close

Вход

Забыли?

вход по аккаунту

?

Study on the Autophagy of Prostate Cancer PC-3 Cells Induced by Oridonin.

код для вставкиСкачать
THE ANATOMICAL RECORD 295:417–422 (2012)
Study on the Autophagy of Prostate
Cancer PC-3 Cells Induced by Oridonin
LI-HONG YE,* WANG-JIAN LI, XIAO-QIANG JIANG, YONG-LIANG CHEN,
SHUI-XIANG TAO, WEI-LIANG QIAN, AND JIAN-SONG HE
Department of Urology Surgery, Shaoxing County Central Hospital,
Shaoxing 312030, China
ABSTRACT
To investigate the mechanism of oridonin (ORI)-induced autophagy in
prostate cancer PC-3 cells, PC-3 cells cultured in vitro were treated with
ORI, and the inhibitory ratio of ORI on PC-3 cells was assayed by 3-4,5dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide. The ultrastructural changes of the cells were observed under light microscope, scanning
electron microscope (SEM), and transmission electron microscope (TEM).
Acridine orange (AO) staining was used to observe the acidic vesicular
organelles (AVOs). The level of autophagy-related proteins, MAP1-LC3,
was detected by Western Blot, and RT-PCR was used to detect the level
of mRNA of beclin 1. After ORI treatment, the proliferation of PC-3 cells
was inhibited significantly in a concentration and time-dependent manner. SEM examination revealed cellular shrinkage and disappearance of
surface microvilli in ORI-treated cells. Under TEM examination, the
nuclei exhibited chromatin condensation and the appearance of a large
number of autophagosomes with double-membrane structure in cytoplasm. AO staining showed the existence of AVOs. The expression of LC3
and the mRNA level of beclin 1 was increased by ORI. Furthermore,
autophagy inhibitor 3-methyladenine reversed the increase of beclin 1
mRNA. The growth of PC-3 cells was inhibited, and autophagy was
induced by ORI, indicating ORI may have a potential antitumor effect.
C 2011 Wiley Periodicals, Inc.
Anat Rec, 295:417–422, 2012. V
Key words: oridonin; prostate cancer; autophagy; beclin 1
Oridonin (ORI), a diterpenoid extracted from
Rabdosia rubescens, has been proven to have effective
antitumor activity, in addition to its potential as an
anti-inflammatory and antibacterial drug. It has been
reported that ORI could significantly inhibited cell
growth in ehrlich ascites carcinoma (EAC), sarcoma
S180, mouse Leukemia P388 and L1210, and other
transplantable tumors (Fujita et al., 1981). Meanwhile,
ORI also has been widely used for the treatment of
solid tumors, such as esophageal and gastric cancers,
and has achieved significant clinical benefit (Han et al.,
2003). Therefore, ORI can potentially be very effective
antitumor drug.
Autophagy is a ubiquitous process of nonapoptotic
form of programmed cell death (PCD). In this process,
formation of double-membrane vesicular structures, containing damaged organelles and part of cytosol, is
caused. The vesicles subsequently delivered their contents to lysosome for degradation. Therefore, autophagy
is a process of self-digestion and recycling of cellular
C 2011 WILEY PERIODICALS, INC.
V
constituents, which helps cells to survive longer from
starve. However, excessive autophagy can lead to autophagic cell death, which is termed type II PCD. In
recent years, it has been reported that ORI could induce
autophagy in HeLa, A431, and several other cancer cell
lines and delay the occurrence of apoptosis (Cui et al.,
2006; Cui et al., 2007a).
However, the involvement of ORI-induced autophagy
in prostate cancer has not been reported. In this study,
we investigated the mechanism of ORI-induced autophagy in prostate cancer PC-3 cells in order to provide
Grant sponsor: Zhejiang TCM Science Foundation; Grant
number: 08029.
*Correspondence to: Dr. Li-Hong Ye, Department of Urology
Surgery, Shaoxing County Central Hospital, Shaoxing 312030,
China. Fax: þ086-84122298. E-mail: ylh7966@126.com
DOI 10.1002/ar.21528
Published online 20 December 2011 in Wiley Online Library
(wileyonlinelibrary.com).
418
YE ET AL.
experimental evidence for the development of new antitumor natural medicine.
