP
0 CBA-B27/HSP
V
15
UJ
w
10
5
0
60
30
15
7.5
E/T ratio
3.8
1.9
Figure 6. Cytolytic activity of chlamydial 57-kd heat-shock protein
(hsp57) bead-primed splenocytes from transgenic mice. Cytotoxicity
was measured on CBA splenocytes, CBA splenocytes loaded with
hsp57 (CBA-HSP), CBA-B27p,m targets, CBA-B27P,m cells loaded
with hsp57, C truchomutis infected and uninfected J26p, L cells, and
infected and uninfected J26p2-B*2705 L cells. Percent specific lysis is
shown as the mean ? SD of triplicate cultures. See Figures 1 and 3 for
other definitions.
KUON ET AL
952
B
A
40
40
J26p2
o J26pUChl
o J26pUChl
++ J26/32-B27/Chl
V J26P2+anti CD8
B J26p2-B27+anti CD8
E J26pUChlanti CD8
0 J26P2-B27/Chl+anti CD8
0 J26p2-827
+ J26/32-B27/Chl
30
A J26pUHSP
A J26p2-B27/HSP
.-
v)
v)
V
20
it
.-x
v)
v)
V
c
v)
30
20
$G
$
8
10
w
10
w
0
0
-10
-10
30
15
7.5
3.7
E/'T ratio
1.8
0.9
I
30
I
15
I
I
7.5
3.7
E/T ratio
I
1.8
I
0.9
Figure 7. A, Failure of Chlumydiu trachornatis-specific CTL to lyse 57-kd heat-shock protein-loaded J260, (J26PZ/HSP)and J26P2-B27 targets, in
contrast to C trachornatis-infected J26& and J26PZ-B27 targets. B, Inhibition of cytolysis of C truchornatis-infected J26& and J26P2-B27 targets
after incubation of the CTL with rat anti-mouse CD8 MAb. Values are the mean of triplicate determinations. See Figures 1 and 3 for other
definitions.
fore conclude that the cultures contained, in addition to
an H-Zrestricted, also a B27'-restricted T cell population. The blocking experiments with monoclonal antibodies directed against H-2k and HLA-B27 also suggested that chlamydial peptides seemed to be presented
in transgenic mice in association with both murine and
human class I molecules. Using MAb ME1, lysis of
infected J26P2-B*2705 L cells was decreased, without
inhibition of lysis of infected parental J26P2 targets. It
has also been previously reported that virus antigens can
be presented by both murine MHC and HLA molecules
in transgenic mice (19).
Recently, competition between co-expressed
HLA antigens for the same peptide has been reported
(46). Therefore, the lower inhibitory effect of the murine
Kk MAb on J26P2-B*2705 targets could be due to
competition between co-expressed HLA-B27 and
H-2Kk molecules for peptides, which have higher affinity
for HLA-B27. The cytolyijis observed using the
Chlamydia-infected, H-2-mismatched (H-2d) P388D.1B27 line (Figure 3) additionally shows that antigenic
peptides can be presented by HLA-B27. However, the
possibility that bacterial infections might have induced
new endogenous host proteins and peptides in our
experiments must be considered. To prove that the
B27-restricted CTL response is not directed against self
but against chlamydial-derived peptides, these peptides
have to be identified in the future.
We also began to explore possible immunodominant proteins of C trachornatis, such as the chlamydial
57-kd heat-shock protein, in the CD8 response of HLAB27 transgenic mice. Chlamydia1 hsp57 has been identified as the immunodominant protein for a CD4 T cell
response of guinea pigs after infection of the eye, which
leads to hypersensitivity to chlamydial antigen (23), a
situation resembling that in reactive arthritis (47). Furthermore, Chlamydia-derived hsp57 peptides that are
able to bind to HLA-B27 have recently been characterized (48).
