close

Вход

Забыли?

вход по аккаунту

?

Versican Knockdown Reduces Interzone Area During Early Stages of Chick Synovial Joint Development.

код для вставкиСкачать
THE ANATOMICAL RECORD 295:397–409 (2012)
Versican Knockdown Reduces Interzone
Area During Early Stages of Chick
Synovial Joint Development
PARTHA S. NAGCHOWDHURI, KRISTEN N. ANDREWS, SAVANNAH ROBART,
AND ANTHONY A. CAPEHART*
Department of Biology, East Carolina University, Greenville, North Carolina
ABSTRACT
Much has been learned regarding factors that specify joint placement, but less is known regarding how these molecular instructions are
translated into functional joint tissues. Previous studies have shown that
the matrix chondroitin sulfate proteoglycan, versican, exhibits a similar
pattern of expression in the embryonic joint rudiment of chick and mouse
suggesting conserved function during joint development. In this study,
versican’s importance in developing joints was investigated by specific inhibition of its expression in the early joint interzone, tissue that gives
rise to articular cartilages and joint cavity. In ovo microinjection of adenoviral shRNA constructs into the HH25 chick wing was employed to
silence endogenous versican protein in developing appendicular joints.
Results showed statistically significant (12–14%) reduction of nonchondrogenic elbow joint interzone area in whole-mount specimens at HH36 in
response to versican knockdown. Attenuated expression of key versicanassociated molecules including hyaluronan, tenascin, CD44, and link protein was also noted by histochemical and immunohistochemical analysis.
Versican knockdown also lowered collagen II expression in presumptive
articular chondrocytes indicating possible delay in chondrogenesis.
Results suggest that versican functions interactively with other matrix/
cell surface molecules to facilitate establishment or maintenance of early
C 2011 Wiley
joint interzone structure. Anat Rec, 295:397–409, 2012. V
Periodicals, Inc.
Key
words: versican; extracellular matrix; immunohistochemistry; chick embryo; joint interzone;
adenoviral gene transfer
Synovial joint formation within the embryonic limb
begins with flattening and packing of nonchondrogenic
mesenchymal cells to form the joint interzone (Craig
et al., 1987; Archer et al., 2003). Joint interzones in the
developing embryo are comprised of a central intermediate layer sandwiched between two chondrogenous
laminae lining the epiphyseal ends of the long bone
anlagen (Craig et al., 1987). Articular cartilages may be
derived from cells of the intermediate zone as the outer
layers differentiate into chondrocytes and add to the
growing cartilage template (Archer et al., 1994; Ito and
Kida, 2000). Articular cartilages differ from other chondrocytes forming the long bone template in that the
former retain their phenotype throughout the life of the
organism, tend to be less mitotic, and pack more densely
C 2011 WILEY PERIODICALS, INC.
V
during embryonic joint development (Lufti, 1974; Howlett, 1979). Articular cartilage imparts strength and
functional resilience to joints while resisting ossification,
unlike skeletal cartilage tissue, which undergoes cellular
Grant sponsor: NIH; Grant number: HD040846; Grant
sponsors: East Carolina University; Research and Creative
Activities Grant.
*Correspondence to: Anthony A. Capehart, Department of
Biology, East Carolina University, N108 Howell Science
Complex, Greenville, NC 27858. Fax: 252-328-4178. E-mail:
capehartt@ecu.edu
Received 25 August 2011; Accepted 15 October 2011.
DOI 10.1002/ar.21542
Published online 20 December 2011 in Wiley Online Library
(wileyonlinelibrary.com).
398
NAGCHOWDHURI ET AL.
hypertrophy, apoptosis, and replacement by osteoblasts
(Jurand, 1965; Pacifici et al., 2005).
Synovial joint morphogenesis hinges strongly on the
process of cavitation or the partitioning of the interzone
tissue bridging joint-forming skeletal structures (Pacifici
et al., 2005). Several studies have proposed mechanical
movement as the cause of cavitation or maintenance of
joint cavity structure (Fell and Canti, 1934; Hamburger
and Waugh, 1940). Studies have also indicated that cavitation may be due to increased expression of hyaluronan
and its cell surface receptor CD44 in the interzone
(Craig et al., 1990; Archer et al., 1994; Edwards et al.,
1994; Pitsillides et al., 1995). Indeed, oligosaccharidemediated blockade of hyaluronan function in the interzone (Dowthwaite et al., 1998) and conditional deletion
of hyaluronan synthase 2 (Matsumoto et al., 2009) compromised normal synovial cavity formation.