MATERIAL AND METHODS
Reagents
ORI purchased from the Wuhan Botanical Garden,
China, was extracted as described previously by Jian
et al. (2007) and detected by RP-HPCL (=98%). 3-4,5Dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide
(MTT) and 3-methyladenine (3-MA) were purchased
from SIGMA. F-12 medium was purchased from GIBCO,
and fetal bovine serum (FBS) was obtained from ExCell
Biology. Acridine orange (AO) was purchased from
Fluka. The mouse monoclonal GAPDH antibody and
goat LC3 antibody were obtained from Santa Cruz.
Reverse transcription reagents and primers were purchased from Invitrogen.
Cell Culture
Prostate cancer PC-3 cells, preserved in our laboratory
and obtained from ATCC, were seeded in F-12 medium
(10% FBS, 100 U/L penicillin and streptomycin) and
maintained at 37 C in a humidified atmosphere of 5%
CO2. PC-3 cells were incubated with increasing concentrations of ORI drug. The control group was treated
with equal-volume DMSO instead of drug.
MTT Assay
During the logarithmic growth phase, cells were
digested with trypsin, suspended in F-12 medium (5 104 cells/mL), then cultured in 96-well plates (100 lL/
well). After 24 hr, the original media was removed and
replaced with new culture medium containing various
concentrations of ORI (5, 10, 15, 25, 50, and 100 lmol/
L). Each treatment was performed in triplicate and
treated for 24 or 48 hr. Then the culture medium was
replaced with 100 lL DMSO. After shaking on a rocker
for 30 min, OD values were read on 128-C enzymelinked immunosorbent assay reader (CliniBio) at 492 nm
wavelength, and the inhibition rate was calculated.
Scanning Electron Microscopy
PC-3 cells in the logarithmic phase were inoculated on
sterilized cover slips covered with 1% paraformaldehyde
in 24-well plates. After culture for 48 hr, cells were treated
with 15 lmol/L ORI for 24 hr, washed with PBS two times,
fixed in 2.5% glutaraldehyde at 4 C for 2 hr, and then
washed again. Subsequently, it was dehydrated with 50%,
70%, 80%, 90%, and 100% ethanol gradient followed by
further dehydration in 100% acetone for 15 min and
finally washed in isoamyl acetate for 15 min. Critical
point-dried in CO2, sputter-coated with gold and examined
under scanning electron microscope (SEM; STEREOSCAN
260) with an accelerating voltage of 20 kV.
Transmission Electron Microscopy
PC-3 cells cultured in 100-mL flasks were treated
with DMSO or ORI. After that, cells were collected,
washed with PBS, fixed in 2.5% glutaraldehyde at 4 C
for 2 hr, and then washed again twice with PBS. The
material was dehydrated in a graded series of ethanol
Fig. 1. Growth curves of PC-3 cells detected by MTT assay. A: ORI
inhibited the proliferation of PC-3 cells. Cells were treated with different concentrations of ORI (5, 10, 15, 25, 50, and 100 lmol/L) for 24
and 48 hr, and then detected. B: Comparison of the effects of DMSO
and ORI on cell proliferation.
(50%, 70%, 80%, 90%, and 100%) and acetone for 15 min
each and embedded in Epon 812. Ultrathin sections
were stained with uranyl and lead acetates and examined under transmission electron microscope (TEM;
Philips Tecnai 10) at 80 kV.
AO Staining
PC-3 cells were seeded on sterilized cover slips covered with 1% paraformaldehyde in 24-well plates
(50,000 cells per well). After cultured for 24 hr, cells
were treated with ORI for 24 hr, washed with PBS at
4 C twice, and stained with AO dye for 10 min in dark.
Subsequently, cells were washed again and examined
under a fluorescence microscope.
Western Blot
Cells treated with different ORI concentrations were
collected and washed with PBS, and protein was
extracted from lysates (Lowry method). Bicinchoninic
acid protein assay kit (Pierce) was used to determine
protein concentration. Equal denatured protein (50 lg)
was separated by 12% SDS-PAGE electrophoresis and
transferred to PVDF membrane. After blocked for 4 hr
with nonfat dry milk, the blots were incubated with a
dilution of primary antibody overnight and respective
secondary antibody for 2 hr at room temperature. Immunoblots were developed by enhanced chemiluminescence.
THE AUTOPHAGY OF PROSTATE CANCER PC-3 CELLS INDUCED BY ORIDONIN
419
Fig. 2. Morphological changes of ORI-treated PC-3 cells. Cells were treated with 20 lmol/L ORI for 24
hr and observed under Optical microscope (A, 200), or scanning electron microscope (B).