Since soluble proteins as a rule induce only a
class I1 MHC-restricted T cell response, we used a
recently described novel approach to introduce protein
into the class I MHC pathway of antigen presentation:
protein-adsorbed latex beads have proven to be powerful agents for this purpose (49-51). Here we show that
this method can successfullybe applied to other proteins
of interest, in this case, the chlamydial 57-kd heat-shock
protein. Our experiments revealed a cytolytic response
to hsp57-loaded target cells. However, these CTL did
not lyse H-2-matched L cell targets when these cells
were infected with whole Chlamydia, an observation
made for both the J26& and the double transfectant
IMMUNE RESPONSE TO C TRACHOMTIS IN HLA-B2705h&m MICE
J26P2-B*2705 targets. From these results and those in
Figure 7A showing that C trachomatis-specific CTL did
not lyse hspS7-loaded targets, we conclude that the
agent responsible for the observed CTL response does
not seem to be an epitope of the chlamydial hspS7
protein. This does not exclude the possibility that peptides derived from the 57-kd protein are recognized by
CD4 cells, as suggested in the guinea pig model.
In our B27 transgenic mouse model as well as in
transgenic mouse models described by other investigators (26,52-56), but unlike the findings in the B27
transgenic rat model (4-6), the transgenic mouse model
studied by Weinreich et a1 (57),or the recently described
model of HLA-B27 transgenic mice lacking P2m (58),
no spontaneous or induced manifestation of disease
occurs. It nevertheless provides a model suitable for
defining a bacteria-specific CD8 immune response. This
demonstration of a cytotoxic B27-restricted immune
response against C trachomatis opens the opportunity to
identify peptides presented by HLA-B27 (59,60). Cytotoxic T cell lines or clones from B27 transgenic mice
specific for Chlamydia or other ReA-associated bacteria
can be used to screen for candidate proteins or peptides
derived from these bacteria and to analyze peptides
eluted from the B27 molecules of target cells infected
with these bacteria, for immunogenicity (61). Especially
in chronic forms of spondylarthropathies, a switch from
a bacteria-specific to a cross-reacting self antigen response might occur (2,3). Cross-reacting viral peptides
have recently been found to be able to activate T cell
clones specific for myelin basic protein (62), a self
antigen believed to play an important role in the pathogenesis of multiple sclerosis. Thus, the identification of
bacterial epitopes might help in the search for selfreactive antigens presented by HLA-B27.
ACKNOWLEDGMENTS
We thank Dr. G. Riethmuller, Institut fur Immunologie, Munich, for allowing us to use the animal facilities and for
breeding transgenic mice, and Dr. J. Johnson for the kind gift
of hybridoma lines ME1 and 141-11. We are especially grateful
to Dr. N. A. Mitchison for critical review of the manuscript and
helpful comments.
REFERENCES
Brewerton DA, Hart FD, Caffrey M, Nichols A, James DCO,
Sturrock RD: Ankylosing spondylitis and HLA-A27. Lancet
1:904-907, 1973
Sieper J, Braun J: Pathogenesis of spondylarthropathies: persistent
bacterial antigen, autoimmunity, or both? Arthritis Rheum 38:
1547-1554, 1995
Sieper J, Kingsley G: Recent advances in the pathogenesis of
reactive arthritis. Immunol Today 17:160-163, 1996
953
4. Hammer RE, Maika SD, Richardson LJA, Tang JP, Taurog JP:
Spontaneous inflammmatory disease in transgenic rats expressing
HLA-B27 and human P2m: an animal model of HLA-B27 associated human disorders. Cell 63:1099-1112, 1993