Synovial joint differentiation is critically dependent on
the coordinated activity of several key signaling molecules and transcription factors. GDF5 is one of several
paracrine signals that may be necessary for synovial
joint initiation as its expression is detected in early
chick and mouse joint interzones and even throughout
early mesenchymal condensations (Storm and Kingsley,
1996). Mutant mice lacking GDF5 showed joint deformities such as brachypodism and defects in overall
skeletal growth (Storm et al., 1994; Settle et al., 2003).
Wnt9a is expressed in the presumptive joint and its
overexpression in chick embryo limbs drives ectopic
expression of other interzone markers including GDF5,
chordin, and CD44 (Hartmann and Tabin, 2001), providing strong evidence that Wnt signals govern initial joint
positioning. Moreover, conditional ablation of b-catenin
in embryonic limb resulted in absence of synovial joints
(Guo et al., 2004). Collectively, these data indicate that
Wnt9a signaling through the canonical b-catenin dependent pathway is sufficient for synovial joint
specification and maintenance of the mesenchymal nature of interzone cells by preventing differentiation into
chondrocytes (Hartmann and Tabin, 2001; Guo et al.,
2004).
Chondroitin sulfate proteoglycans (CSPGs), core proteins covalently linked to glycosaminoglycan (GAG) side
chains, interact with numerous molecules via action of
their GAG side chains or terminal domains (Ruoslahti,
1989). The versican CSPG plays an important role in development of limb cartilage primordia and is highly
expressed in the limb core matrix during chondrogenesis
(Shinomura et al., 1990) and synovial joint formation
(Shibata et al., 2003; Snow et al., 2005; Shepard et al.,
2007). Versican’s role in the process of endochondral
ossification may be facilitation of precartilage mesenchymal condensation (Williams et al., 2005; Kamiya et al.,
2006; Shepard et al., 2008; Hudson et al., 2010), a requisite step for chondrogenic differentiation (Hall and
Miyake, 2000). Following initial differentiation of cartilage precursor tissues, versican is downregulated within
them, but continues to be highly expressed in the surrounding perichondrium and joint interzone (Shibata
et al., 2003; Snow et al., 2005; Shepard et al., 2007).
Alternative splicing of versican leads to generation of
four isoforms expressed in a tissue dependent and developmentally regulated manner. All isoforms contain the
globular N-terminal G1 and C-terminal G3 domains
(Zimmermann and Rouslahti, 1990). The full-length ver-
sican isoform (V0) consists of two chondroitin sulfate
(CS-a and CS-b) attachment sites, V1 contains CS-b and
V2 only CS-a, while the V3 isoform contains neither
GAG attachment site (Shinomura et al., 1993). The Nterminal G1 domain of versican consists of an immunoglobulin-like motif followed by two-link protein modules
that bind hyaluronan, an interaction further stabilized
by association with link protein to create a loose, highly
hydrated extracellular environment (Le Baron et al.,
1992, Lee et al., 1993; Wight, 2002; Wu et al., 2005). The
C-terminal G3 domain consists of a C-type lectin-like domain, two epidermal growth factor-like repeats and a
complement regulatory domain and interacts with several extracellular matrix (ECM) molecules including
fibrillin 1, fibulin 1, and tenascins (Aspberg et al., 1997;
Olin et al., 2001; Isogai et al., 2002).
Previous studies showed conserved immunolocalization of versican across the joint interzone through
progressive stages of chick and mouse limb development
that eventually resolve to the immediate articular surface (Snow et al., 2005; Shepard et al., 2007; Capehart,
2010). This dynamic pattern of versican expression leads
to the hypothesis that versican may function in joint
interzone formation and/or maintenance subsequent to
its role in early stages of cartilage differentiation. A
recent elegant study utilizing conditional prx1-Cre
driven deletion of versican from mouse limb mesenchyme (Choocheep et al., 2010) described a limb
phenotype in which distal joint formation was compromised, resulting in improper orientation of autopod joint
structure. Because of widespread cartilage template
defects including overall delay in chondrogenesis and
dislocated regions of cartilage hypertrophy, it is possible
that the joint phenotype could be attributed in part to
versican deletion from the entire skeletal template in
addition to specific effects on joint differentiation. To further address versican’s role in early stages of joint
formation, it would be advantageous to misexpress versican specifically in the presumptive joint structure. This
study was designed to extend our understanding of versican function in early synovial joint morphogenesis
through use of recombinant adenoviral short-hairpin
RNAs (shRNA) targeted to the synovial joint rudiment
to assess impact of versican knockdown on initial stages
of joint development.