RT-PCR
Cells cultured in six-well plates were treated with
ORI and lysed in 1 mL TRIzol for 5 min at room temperature to extract total RNA. Then RNA was reverse
transcribed into cDNA and amplified using PCR. Amplification conditions were as follows: 94 C for 5 min; 94 C
for 1 min; 52 C for 1 min; 72 C for 1 min; 30 cycles;
72 C for 10 min. The primer sequences were as follows:
• GAPDH forward: CCAGCCGAGCCACATCGCTC,
• GAPDH reverse: ATGAGCCCCAGCCTTCTCCAT (588 bp);
• beclin 1 forward: TGGATCACCCACTCTGTGAG,
• beclin 1 reversed: TTATTGGCCAGAGCATGGAG3
(569 bp).
39.95 6 3.05% after 24 hr, and reached 51.28 6 2.91%
after 48 hr. When the concentration of ORI was
increased to 25 lmol/L, the inhibition rate was increased
to 67.94 6 4.78% (Fig. 1A). When compared with ORI,
equal concentrations of DMSO solvent mildly promote
proliferation of PC-3 cells (Fig. 1B). Under light microscope, cells treated with ORI at the concentration of 20
lmol/L (IC50 for 24 hr) for 24 hr were observed. We
found cells reduced in number and appeared shrunken
and rounded (Fig. 2A). Under SEM, drug-treated fusiform cells were found to became round, and microvilli
on cell surface disappeared (Fig. 2B). The results suggested that ORI could inhibit prostate cancer PC-3 cell
proliferation significantly in a concentration- and timedependent manner.
RESULTS
ORI Inhibited the Proliferation of PC-3 Cells
Formation of Autophagy in ORI-treated PC-3
Cells
Different concentrations of ORI (5, 10, 15, 25, 50, and
100 lmol/L) were treated PC-3 cells for 24 or 48 hr, and
then cell viability was assayed by MTT. At the concentration of 15 lmol/L, the inhibition rate of ORI was
Under TEM, control cells presented abundant of
microvilli on cell surface, normal nucleo and nuclear-tocytoplasmic (N/C) ratio was 1:1 (Fig. 3A). PC-3 cells
treated with ORI at the concentration of 20 lmol/L for
420
YE ET AL.
Fig. 3. Ultrastructural changes of ORI-treated PC-3 cells observed under TEM. Cells were treated with
DMSO or 20 lmol/L ORI for 24 hr, and then observed. (A) Normal control; (B) Drug-treated cells; (C) Autophagosome with double membrane (arrow).
Fig. 4. Detection of acidic vesicular organelles (AVOs) with AO staining. Cells were treated with DMSO
or 20 lmol/L ORI for 24 hr, and then stained and observed. Red fluorescent spots indicated AVOs. (A)
DMSO control group; (B) Drug-treated group (200).
24 hr appeared to have shrunken cell nuclei with the
integration of crescent-shaped chromatin, and the N/C
ratio increased (Fig. 3B). Additionally, we observed existence of a large number of autophagic bodies with
double membrane, containing portions of the cytoplasm
and damaged organelles (Fig. 3C). By vital AO staining,
control cells showed homogeneous green fluorescence in
cytoplasm, while there were red fluorescent spots
appeared in ORI-treated cells (Fig. 4), which suggested
that ORI treatment caused formation of acidic vesicular
organelles (AVOs) in PC-3 cells. Western blot showed
that the expression of LC3-I protein increased in the
PC-3 cells treated with low concentrations of ORI (10
lmol/L), but LC3-II protein was not detected. When the
concentration of ORI was increased to 20 and 40 lmol/L,
the expression of LC3-I protein decreased, while the
expression of LC3-II protein was increased significantly
(Fig. 5). This suggested that ORI increased the expression of LC3 protein and promoted the modification of
LC3-I to LC3-II. Our results showed that ORI can
induce autophagy in prostate cancer PC-3 cells.
Elevation of Beclin 1 mRNA Level Was Involved
in ORI-Induced Autophagy
RT-PCR results showed that with the concentration of
ORI increased, the beclin 1 mRNA levels increased in a
concentration-dependent manner (Fig. 6A). Treatment of
autophagy inhibitor 3-MA did not change beclin 1
mRNA levels in PC-3 cells. However, combined treatment of ORI and 3-MA could prevent ORI-induced
upregulation of beclin 1 mRNA levels (Fig. 6B). The
THE AUTOPHAGY OF PROSTATE CANCER PC-3 CELLS INDUCED BY ORIDONIN
421
Fig. 5. The expression levels of LC3 protein examined by Western
Blotting. The expression of LC3 protein was increased by ORI. Cells
were treated with DMSO or different concentrations of ORI (20 or 40
lmol/L).
results suggest that ORI promotes beclin 1 gene expression at the transcriptional level, and this gene is
involved in the regulation of ORI-induced autophagy.
