close

Вход

Забыли?

вход по аккаунту

?

The Divergent Development of the Apical Ectodermal Ridge in the Marsupial Monodelphis domestica.

код для вставкиСкачать
THE ANATOMICAL RECORD 293:1325–1332 (2010)
The Divergent Development of the Apical
Ectodermal Ridge in the Marsupial
Monodelphis Domestica
CAROLYN K. DOROBA1 AND KAREN E. SEARS1,2*
Department of Animal Biology, School of Integrative Biology, University of Illinois,
Urbana, Illinois
2
Regenerative Biology and Tissue Engineering Theme, Institute for Genomic Biology,
University of Illinois, Urbana, Illinois
1
ABSTRACT
Marsupials give birth after short gestation times to neonates that
have an intriguing combination of precocial and altricial features, based
on their functional necessity after birth. Perhaps most noticeably, marsupial newborns have highly developed forelimbs, which provide the propulsion necessary for the newborn’s crawl to the teat. To achieve their
advanced state at birth, the development of marsupial forelimbs is accelerated. The development of the newborn’s hind limb, which plays no part
in the crawl, is not accelerated, and is likely even delayed. Given the
large differences in the rate of limb outgrowth among marsupials and placentals, we hypothesize that the pathways underlying the early development and outgrowth of marsupial limbs, especially that of their forelimbs,
will also be divergent. As a first step toward testing this, we examine the
development of one of the two major signaling centers of the developing
limb, the apical ectodermal ridge (AER), in a marsupial, Monodelphis
domestica. We found that, while both opossum limbs have reduced physical AER’s, in the opossum forelimb this reduction has been taken to the
extreme. Where the M. domestica forelimb should have an AER, it
instead has only a few patches of disorganized cells. These results make
the marsupial, M. domestica, the only known amniote (without reduced
limbs) to exhibit no morphological AER. However, both M. domestica
limbs normally express Fgf8, a molecular marker of the AER. Anat Rec,
C 2010 Wiley-Liss, Inc.
293:1325–1332, 2010. V
Key words: development; limb; marsupial; AER; opossum
INTRODUCTION
When marsupials are born, they are at a stage of development that appears premature to that of newborn
placentals. For example, the overall state of development
of a marsupial newborn resembles an 11– or 12-day-old
embryonic mouse or a 10- to 12-week-old embryonic
human (Hughes and Hall, 1984; Vaglia and Smith,
2003). Despite their generally altricial state, marsupial
newborns immediately complete a life or death crawl
from the birth canal to the teat where they attach and
complete much of their development (Sharman, 1973;
Gemmell et al., 2002). To make this crawl, the newborns
pull their bodies along using their large, precocially
developed forelimbs (Fig. 1). The hind limb, which is still
at a very rudimentary stage of development, is not
C 2010 WILEY-LISS, INC.
V
involved in this crawl. The maturation rate of marsupial
forelimbs is accelerated, and that of the hind limb
delayed, to create these divergent limb morphologies at
birth (Bininda-Emonds et al., 2003; Bininda-Emonds
et al., 2007; Harrison and Larsson, 2008; Weisbecker
*Correspondence to: Dr. Karen E. Sears, 465 Morrill Hall,
505 South Goodwin Avenue, School of Integrative Biology and
Institute for Genomic Biology, University of Illinois, Urbana, IL
61801. Fax: 217-244-7724.
E-mail: kesears@alumni.uchicago.edu
Received 17 November 2009; Accepted 24 March 2010
DOI 10.1002/ar.21183
Published online 17 May 2010 in Wiley InterScience (www.
interscience.wiley.com).
1326
DOROBA AND SEARS
Fig. 1. Scanning electron microscope (SEM) images of M. musculus (Mus; mouse) and M. domestica (Md; opossum) limbs. Both the
mouse forelimb (E) and the opossum hind limb (F) display a welldeveloped, protruding apical ectodermal ridge running along the DV
boundary of the developing limb bud at limb Stage (L) 5. In contrast,
the opossum forelimb has scattered clumpings of cells along the DV
boundary, but no protruding ridge at any examined limb stage (limb
Stage 4–A and close-up in G, limb Stage 5–B and close-up in H, limb
Stage 6–C, limb Stage 7–D). D ¼ dorsal; V ¼ ventral. Arrows indicate
the DV boundary of the limb, and the AER (if present). Scale-bars represent 50 microns.
et al., 2008; Sears, 2009; Werneburg and Sánchez-Villagra, in press).