5. Breban M, Hammer RE, Richardson JA, Taurog JD: Transfer of
the inflammatory disease of HLA-B27 transgenic rats by bone
marrow engraftment. J Exp Med 178:1607-1616, 1993
6. Taurog JD, Maika SD, Simmons WA, Breban M, Hammer RE:
Susceptibility to inflammatory disease in HLA-B27 transgenic rat
lines correlates with the level of B27 expression. J Immunol
150:4168-4178, 1993
7. Burmester GR, Daser A, Kamradt T, Krause A, Mitchison NA,
Sieper J, Wolf N Immunology of reactive arthritis. Annu Rev
Immunol 13:229-250, 1995
8. Hermann E, Yu DTY, Meyer zum Buschenfelde KH, Fleischer B:
HLA-B27-restricted CD8 T cells derived from synovial fluids of
patients with reactive arthritis and ankylosing spondylitis. Lancet
342:646-650, 1993
9. Kingsley G, Sieper J: Current perspectives in reactive arthritis.
Immunol Today 14:387-391, 1993
10. Ward ME: Chlamydial classification, development and structure.
Br Med Bull 39:109-115, 1983
11. Schachter J: The intracellular life of Chlamydia. Curr Top Microbiol Immunol 138:109-139, 1988
12. Moulder J W Interaction of Chlamydia with immune cells and
immune molecules in vitro. Microbiol Rev 55:143-189, 1991
13. Germain RN: MHC-dependent antigen processing and peptide
presentation: providing ligdnds for T lymphocyte activation. Cell
76:287-299, 1994
14. Pfeifer JD, Wick MJ, Roberts L, Finlay K, Normark SJ, Harding
CV: Phagocytic processing of bacterial antigens for class I MHC
presentation to cells. Nature 361:359-362, 1993
15. Rock KL, Rothstein L, Gamble S, Fleischacher C: Characterization of antigen-presenting cells that express exogenous antigens in
association with class I MHC molecules. J Immunol 150:438-446,
1993
16. Harding CV, Song R: Phagocytic processing of exogenous particulate antigens by macrophages for presentation by class I MHC
molecules. J Immunol 153:4925-4933, 1994
17. De Bruijn MLH, Jackson MR, Peterson P A Phagocyte-induced
antigen-specific activation of unprimed CD8+ T cells in vitro. Eur
J Immunol 25:1274-1285, 1995
18. Kaufmann SHE: Immunity to intracellular bacteria. Annu Rev
Immunol 11:129-163, 1993
19. Kievits F, Ivanyi P, Krimpenford P, Berns A, Ploegh HL: HLArestricted recognition of viral antigens in HLA transgenic micc.
Nature 329:447-449, 1987
20. Dill 0, Kievits F, Koch S, Ivanyi P, Himmerling GH: Immunological function of HLA-C antigens in HLA-Cw3 transgenic mice.
Proc Natl Acad Sci U S A 855664-5668, 1988
21. Weiss EH, Schliesser G, Kuon W, Lang M, Riethmuller G, Kievits
F, Ivany P, Brem G: Copy number and the presence of human
&-microglobulin control cell surface expression of HLA-B27 in
transgenic mice with a 25 kb B27 gene fragment. In, Transgenic
Mice and Mutants in MHC Research. Edited by IK Egorov, CS
David. Berlin, Springer Verlag, 1990
22. Morrison RP, Belland RJ, Lyng KL, Caldwell HD: Chlamydial
disease pathogenesis: the 57 kD chlamydial hypersensitivity antigen is a stress response protein. J Exp Med 170:1271-1283, 1989
23. Morrison RP, Lyng K, Caldwell HD: Chlamydial disease pathogenesis: ocular hypersensitivity elicited by a genus specific 57-kD
protein. J Exp Med 169:663-675, 1989
24. Weiss EH, Kuon W, Dorner C, Lang M, Riethmuller G Organization, sequence and expression of the HLA-B27 gene: a molecular approach to analyze HLA and disease associations. Immunobiology 170:367-380, 1985
25. Weiss EH, Bloemer K, Doerner C, Kuon W, Lang M, Pohla H,
Schattenkirchner M, Riethmuller G: Molecular biology of the
HLA-B27 locus. Br J Rheumatol 27 (suppl 11):12-18, 1988
954
26. Krimpenfort P, Rudenko G, Hochstenbach F, Guessow D, Berns
A, Ploegh H: Crosses of two independently derived transgenic
mice demonstrate functional complementation of the genes encoding heavy (HLA-B27) and light (&-microglobulin) chains of
HLA class I antigens. EMBO J 6:1673-1676, 1987
27. Kavathas P, Herzenberg LA: Stable transformation of mouse L
cells for human membrane T-cell differentiation antigens, HLA
and &-microglobulin: selection by fluorescence-activated cell sorting. Proc Natl Acad Sci U S A 80:524-528, 1983
28. Koren HS, Handwerger BS, Wunderlich JR: Identification of
macrophage-like characteristics in a cultured murine tumor line.