DISCUSSION
ORI has varied pharmacologic activities, such as antiinflammatory, antibacterial, and antitumor activities. It
can inhibit proliferation of tumor cells in breast cancer,
colon cancer, and liver cancer and induce apoptosis in
various cancer cell lines. ORI has been reported to block
breast cancer cell line MCF-7 in S phase (Cui et al.,
2007b) and colon cancer cell line HT29 in G2/M phase
(Zhu et al., 2007) and induce characteristic apoptotic
changes in hepatocellular carcinoma cell line BEL-7402
(Zhang et al., 2006), breast cancer cell line MCF-7 (Cui
et al., 2007b) and human cervical cancer cells HeLa
(Zhang et al., 2004).
Ikezoe et al. (2003) found that ORI can inhibit androgen-dependent prostate cancer cell line LNCaP
proliferation and block cells in the G0/G1 phase by upregulating p21WAF1 protein in a p53-dependent manner.
However, the role of ORI in androgen-independent prostate cancer cell line PC-3 has not been reported.
Therefore, we investigated the potential application of
ORI in prostate cancer treatment. ORI was found to inhibit prostate cancer PC-3 cells significantly in a
concentration- and time-dependent manner. We further
studied the mechanisms of ORI-induced autophagy in
PC-3 cells. After ORI treatment, there were a large
number of autophagosomes and pre-autophagosomal
structure with double-membrane in cytoplasm, associating with formation of AVOs, and conversion of LC3-I
protein to LC3-II. ORI promoted transcription of beclin
1, which can be reversed by autophagy inhibitor 3-MA.
Cui et al. (2006) found ORI-induced apoptosis, accompanied by the occurrence of autophagy at the same time
in HeLa cells treated with ORI, indicating ORI had
autophagy-inducing activity. In this study, we observed
exist of autophagosome in ORI-treated cells for the first
time. The occurrence of autophagosomes is a gold standard to determine autophagy. Therefore, our results
provide strong evidence for autophagy-inducing activity
of ORI. Autophagosome further fuses with lysosome to
form autolysosome that is one kind of AVO structures.
Because of this, formation of AVOs is another important
indicator of autophagy and has been reported to be
induced by various autophagic inducer, including radiation or ceramide (Daido et al., 2004; Paglin et al., 2001).
Fig. 6. ORI-induced transcription of the beclin 1 gene in PC-3 cells.
A: The level of beclin 1 mRNA was upregulated in ORI-treated cells.
Cells were treated with DMSO or different concentrations of ORI for
24 hr, and the level of mRNA was detected by RT-PCR. B: Inhibitor of
autophagy 3-MA blocked increase of mRNA transcription. Cells were
treated by ORI (20 lmol/L) with or without 3-MA (5 mmol/L).
Therefore, we determined the effect of ORI on the formation of AVOs in PC-3 cells by lysosomotropic agent AO
staining and fluorescence microscopy. AO is a weak base
that will accumulate in acidic compartments and form
red fluorescence aggregates. MAP-LC3, the mammalian
homolog of yeast Atg8, is an important marker of
autophagy. LC3-I, evenly distributed throughout the
cytoplasm, can be ubiquitin-like modified to LC3-II during autophagy, which associated with autophagosome
membrane. LC3-II was further degraded by lysosomal
hydrolases in lysosome. Therefore, LC3-I/ LC3-II ratio or
LC3-II levels indicate the level of autophagy. Our
research suggested that low concentrations of ORIinduced initial occurrence of autophagy but did not form
mature autophagosomes. When concentration of ORI
was increased, LC3-I/ LC3-II ratio decreased, indicating
mature autophagosomes was formed. Thus, ORI-induced
autophagy in PC-3 cells in a concentration-dependent
manner.
Autophagic phenomenon was first observed in liver
cells of glucagon-treated mice by Ashford et al. (1962).