The acceleration of opossum forelimb development
begs the question–are changes in early limb development responsible for this phenomenon? To answer this
question, we have to explore the mechanisms controlling
limb development. There are two major signaling centers
responsible for limb outgrowth and patterning in
amniotes–the zone of polarizing activity (ZPA) and the
apical ectodermal ridge (AER). The ZPA is found in the
posterior mesenchyme of the developing limb bud and
provides important molecular signals for positioning the
anteroposterior axis of the limb. In contrast, the AER is
a visible ridge at the distal tip of the limb bud that protrudes along the dorsoventral (DV) boundary (Capdevila
and Belmonte, 2001). The physical manifestation of the
AER forms through a thickening of the epithelium along
the tip of the limb (Niswander, 2003). The AER has several important functions during limb development, and
plays a large role in both distal outgrowth of the limb
and DV patterning (for reviews see Niswander, 2003;
Fernandez-Teran and Ros, 2008). Surgical removal of
the AER from the developing limb bud results in progressive truncation of the limb and loss of distal elements, depending on when the AER is removed
(Saunders, 1948; Summerbell, 1974). Furthermore, tetrapods with reduced limbs (e.g., whales and snakes) are
thought to have achieved their specialized limb morphology through, at least in part, reductions in their physical
AER’s (Cohn and Tickle, 1999; Thewissen et al., 2006).
THE MARSUPIAL APICAL ECTODERMAL RIDGE
However, although the molecules produced by the AER
are essential to limb outgrowth (Niswander et al., 1993;
Fallon et al., 1994), experimental manipulation suggests
that its physical manifestation is not (Errick and Saunders, 1974, 1976). Therefore, the actual role of the physical AER in tetrapod limb development remains
unknown.
Because of the integral role of the AER in limb outgrowth, we hypothesize that, over the course of evolution, development of the marsupial AER was altered to
help achieve or in response to the rapid outgrowth of
their forelimbs. To test this hypothesis, we compare the
morphological (at the gross and cellular level) and molecular development of the AER in the fore- and hind
limbs of the marsupial M. domestica. Among marsupials,
we have targeted M. domestica because of its ease of use
as a laboratory mammal (Keyte and Smith, 2008), and
its placement among the most basal of living marsupials
(Horovitz et al., 2009). In terms of the molecular development of the AER, fibroblast growth factors (FGF’s) are
the key molecular factors required for AER function.
This was conclusively established through physical
manipulations in which Fgf soaked beads were found to
have the capability of rescuing proximo-distal development of the limb after AER removal (Niswander et al.,
1993; Fallon et al., 1994), and genetic manipulations, in
which it was found that in the complete absence of Fgf8
and Fgf4 limbs fail to form (Sun et al., 2002). Four Fgf ’s
are expressed in the AER: Fgf8 which is expressed
throughout the AER, and Fgf4, Fgf9, and Fgf17 which
are restricted to the posterior and distal AER (Niswander, 2003). Of these, the expression of Fgf8 is considered
a synonymous marker for the AER, given that its temporal and spatial expression matches the AER’s entire duration in mouse and chick (Fernandez-Teran and Ros,
2008). Therefore, because of its importance in AER function, we focus our molecular research on the levels and
patterns of expression of Fgf8 in the developing marsupial AER. We also compare AER development in marsupial limbs to that in a placental mammal, the mouse
(Mus musculus).
By taking this approach, this study has the potential
to provide insights into not only the evolutionary
changes that led to the highly derived development of
marsupial limbs, but also the function of the morphological AER, a prominent outstanding question in the field
of limb developmental biology.
MATERIALS AND METHODS
Specimens
M. domestica (opossum) and Mus musculus (mouse)
embryos were obtained from in-house colonies maintained by the Sears laboratory. To obtain timed mating,
male and female opossums were placed together and
filmed using an infrared camera from 7 to 11 pm daily,
and the time of mating noted. Mice were checked for
vaginal plugs every morning, and if plugs were discovered, mating was assumed to have taken place at midnight the night before.