MATERIALS AND METHODS
Recombinant shRNA Adenoviral-shRNA
Preparation
A shRNA template targeting chick versican
(NM_204787) mRNA at nucleotides 320–338 (adeno-320;
50 -TATCTTCGAATCAAATGGT-30 ) was selected using
Ambion siRNA target finder (www.ambion.com/techlib/
misc/siRNA_finder.html; Applied Biosystems, Austin,
TX). A second shRNA sequence targeting versican
mRNA at nucleotides 5334–5352 (adeno-5334; 50 AGCCTGACATGACTGCTTC-30 ) was also utilized and
overlapped a published siRNA sequence used previously
to silence versican in vitro (nucleotides 5337–5355;
Sheng et al., 2006). The -320- and -5334 target sequences are located in versican G1 and CS-b domains,
respectively, with -320 targeting all isoforms and -5334
the V0/V1 isoforms predominant in limb. A noncoding
VERSICAN KNOCKDOWN IN CHICK JOINT RUDIMENT
sequence (50 -GACTTGTTACTGTTTCGAC-30 ) was also
used to construct a control adeno-shRNA. Oligonucleotides containing the 50 -TTCAAGAGA-30 loop sequence
were prepared (Integrated DNA Technologies, Coralville,
IA) and the pSilencer adeno 1.0-CMV system (Applied
Biosystems) used to engineer replication incompetent
shRNA adenoviral constructs. Oligonucleotide templates
were ligated into the pSilencer shuttle vector and verified by sequencing.
For each recombinant shRNA adenovirus, corresponding shuttle and adenoviral-lacZ plasmids were linearized
using Pac1 restriction endonuclease and cotransfected
into low-density HEK-293 cells (ATCC, Manassas, VA) in
DMEM-10% heat inactivated fetal bovine serum (FBS)1% penicillin/streptomycin (Invitrogen, Carlsbad, CA).
After three rounds of expansion in the packaging HEK293 line, cells were lysed, centrifuged, and adenoviruses
purified using the Adeno-X Virus Mini Purification Kit
(Clontech, Mountain View, CA) according to manufacturer’s instructions. Titers (5 109 ifu/mL) were
determined by adenoviral lacZ reporter staining following the Adeno-X Rapid Titer Kit (Clontech) protocol.
Adenoviral aliquots were maintained at 70 C for longterm storage.
Determination of Gene Silencing by qRT-PCR
Chick embryonic fibroblasts (CEFs) were isolated from
Hamburger and Hamilton (1951) stage 35 (HH35) dermal tissues in PBS and digested with 0.25% Trypsin/
EDTA (Invitrogen) for 10 min at 37 C. Cells were centrifuged and media replaced with fresh DMEM/F12
containing 2% FBS. Three samples at 2 106 cells were
used for each adenovirus and infected at a MOI (multiplicity of infection) of 100. After infection, cells were
seeded in 35-mm plates and supplemented with 2-mL
DMEM/F12-2% FBS. Media were replaced after 24 hr
with fresh media containing 10% FBS. Total RNA was
extracted from replicates after 2 days using the RNA
aqueous-4 PCR kit (Applied Biosystems).
Superscript III First Strand Synthesis kit (Invitrogen)
was used to reverse transcribe equivalent concentrations
of total RNA from each of the three samples using oligodT priming. The cDNAs were diluted threefold and
used for real-time PCR with three replicates run for
each of the three samples. Primer sets utilized were:
320F: 50 -AACGTCAGTCCTTCCATGCT-30 , R: 50 -TGAAT
GGGTTGGAACAGACA-30 , 5334F: 50 -CCTTTTGAAAG
CAACCCAGA-30 , R: 50 -TGTGCCAGAAGCCAAAGAAG30 . Real-time PCR reactions (Applied Biosystems ABI
7300) used RT2 real-time SYBR Green/Rox PCR master
mix (SA Biosciences, Frederick, MD) according to manufacturer’s instructions. b-actin primers (F: CACAGATC
ATGTTTGAGACCTT,
R:
CATCACAATACCAGTGGTACG; Accession # L08165; DeBoever et al., 2008) were
used to amplify endogenous b-actin as an internal control. Threshold cycle data were analyzed relative to
untreated control samples using MS excel and followed
Pfaffl (2001) for relative quantification calculations. Student t-test was also performed to evaluate statistical
significance.
In ovo versican knock down in the developing elbow
region at HH35 for two replicate sample pools (n ¼ 5)
coinjected with adeno-320 þ adeno-5334 at HH25 (see
below) was also assessed relative to control adeno-
399
shRNA. RNA was extracted from lysates utilizing the
RiboPure Kit (Applied Biosystems), cDNA transcribed,
and assayed by real-time PCR. Microarray analysis of
replicate RNA samples relative to control shRNA treatment was also performed through the University of
North Carolina Genomics Core (Chapel Hill, NC) using
the 4X44K chick gene expression array (#G2519F, Agilent Technologies, Wilmington, DE) with Lowess
normalization and fold-change in expression determined
for molecules relevant to this study.