As a cell survival mechanism, autophagy plays important roles in physiological clearing cell process, such as
clearing damaged organelles. Nevertheless, excessive
activation of autophagy can lead to cell death. It has
been reported that autophagy was involved in tumor development. In early stage, autophagy inhibited tumor
development (Gozuacik and Kimchi, 2004). While in
advanced stages, autophagy helped cells to resist starvation and promoted cell growth (Cuervo, 2004). In
addition, autophagy may protect several cancer cells
from radiation damage. Because of its two-way effect in
tumor development, induction or inhibition of autophagy
determine the efficacy of anticancer drugs. ORI has been
demonstrated to induce autophagy in human breast
422
YE ET AL.
cancer MCF-7 cells and mouse fibroblast L929 cells.
Furthermore, inhibition of autophagy in these two models could upregulate apoptosis (Cui et al., 2007a; Cheng
et al., 2008). Our study found that induction of autophagy may be possible mechanism of ORI antiprostate
cancer activity.
Beclin 1 is the mammalian homolog of yeast autophagy
protein Atg6 and plays an important role in formation of
autophagy. It is involved in vacuolar transport via the
cytoplasm-to-vacuole targeting (Cvt) pathway and the
vacuolar protein-sorting (Vps) pathway. High-frequency
monoallelic deletion of beclin 1 has been reported in
human breast cancer, ovarian cancer, and prostate cancer.
In MCF-7 cells, expression of beclin 1 protein was so low
that it almost failed to detect, whereas stable tranfection
of beclin 1 promoted autophagy in MCF-7 cells and
reduced tumorigenic ability (Zhang et al., 1999). Broadspectrum caspase inhibitor zVAD has been demonstrated
to inhibit activity of caspase-8 and induce autophagic cell
death, in which Atg7 and beclin 1 genes played an essential role (Yu et al., 2004). Thus, beclin 1 may be a crossed
protein in regulation of autophagy and apoptosis. Induction of autophagy may be the possible mechanism of
several antitumor drugs, such as tamoxifen widely used
in breast cancer therapy. Mediated by ceramide, tamoxifen could upregulate expression of Beclin 1 and activate
cell autophagy (Scarlatti et al., 2004). ORI has been
reported to increase expression of Beclin 1 in HeLa cells
through Ras, JNK, and p38 regulation, which could be
reversed by autophagy inhibitor 3-MA (Cui et al., 2007c).
In our experiment, ORI promoted mRNA synthesis of
beclin 1 gene, suggesting that ORI regulate beclin 1
expression at the transcriptional level. In addition, ORI
treatment could decrease expression of antiapoptotic
proteins Bcl-2, Bcl-xL, and promote the release of mitochondrial cytochrome C (Li et al., 2007; Liu et al., 2006).
By interfering formation of Beclin-Ptdlns 3-kinase complex, Bcl-2 could inhibit activity of PtdIns 3-kinase and
beclin 1-dependent autophagy (Cao and Klionsky, 2007).
Therefore, we presumed that mitochondrial pathway
may be involved in the regulation of ORI-induced beclin
1 expression. Although ORI treatment had been shown to
induce conversion of LC3-I to LC3-II in A431 cells,
but the expression of Beclin 1 protein was inhibited,
suggesting that not all ORI-induced autophagy is beclin
1-dependent (Li et al., 2007). Therefore, there is different
mechanism of ORI-induced autophagy in different tumor
cells.
Our study demonstrated that ORI could induce beclin
1-dependent autophagic in prostate cancer PC-3 cells,
and upregulate beclin 1 expression at the transcriptional
level. The results of this study provide the theoretical
basis for clinical application of ORI in prostate cancer.
LITERATURE CITED
Ashford TP, Porter KR. 1962. Cytoplasmic components in hepatic
cell lysosomes. J Cell Biol 12:198–202.
Cao Y, Klionsky DJ. 2007. Physiological functions of Atg6/Beclin 1:
a unique autophagy-related protein. Cell Res 17:839–849.
Cheng Y, Qiu F, Huang J, Tashiro S, Onodera S, Ikejima T. 2008.
Apoptosis-suppressing and autophagy-promoting eects of calpain
on oridonin-induced L929 cell death. Arch Biochem Biophys 475:
148–155.
Cuervo AM. 2004. Autophagy: in sickness and in health. Trends
Cell Biol 14:70–77.
Cui Q, Tashiro S, Onodera S, Ikejima T. 2006. Augmentation of
oridonin-induced apoptosis observed with reduced autophagy.
J Pharmacol Sci 101:230–239.
Cui Q, Tashiro S, Onodera S, Minami M, Ikejima T. 2007a. Autophagy preceded apoptosis in oridonin-treated human breast cancer
MCF-7 cells. Biol Pharm Bull 30:859–864.