Opossum embryos were staged according to criteria
originally developed by McCrady (1938) for Didelphis
and modified by Mate et al. (1994) and Kathleen Smith
(Duke University, personal communication). For the
opossum forelimb, multiple embryos from Stages 28, 29,
1327
and 30 were examined, and for the opossum hind limb,
multiple embryos from Stages 31, 32, and 33 were examined. Limbs from these embryos were staged according
to the guide established for mice by Wanek et al. (1989)–
hereafter called ‘‘limb stages.’’ For the forelimb, Stage 28
encompassed limb Stages 3 and 4, Stage 29 encompassed
limb Stages 5 and 6, and Stage 30 encompassed limb
Stages 7 and 8. For the hind limb, Stage 31 encompassed limb Stage 4, Stage 32 encompassed limb Stages
5 and 6, and Stage 33 encompassed limb Stages 7 and 8
(Table 1). As described by Wanek et al. (1989), limb
Stages 4 through 7 captures the transition from a budlike to paddle-like limb. These stages also encompass the
entire duration of a prominent, physical AER in mice. In
mice, the future AER begins to thicken in limb Stage 3,
and is prominent during limb Stages 4 through 6. During limb Stage 7, the prominence of the AER begins to
reduce (Table 1; Wanek et al., 1989; Fernandez-Teran
and Ros, 2008). For comparative purposes, mice from
embryonic days 10.5 to 12 post-fertilization were also
examined. Limb stages for these mouse embryos were
also determined by comparison with Wanek et al. (1989)
(Table 1).
Histology and Electron Microscopy
For histological analysis, embryos were fixed in 4%
paraformaldehyde, then rinsed stepwise into 100% methanol and stored at 20 C until used. For histological
preparation, embryos were rinsed stepwise into 100%
PBS, then left in 30% sucrose in 4oC overnight. Embryos
were then soaked in OCT compound at room temperature for 1 h. Limbs were then flash-frozen in OCT compound after being aligned for sectioning in the
appropriate plane (in this case sagittal). Sagittal histological sections were taken at 10 um using a cryosectioner. Samples were stained with hematoxylin and
eosin to visualize cellular morphology (Nagy et al.,
2002).
For scanning electron microscopy (SEM), embryos
were fixed in 2% paraformaldehyde and 2.5% gluteraldehyde, then stained with 1% osmium tetroxide before
being brought stepwise into 100% ethanol for storage at
20 C until used (Nagy et al., 2002). To prepare for
SEM, embryos were dried in a critical point drier, then
sputter coated with gold palladium. Embryo morphology
was then visualized using an Environmental Scanning
Electron Microscope (ESEM; Phillips Xl30 ESEM-FEG
manufactured by FEI Company) housed in the Imaging
Technology Group of the Beckman Institute (University
of Illinois).
In Situ Hybridization and Semi-Quantitative
RT-PCR
Embryos for in situ hybridization were dissected in 1X
DEPC PBS, fixed in 4% paraformaldehyde, then rinsed
stepwise into 100% methanol and stored at 20 C until
used. In situ hybridization for Fgf8 was performed on
whole-mount specimens using digoxygenin-labeled RNA
probes derived from mouse sequences (Tanaka et al.,
1992), which also recognize the opossum transcript
(Nagy et al., 2002). Fgf8 expression was assayed in opossum forelimbs of Stages 28 through 30, and opossum
hind limbs of Stages 30 through 32.
1328
AER reducing
Early Stage 33
AER reducing
E12
AER reducing
E13
AER prominent
E12
E12
AER prominent
Late Stage 32
AER prominent
AER prominent
AER prominent
Early Stage 32
E12
E12
AER prominent
E12
AER prominent
E11
Nearly continuous
cell clumps at
DV boundary
AER prominent
Early Stage 29
Late Stage 29
Early Stage 30
Stage 5
Stage 6
Stage 7
Isolated cell clumps at
DV boundary
Isolated cell clumps
at DV boundary
Fewer isolated cell
clumps at the
DV boundary
Md HL
Stage 31
Md FL
Late Stage 28
Stage 4
Isolated cell clumps
at DV boundary
Mouse
FL
Md
HL AER
morphology
Md
FL AER
morphology
Limb
Stage
TABLE 1. AER development in opossum and mouse
Mouse
FL AER
morphology
Mouse
HL
Mouse
HL AER
morphology
DOROBA AND SEARS
To quantify Fgf8 transcript levels in opossum and
mouse fore- and hind limbs, we used a semi-quantitative
RT-PCR assay with 18S rRNA as a control using the
Quantum RNA Universal 18S Internal Standard Kit as
per the manufacturer’s instructions (Applied Biosystems
#AM 1718) with a primer/competimer ratio of 1:9 and 30
PCR cycles. Limb buds were dissected from comparable
stages of AER development (limb Stage 4) for the opossum forelimb (from Stage 28), opossum hind limb (from
Stage 31), and mouse fore- and hind limbs (11 and 12
days post-fertilization, respectively). Limb Stage 4 was
targeted as it captures the early maturation stage of
AER development. For each sample (e.g., opossum forelimb), all the limb buds in a single litter were combined
for analysis to insure sufficient RNA levels. RNA was
extracted (RNeasy kit; Qiagen #74104) and cDNA generated for each sample (SuperScript III First-Strand Synthesis system for RT-PCR; Invitrogen #18080-051). To
generate conserved Fgf8 primers for opossum and
mouse, we downloaded and aligned Fgf8 mRNA sequences from Ensembl. The following primers (which span a
288 bp region and are homologous in opossum and
mouse) were used: GAGCAGAGCCTGGTGACGGATC
(sense) and TAGTTGTTCTCCAGCACGATC (anti-sense).