J Immunol 114394-897, 1975
29. Grosfeld FG, Lund T, Murray EJ, Mellor AL, Dahl HHM, Flavell
RA: The construction of cosmic1 libraries which can be used to
transform eucaryotic cells. Nucleic Acids Res 10:6715-6732, 1982
30. Qin S, Wise M, Cobbold SP, Leong L, Kong YCM, Parnes JR,
Waldmann H: Induction of tolerance in peripheral T cells with
monoclonal antibodies. Eur J Immunol 20: 2737-2745, 1990
31. Moore AE, Sabachewsky L, Toolan HW: Culture characteristics of
four permanent lines of human cancer cells. Cancer Res 15598602, 1955
32. Moore M, Carbon R, Bevan M: Introduction of soluble protein
into the class I pathway of antigen processing and presentation.
Cell 54:777-785, 1988
33. Pavia CS, Schachter J: Failure to detect cell-mediated cytotoxicity
against Chlamydia trachomatis-infected cells. Infect Immun 39:
1271-1274, 1983
34. Lammert J K Cytotoxic cells induced after Chlamydia psittaci
infection in mice. Infect Immun 35:1011-1017, 1982
35. Beatty PR, Stephens RS: CD8+ T lymphocyte-mediated lysis of
Chlamydia-infected L cells using an endogenous antigen pathway.
J Immunol 153:4588-4595, 1994
36. Magee DL, Williams DM, Smith JG, Bleicker CA, Grubbs BG,
Schachter J, Rank RG: Role of CD8 T cells in primary Chlamydia
infection. Infect Immun 63:516-!i21, 1995
37. Buzoni-Gate1 D, Guilloteau L, Bernard F, Bernard S, Chardes T,
Rocca A Protection against Chlamydia psittaci in mice conferred
by Lyt-2+ T cells. Immunology 77:284-288, 1992
38. Starnbach NM, Bevan MJ, Lampe MF: Protective cytotoxic T
lymphocytes are induced during inurine infection with Chlamydia
trachomatis. J Immunol 153:518:1-5199, 1994
39. Hassell AB, Pilling D, Reynolds I), Life PF, Bacon PA, Gaston JS:
MHC restriction of synovial fluid lymphocyte responses to the
triggering organism in reactive arthritis: absence of a class
I-restricted response. Clin Exp Iinmunol 88:442-447, 1992
40. Engelhard V, Lacy E, Ridge JP: Influenza A specific, HLA-A2.1
restricted cytotoxic T lymphocytes from HLA-A2.1 transgenic
mice recognize fragments of M1 protein. J Immunol 146:12261232, 1991
41. Shirai M, Arichi T, Nishioka M, Nomura T, Ikeda K, Kawanishi K,
Engelhard VH, Feinstone SM, Berzofsky JA: CTL response of
HLA-A2.1 transgenic mice specific for hepatitis C viral peptides
predict epitopes for CTL of humans carrying HLA-A2.1. j &muno1 154:2733-2742, 1995
42. Bernard EJ, Le AXT, Barbosa JA, Lacy E, Engelhard VH:
Cytotoxic T lymphocytes from H[LA-A2 transgenic mice specific
for HLA-A2 expressed on human cells. J Exp Med 168:1157-1162,
1988
43. Vitiello A, Marchesini D, Furze J, Sherman LA, Chestnut RW.
Analysis of the HLA-restricted influenza-specific cytotoxic T lymphocyte response in transgenic mice carrying a chimeric humanmouse class I major histocompatibility complex. J Exp Med
173:1007-1015, 1991
44. Falk K, Rotzschke 0, Rammensee HG: Specificity of antigen
KUON ET AL
processing for MHC class I restricted presentation is conserved
between mouse and man. Eur J Immunol22:1323-1326, 1992
45. Frangoulis B, Reboul M, Rocca A, Pla M: Cross-reactivity among
evolutionary distant major histocompatibility complex class I
molecules (HLA-B27 and H-2Kk) revealed by xenoreactive T
lymphocytes. Eur J Immunol 23:338-342, 1993
46. Tussey LG, Rowland-Jones S, Zheng TS, Androlewicz MJ, Cresswell P, Frelinger JA, McMichael AJ: Different MHC class I
alleles compete for presentation of overlapping viral epitopes.