Cui Q, Yu JH, Wu JN, Tashiro S, Onodera S, Minami M, Ikejima T.
2007b. P53-mediated cell cycle arrest and apoptosis through a
caspase-3-independent, but caspase-9-dependent pathway in oridonin-treated MCF-7 human breast cancer cells. Acta Pharmacol
Sin 28:1057–1066.
Cui Q, Tashiro S, Onodera S, Minami M, Ikejima T. 2007c. Oridonin
induced autophagy in human cervical carcinoma HeLa cells
through Ras, JNK, and P38 regulation. J Pharmacol Sci 105:
317–325.
Daido S, Kanzawa T, Yamamoto A, Takeuchi H, Kondo Y, Kondo S.
2004. Pivotal role of the cell death factor BNIP3 in ceramideinduced autophagic cell death in malignant glioma cells. Cancer
Res 64:4286–4293.
Fujita E, Nagao Y, Kohno T, Matsuda M, Ozaki M. 1981. Antitumor
activity of acylated oridonin. Chem Pharm Bull (Tokyo) 29:
3208–3213.
Gozuacik D, Kimchi A. 2004. Autophagy as a cell death and tumor
suppressor mechanism. Oncogene 23:2891–2906.
Han QB, Li ML, Li SH, Mou YK, Lin ZW, Sun HD. 2003. Ent-kaurane diterpenoids from Isodon rubescens var. lushanensis. Chem
Pharm Bull (Tokyo) 51:790–793.
Ikezoe T, Chen SS, Tong XJ, Heber D, Taguchi H, Koeer HP. 2003.
Oridonin induces growth inhibition and apoptosis of a variety of
human cancer cells. Int J Oncol 23:1187–1193.
Jian G, Wang YW, Lu XC, Cao JY. 2007. Determination of oridonin
in rat plasma by reverse-phase high-performance liquid chromatography. J Pharm Biomed Anal 43:793–797.
Li D, Cui Q, Chen SG, Wu LJ, Tashiro S, Onodera S, Ikejima T.
2007. Inactivation of ras and changes of mitochondrial membrane
potential contribute to oridonin-induced autophagy in a431 cells.
J Pharmacol Sci 105:22–33.
Liu JJ, Huang RW, Lin DJ, Wu XY, Peng J, Pan XL, Lin Q, Hou M,
Zhang MH, Chen F. 2006. Antiproliferation eects of oridonin on
HPB-ALL cells and its mechanisms of action. Am J Hematol 81:
86–94.
Paglin S, Hollister T, Delohery T, Hackett N, McMahill M, Sphicas
E, Domingo D, Yahalom J. 2001. A novel response of cancer cells
to radiation involves autophagy and formation of acidic vesicles.
Cancer Res 61:439–444.
Scarlatti F, Bauvy C, Ventruti A, Sala G, Cluzeaud F, Vandewalle
A, Ghidoni R, Codogno P. 2004. Ceramide-mediated macroautophagy involves inhibition of protein kinase B and up-regulation of
beclin 1. J Biol Chem 279:18384–18391.
Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S, Baehrecke EH,
Lenardo MJ. 2004. Regulation of an ATG7-beclin 1 program of
autophagic cell death by caspase-8. Science 304:1500–1502.
Zhang CL, Wu LJ, Tashiro S, Onodera S, Ikejima T. 2004. Oridonin
induces apoptosis of HeLa cells via altering expression of Bcl-2/
Bax and activating caspase-3/ICAD pathway. Acta Pharmacol Sin
25:691–698.
Zhang JF, Liu JJ, Liu PQ, Lin DJ, Li XD, Chen GH. 2006. Oridonin
inhibits cell growth by induction of apoptosis on human hepatocelluar carcinoma BEL-7402 cells. Hepatol Res 35:104–110.
Zhang Y, Kou X, Lu J, Wang G. 1999. Study on the inclusion of oridonin-beta-cyclodextrin. Zhong Yao Cai 22:204–205.
Zhu Y, Xie L, Chen G, Wang H, Zhang R. 2007. Eects of oridonin on
proliferation of HT29 human colon carcinoma cell lines both
in vitro and in vivo in mice. Pharmazie 62:439–444.
Документ
Категория
Без категории
Просмотров
3
Размер файла
1 346 Кб
Теги
cancer, induced, stud, autophagy, oridonin, prostate, cells
1/--страниц
Пожаловаться на содержимое документа