We used the following PCR conditions: 94 C for 20 sec,
55 C for 30 sec, and 72 C for 45 sec. PCR products were
run on 3% agarose gels, and the resulting Fgf8 and 18S
bands were quantified using Quantity One 1D analysis
software (Bio-Rad). Significance of differences between
levels of Fgf8 expression in opossum and mouse foreand hind limbs were evaluated using Mann-Whitney U
tests (Sokal and Rohlf, 1995).
RESULTS
Opossum Limbs Display Divergent AER
Morphologies at the Gross and Cellular Level
SEM results revealed that mouse fore- and hind limbs
during limb Stage 5 have fully developed and mature
AER’s, as expected (Table 1; Fig. 1E; Wanek et al.,
1989). A similar fully developed and mature physical
AER was observed in the opossum hind limb during
limb Stages 5 and 6 (Stage 32; Table 1; Fig. 1F). However, the AER of the marsupial hind limb does not
achieve the prominence of the AER of mouse limbs. During limb Stage 4, the opossum hind limb AER was beginning to form through the concatenation of a
multitude of cell clumps forming a nearly continuous
line along the DV boundary of the developing limb bud.
In both the opossum hind limb and mouse limbs, the
physical AER begins to reduce during limb Stage 7
(Table 1).
The opossum forelimb did not display a well-formed
physical AER at any examined limb stage. Where the
AER should have been, SEM results demonstrated that
the opossum forelimb had only disorganized clumps of
cells scattered along the DV limb border for limb Stages
4 (Fig. 1A), 5 (Fig. 1B), and 6 (Fig. 1C). During limb
Stage 7, the number of cell clumps at the opossum forelimb DV boundary seemed to decrease (Fig. 1D). The
location of the scattered ‘‘cell clumpings’’ along the DV
boundary of the limb suggests that even though no
organized, physical AER is present, the marsupial forelimb still has clear dorsal and ventral polarity.
THE MARSUPIAL APICAL ECTODERMAL RIDGE
1329
Fig. 2. Histological sections of M. musculus (mouse) and M.
domestica (opossum) limbs during limb Stage 5, stained with hematoxylin and eosin. The AER can be seen protruding from the distal tip
of the limb bud in the mouse forelimb (A), and in the opossum hind
limb (C), although the AER of the opossum hind limb is relatively less
prominent. However, even at the cellular level no physical AER ridge
can be detected along the DV boundary of the opossum forelimb (B).
Fig. 3. Fgf8 expression in M. domestica (opossum) fore- and hind
limbs. In situ hybridization reveals that Fgf8 is expressed (indicated by
black staining) normally in opossum forelimbs (A and B - Stage 28;
limb Stage 3) and hind limbs (C and D - Stage 30; limb Stage 2).
Arrows indicate Fgf8 expression in the limb buds. (c) Semi-quantitative
RT-PCR reveals that Fgf8 is also expressed the same relative level in
the fore- (FL) and hind limbs (HL) of opossums (Mono.) and mouse,
Mus musculus (Mus) at limb Stage 4.
Histological analyses of cellular morphology confirm
that both mouse fore- and hind limbs and the opossum
hind limbs possess a distinct, protruding AER separating the dorsal and ventral sides of the limb, whereas the
opossum forelimb does not (Fig. 2). In mouse limbs of
limb Stage 5, there is obvious thickening and compaction
of the ectoderm at the distal tip of the limb bud (Fig.