Immunity 3:65-77, 1995
47. Rahman MU, Cheema MA, Schumacher HR, Hudson HP: Molecular evidence for the presence of chlamydia in the synovium of
patients with Reiter’s syndrome. Arthritis Rheum 35521-529,
1992
48. Daser A, Urlaub H, Henklein P: HLA-B27 binding peptides
derived from the 57 kD heat shock protein of Chlamydia trachomatis: novel insights into the peptide binding rules. Mol Immunol
311331-336, 1994
49. Mescher MF: Surface contact requirements for activation of
cytotoxic T lymphocytes. J Immunol 149:2402-2405, 1992
50. Kovacsovics-Bankowski M, Clark K, Benacerraf B, Rock KL:
Efficient major histocompatibility complex class I presentation of
exogenous antigen upon phagocytosis by macrophages. Proc Natl
Acad Sci U S A 90:4942-4946, 1993
51. Rock KL: A new foreign policy: MHC class I molecules monitor
the outside world. Immunol Today 17:131-137, 1996
52. Nickerson CL, Hanson J, David CS: Expression of HLA-B27 in
transgenic mice is dependent on the mouse H-2D genes. J Exp
Med 172:1255-1261, 1990
53. Nickerson CL, Luthra HS, David CS: Role of enterobacteria and
HLA-B27 in spondyloarthropathies: studies with transgenic mice.
Ann Rheum Dis 49:426-433, 1990
54. Taurog JD, Lowen L, Forman J, Hammer RE: HLA-B27 in inbred
and non-inbred transgenic mice: cell surface expression and recognition as an alloantigen in the absence of human pzmicroglobulin. J Immunol 141:4020-4023, 1988
55. Kalinke U, Arnold B, Hammerling GJ: Strong xenogeneic HLA
response in transgenic mice after introducing an a3 domain into
HLA-B27. Nature 348:642-644, 1990
56. Ismail N, Chamberlain J, Inman RD: Persistence and dissemination of Yersinia enterocolitica 0:8 after intragastric challenge in
B27-transgenic mice (abstract). Arthritis Rheum 37 (suppl 9):
S211, 1994
57. Weinreich S, Eulderink F, Capkova J, Pla M, Gaede K, Heesemann J, van Alphen L, Zurcher C, Hoebe-Hewryk B, Kievits F,
Ivanyi P: HLA-B27 as a relative risk factor in ankylosing enthesopathy in transgenic mice. Hum Immunol 42:103-115, 1995
58. Khare SD, Luthra HS, David CS: Spontaneous inflammatory
arthritis in HLA-B27 transgenic mice lacking &-microglobulin: a
model of human spondyloarthropathies. J Exp Med 182:11531158, 1995
59. Madden DR, Gorga JC, Strominger JL, Wiley DC: The structure
of HLA-B27 reveals nonamer self-peptides bound in an extended
conformation. Nature 353:321-325, 1991
60. Tanigaki N, Fruci D, Vigneti E, Staraca G, Roverso P, Londei M,
Butler RH, Tosi R: The peptide binding specificity of HLA-B27
subtypes. Immunogenetics 40:192-198, 1994
61. Falk K, Rotzschke 0, Stevanovic S, Jung G, Rammensee HG:
Allele-specific motifs revealed by sequencing of self-peptides
eluted from MHC molecules. Nature 351:290-296, 1991
62. Wucherpfennig KW, Strominger JL: Molecular mimicry in T cell
mediated autoimmunity: viral peptides activate human T cell
clones specific for myelin basic protein. Cell 80:695-705, 1995
Документ
Категория
Без категории
Просмотров
0
Размер файла
1 018 Кб
Теги
hla, transgenic, mice, antigen, cba, chlamydia, b27, recognition, cytotoxic, restricted, 178040052705, cells
1/--страниц
Пожаловаться на содержимое документа