2a). Similarly, the opossum hind limb at limb Stage 5
displays a significant thickening of the distal ectoderm,
where the AER is located (Fig. 2c). Again, the AER of
the opossum hind limb is not as pronounced as that of
the mouse. In contrast, in the opossum forelimb at limb
Stage 5, the thickness of the ectoderm is uniform along
the distal edge of the limb bud, and there is no noticeable compaction or protrusion of cells forming an AER.
Fgf8 Expression is Conserved in
Opossum Limbs
Analyses of patterns and levels of Fgf8 expression
indicate that Fgf8 expression is conserved in opossum
limbs. As revealed by in situ hybridization, Fgf8 transcripts are expressed in a solid line along the DV boundary of both the developing fore- and hind limb in
opossums, in a similar manner to that previously documented in other tetrapods (Fig. 3; Crossley and Martin,
1995; Crossley et al., 1996; Cooper et al., in press).
Moreover, semi-quantitative RT-PCR analysis of the levels of Fgf8 transcript revealed that the level of Fgf8
transcript is indistinguishable (p ¼ 0.8873) in mouse
and opossum fore- and hind limbs of comparable
1330
DOROBA AND SEARS
developmental stages (Fig. 3). Taken together, these
results indicate that Fgf8 is expressed in the same levels
and patterns in opossum and mouse limbs, despite the
opossum forelimb’s lack of a physical AER, and the opossum hind limb’s less prominent AER.
DISCUSSION
Several conclusions can be drawn from the results of
this study. First, and perhaps most interestingly, this
study suggests that the marsupial, M. domestica, is the
only studied amniote (without reduced limbs) to not develop a mature, physical AER in all of its limbs. It is, of
course, possible, that a physical AER appears only very
briefly in the opossum forelimb, for a fraction of a limb
stage. This is unlikely, however, as limb stages happen
over very short spans of time during opossum forelimb
development, each lasting only a couple of hours (personal observation). At the very least, results of this study
allow us to conclude that the opossum forelimb either
never forms a mature, physical AER, or forms a physical
AER for just a small fraction of limb development relative to opossum hind limbs and mouse limbs. The physical AER of the opossum hind limb is also reduced
relative to mouse, but not to the severe extent of that of
the opossum forelimb. The variation in the degree of
AER protrusion among opossum hind limbs and mouse
limbs is not altogether unexpected, as AER prominence
differs slightly in other tetrapods. For example, the
chick AER is notably more pronounced that that of the
mouse (Niswander, 2003; Fernandez-Teran and Ros,
2008).
Second, despite not forming a mature, physical AER,
the M. domestica forelimb normally expresses Fgf8, a
well-known genetic marker for the AER. Furthermore,
despite its relatively reduced prominence, the opossum
hind limb also normally expresses Fgf8.
Taken together, these results suggest that the physical
AER of both opossum limbs has undergone an evolutionary reduction, but that in the opossum forelimb this
reduction was taken to the extreme. Additionally, results
suggest that although the opossum forelimb does not
have a physical AER, both it and the opossum hind limb
retain a molecular AER. These findings are consistent
with our hypothesis that the marsupial AER was altered
to help achieve or as a result of the rapid outgrowth of
their forelimbs. However, further testing is needed to
determine if the reduction of the AER played a role in
the acceleration of opossum forelimb development, or if
it was just a byproduct of it. Although the opossum represents the only marsupial species in which AER morphology has been investigated, the opossum’s basal
placement in the group (Horovitz et al., 2009), and the
general similarity of limb development among marsupials (e.g., Sears, 2004; Bininda-Emonds et al., 2007;
Sears, 2009), leads us to predict that the AER morphology observed in M. domestica will be found to represent
the general marsupial condition.
With these results many new questions arise. First, it
is surprising that the physical AER of the opossum forelimb is so dramatically reduced, as a current hypothesis
is that the physical AER functions to condense cells and
cellular products and thereby accelerate growth (Fernandez-Teran and Ros, 2008). As marsupial forelimbs
develop fastest of any examined amniote (Sears, 2009),
to be consistent with this hypothesis, the AER of the
opossum forelimb should actually be enlarged, rather
than reduced. This suggests that size of the AER, or
even its physical presence, are not directly linked to
rate of limb outgrowth. Results of this study are also
not consistent with another current model of AER
function, namely that the AER provides the mechanical support necessary for proper DV patterning (Dahmann and Basler, 1999), as opossum forelimbs
successfully establish their DV polarity despite not having a physical AER.
However, the question remains; why is the physical
AER of the opossum forelimb so dramatically reduced?
Perhaps as a result of the extreme shortening of its development, opossum forelimbs just do not have the time
or the resources to build a fully mature, protruding
AER. If this is the case, the disorganized clumps of cells
observed along the DV boundary of the developing opossum forelimb could be the vestigial remnants of an ancestral, morphological AER. In this scenario, despite not
forming a morphological AER, opossums are able to
maintain limb outgrowth through the presence of a molecular AER (as indicated by Fgf8 expression). A similar
situation exists in other amniotes that lack a ridge-like
AER but form a fully functional limb [e.g., urodeles (e.g.,
Han et al., 2001)]. As a note, Fgf8 expression has not yet
been investigated in the direct developing frog, Eleutherodactylus coqui. These findings suggest that the formation of a fully developed, protruding physical AER is not
essential to limb development. Given that the function
of a physical AER is not known, despite years of study
(Fernandez-Teran and Ros, 2008), and that the actual
morphology of the AER can be experimentally manipulated without affecting limb outgrowth (Errick and
Saunders, 1974, 1976), this is a strong possibility. However, the strong conservation of a well-developed, protruding AER across tetrapods belies the assertion that
the morphological AER has no function.
Physical AER’s have been observed in most tetrapods,
in all amniotes without reduced limbs, and in all mammals (even those with reduced limbs) that have been
studied (Stopper and Wagner, 2005; Cooper et al., in
press). In addition to the findings of this study, researchers have found only two tetrapod groups with fully
developed adult limbs that do not form physical AER’s,
and both are non-amniotes with specialized development. The first is the urodele amphibians, which retain
a capacity for limb regeneration into adult-hood (Sturdee
and Connock, 1975), and the second is Eleutherodactylus
coqui, a frog that develops directly with no larval stage
(Richardson et al., 1998). The actual morphology of the
AER varies between tetrapod species, with some AER’s
being more prominent and/or stratified than others, but
the condition of having a physical AER appears to be ancestral for tetrapods. This argument is strengthened by
the fact that several fish (e.g., zebrafish, killfish, and the
Australian lungfish) also possess morphological AER’s
(Wood, 1982; Grandel and Schulte-Merker, 1998; Hodgkinson et al., 2007; Mercader, 2007). If a morphological
AER truly played no essential role in limb development,
we would expect to have seen it reduced or lost by
chance in more amniote lineages than in just marsupials. In any event, the situation in opossums indicates
that more study of the role that the physical AER plays
in limb development is needed.
THE MARSUPIAL APICAL ECTODERMAL RIDGE
Another outstanding question is–how have opossums
modified their limb development to achieve this highly
divergent AER morphology? Results of this study suggest that pathways other than those involving Fgf8 (e.g.,
interactions between the BMP’s and engrailed, or
between the Wnt’s and other FGF’s) have been modified
in opossum forelimbs relative to the limbs of other tetrapods to generate the opossum’s divergent morphology.
The AER goes through four phases during its duration
(Fernandez-Teran and Ros, 2008). In the first phase,
AER induction, AER precursor cells are specified, and
migrate to the distal tip of the developing limb bud.
AER maturation, the second phase, is characterized by
the establishment of a mature, protruding AER through
the compaction of the precursor cells. In the third stage,
AER maintenance, the AER is maintained as a functional structure. Finally, in the fourth stage, AER
regression, the AER flattens and regresses. Given the
morphology of the cells in the region where the opossum
forelimb AER would be (and their similarity to the early
stages of AER development in the opossum hind limb),
we propose that induction of the opossum forelimb AER
(Phase 1) begins normally, and that the AER precursor
cells are specified and migrate to the distal tip of the
developing limb bud. However, we propose that the compaction of these precursor cells (Phase 2) to make a
mature, protruding AER is disrupted in opossum forelimbs. With this in mind, it is possible that the expression of genes associated with this compaction have also
been disrupted (e.g., Wnt’s, Dkk1, En1, etc.; FernandezTeran and Ros, 2008). Testing of these hypotheses is currently underway.
ACKNOWLEDGMENTS
The authors would like first and foremost to acknowledge Kathleen Smith for conversations that provided the
impetus for this study. The authors also thank the members of the Sears and Marcot Laboratories at the University of Illinois for stimulating discussions on this topic
that improved the study and manuscript. The authors
also thank two anonymous reviewers whose comments
strengthened the manuscript. Finally, the authors thank
Lisa Powers for help with experimental implementation
and training.
LITERATURE CITED
Bininda-Emonds ORP, Jeffrey JE, Richardson MK. 2003. Is
sequence heterochrony an important evolutionary mechanism in
mammals. J Mammal Evol 10:335–361.
Bininda-Emonds ORP, Jeffery JE, Sanchez-Villagra MR, Hanken J,
Colbert M, Pieau C, Selwood L, ten Cate C, Raynaud A, Osabutey
CK, Richardson MK. 2007. Forelimb-hindlimb developmental timing changes across tetrapod phylogeny. BMC Evol Biol 7:182–189.
Capdevila J, Belmonte J. 2001. Patterning mechanisms controlling
vertebrate limb development. Annu Rev Cell Dev Biol 17:87–132.
Cohn MJ, Tickle C. 1999. Developmental basis of limblessness and
axial patterning in snakes. Nature 399:474–479.
Cooper LN, Armfield BA, Thewissen JGM. In press. Phenotypic variation and conserved FGF gene expression in the vertebrate limb
ectoderm. In: Hallgrimmson B, Hall BK, editors. Epigenetics:
Linking Genotype and Phenotype in Development and Evolution.
Crossley PH, Martin GR. 1995. The mouse FGF8 gene encodes a
family of polypeptides and is expressed in regions that direct outgrowth and patterning in the devel oping embryo. Development
121:439–451.
1331
Crossley PH, Minowada G, MacArthur CA, Martin GR. 1996. Roles
for FGF8 in the induction, initiation and maintenance of chick
limb development. Cell 84:127–136.
Dahmann C, Basler K. 1999. Compartment boundaries: at the edge
of development. Trends Genet 15:320–326.
Errick JE, Saunders JW. 1974. Effects of an ‘‘inside-out’’ limb-bud
ectoderm on development of the avian limb. Dev Biol 41:338–351.
Errick JE, Saunders JW. 1976. Limb outgrowth in the chick embryo
induced by dissociation and reaggregated cells of the apical ectodermal ridge. Dev Biol 50:26–34.
Fallon JF, Lopez A, Ros MA, Savage MP, Olwin BB, Simandl BK.
1994. Fgf-2: apical ectodermal ridge growth signal for chick limb
development. Science 264:104–107.
Fernandez-Teran M, Ros MA. 2008. The Apical Ectodermal Ridge:
morphological aspects and signaling pathways. Int J Dev Biol
52:857–871.
Gemmell RT, Veitch C, Nelson J. 2002. Birth in marsupials. Comp
Biochem Physiol B Biochem Mol Biol 131:621–630.
Grandel H, Schulte-Merker S. 1998. The development of paired find
in the Zebrafish (Danio rerio). Mech Dev 79:99–120.
Han M, An J-Y, Kim W-S. 2001. Expression patterns of FGf-8 during devleopmental and limb regeneratino of the axolotl. Dev Dyn
220:40–48.
Harrison LB, Larsson HCE. 2008. Estimating evolution of temporal
sequence changes: A practical approach inferring ancestral developmental sequences and sequences heterochrony. Syst Biol
57:378–387.
Hodgkinson VS, Johanson Z, Ericsson R, Joss JMP. 2007. Apical
ectodermal ridge (AER) development in the pectoral fin of
the Australian lungfish (Neoceratodus forsteri). J Morphol
268:1085.
Horovitz I, Martin T, Bloch J, Ladevéza S, Kurz C, Sánchez-Villagra
MR. 2009. Cranial anatomy of the earliest marsupials and the origin of opossums. PLoS One 4:e8278.
Hughes RL, Hall LS. 1984. Embryonic development in the common
brushtail possum (Trichosurus vulpecula). In: Smith AP, Hume
ID, editors. Possums and Gliders. Sydney: Australian Mammal
Society. p 197–212.
Keyte AL, Smith KK. 2008. Opossum (Monodelphis domestica): A
marsupial developmental model. Cold Spring Harbor Protocols.
Mate KE, Robinson ES, VandeBerg JL, Pederson RA. 1994. Timetable of in vivo embryonic development in the gray short-tailed
opossum (Monodelphis domestica). Mol Reprod Dev 39:365–374.
McCrady E. 1938. The embryology of the Opossum. Philadelphia:
Wistar Institute of Anatomy and Biology. p 233.
Mercader N. 2007. Early steps of paired fin development in zebrafish compared with tetrapod limb development. Dev Growth Differ 49:421–437.
Nagy A, Gertsenstein M, Vintersten K, Behringer RR. 2002. Manipulating the mouse embryo: A laboratory manual, 3rd edition. Cold
Spring Harbor, New York: Cold Spring Harbor Press. p 764.
Niswander L. 2003. Pattern Formation: Old models out on a limb.
Nat Rev Genet 4:133–143.
Niswander L, Tickle C, Vogel A, Booth I, Martin GR. 1993. FGF4
replaces the apical ectodermal ridgge and directs outgrowth and
patterning of the limb. Cell 75:579–587.
Richardson MK, Carl TF, Hanken J, Elinson RP, Cope C, Bagley P.
1998. Limb development and evolution: a frog embryo with no apical ectodermal ridge (AER). J Anat 192:379–390.
Saunders JWJ. 1948. The proximo-distal sequence of origin of the
parts of the chick wing and the role of the ectoderm. J Exp Zool
108:363–403.
Sears KE. 2004. Constraints on the morphological evolution of marsupial shoulder girdles. Evolution 58:2353–2370.
Sears KE. 2009. Differences in the timing of early limb development
in mammals: The marsupial-placental dichotomy resolved. Evolution 63:2193–2200.
Sharman GB. 1973. Adaptations of marsupial pouch young for
extra-uterine existence. In: Austin CR, editor. The Mammalian
Fetus in Vitro. London: Chapman and Hall. p 67–90.
Sokal RR, Rohlf FJ. 1995. Biometry. New York: W.H. Freeman and
Company. p 880.
1332
DOROBA AND SEARS
Stopper GF, Wagner GP. 2005. Of chicken wings and frog legs: A
smorgasbord of evolutionary variation in mechanisms of tetrapod
limb development. Dev Biol 288:21–39.
Sturdee A, Connock M. 1975. The embryonic limb bud of the urodele: Morphological studies of the apex. Differentiation 3:43–49.
Summerbell DA. 1974. A quantitative analysis of the effect of excision of the AER from the chick limb-bud. J Embryol Exp Morphol
32:651–660.
Sun X, Mariani FV, Martin GR. 2002. Functions of FGF signalling
from the apical ectodermal ridge in limb development. Nature
418:501–508.
Tanaka A, Miyamoto K, Minamino N, Takeda M, Sato B, Matsuo H,
Matsumoto K. 1992. Cloning and characterization of an androgen-inducced growth factor essentail for the androgen-dependent
growth of mouse mammary carcinoma cells. Proc Natl Acad Sci
USA 89:8928–8932.
Thewissen JGM, Cohn MJ, Stevens ME, Bajpai S, Heyning J, Horton WEJ. 2006. Developmental basis for hind-limb loss in dol-
phins and origin of the cetacean bodyplan. Proc Natl Acad Sci
USA 103:8414–8418.
Vaglia JL, Smith KK. 2003. Early differentiation and migration of
cranial neural crest in the opossum, Monodelphis domestica. Evol
Dev 5:121–135.
Wanek N, Muneoka K, Holler-Dinsmore G, Burton R, Bryant SV.
1989. A staging system for mouse limb development. J Exp Zool
249:41–49.
Weisbecker V, Goswami A, Wroe S, Sanchez-Villagra MR. 2008.
Ossification heterochrony in the therian postcranial skeleton and
the marsupial-placental dichotomy. Evolution 62:2027–2041.
Werneburg I, Sánchez-Villagra MR. In press. The early development of the Echidna, Tachyglossus aculeatus (Mammalia: Monotremata) and the grundmuster of mammalian development. Acta
Zool.
Wood A. 1982. Early pectoral fin development and morphogenesis of
the apical ectodermal ridge in the Killfish, Aphyosemion scheeli.
Anat Rec 204:349–356.
Документ
Категория
Без категории
Просмотров
0
Размер файла
1 814 Кб
Теги
development, ectodermal, apical, divergent, monodelphis, domestic, marsupialia, ridges
1/--страниц
Пожаловаться на содержимое документа