In Ovo Microinjection
Fertilized chick eggs (SPF; Charles River, Wilmington,
MA) were incubated in a 37.5 C humidified egg incubator until HH25. Eggs were ‘‘windowed’’ and eggshell and
vitelline membranes carefully removed using tungsten
needles. Presumptive joint regions of accessible wings
(usually right wing) were injected with adeno-shRNA
control, adeno-320, adeno-5334 or a 1:1 combination of
adeno-320 and -5334 viruses (adeno-320 þ adeno-5334).
Uninjected wings served as matched contralateral controls (CLC). Each microinjection delivered approximately
7.5 106 virions targeted to the joint region using
pulled-glass needles inserted into a micromanipulator
(No.778; Narishige International, East Meadow, NY)
connected to a pneumatic pump (Model 820; WPI, Sarasota, FL). Following injection, windowed eggs were
sealed with plastic tape and incubated until desired developmental stages were reached (HH34-36). Embryos
were harvested from eggs and preserved using appropriate fixatives. BSL2 animal use procedures were
approved by the ECU IACUC and IBC.
Whole-Mount LacZ Reporter Histochemistry
Adenoviral b-galactosidase reporter staining was
adapted from Kern et al. (2007). Briefly, embryos were
fixed briefly in ice cold 4% paraformaldehyde, rinsed
three times with PBS, and washed in 0.02% sodium
deoxycolate, 0.01% Tergitol-type NP-40 in PBS overnight
at 4 C. Following permeablization, specimens were incubated in 0.02% magnesium chloride, 0.1% potassium
ferrocyanide, 0.1% potassium ferricyanide, and either
0.1% X-gal (Invitrogen) or Red Gal (Research Organics,
Cleveland OH) in PBS at 37 C in the dark. Specimens
were postfixed with 4% paraformaldehyde, washed, and
stored in PBS at 4 C or embedded in paraffin.
Whole-Mount Alcian Blue/Alizarin Red
Histochemistry
Alcian blue/Alizarin red whole-mount histochemistry
was used to detect gross morphological changes in elbow
morphology at HH36 using a modification of Kuczuk
and Scott (1984). Specimens were fixed in 95% ethanol
overnight at room temperature, followed by overnight
staining in 0.2% alcian blue in acidified ethanol (pH
1.0). Embryos were destained in 95% ethanol, macerated
with 2% potassium hydroxide (KOH) until translucent
(usually 3–5 hr) and stained with 0.01% Alizarin Red in
1% KOH. Samples underwent serial KOH/glycerol
washes (80:20, 60:40, 40:60, and 20:80) and were stored
in 100% glycerol.
400
NAGCHOWDHURI ET AL.
Histo- and Immunohistochemistry on Tissue
Sections
Paraformaldehyde-fixed paraffin (7 lm) or cryostat sections (10 lm) were immunostained overnight at 4 C with
primary antibodies: rabbit anti-chick versican (1:50 dilution; Zanin et al., 1999; Shepard et al., 2007, 2008),
rabbit anti-phosphohistone H3 (Ser10) (1:100; Cell Signaling, Danvers MA) or monoclonal mouse IgG supernatants
(1:5; Developmental Studies Hybridoma Bank, Iowa City
IA) anti-chick collagen II (II-II6B3), tenascin (M1B4),
CD44 (1D10), link protein (9/30/8A4), and TGF-B3 (active
form; D-B3). Secondary antibodies used were fluoresceinor rhodamine-conjugated goat anti-mouse or rabbit antibodies (1:200; Cappel, MP Biomedicals, Santa Ana, CA)
for 2 hr at room temperature. Histochemical localization
of hyaluronan utilized biotinylated hyaluronic acid binding protein (HABP) (1:100; Cape Cod, East Falmouth,
MA) and fluorescein-strepavidin (1:200; Vector Labs, Burlingame, CA). Negative control samples were routinely
processed with omission of primary reagents. Control
specimens were also incubated with irrelevant monoclonal mouse IgG supernatants or nonimmune rabbit IgG.
Prior to primary reagent incubation sections were treated
with citrate-based Antigen Unmasking solution (Vector
Labs) per manufacturer’s instructions followed by 1 mg/
mL bovine testicular hyaluronidase (Sigma Chemical, St.
Louis, MO), except those reserved for HABP or CD44
staining, which were treated with 0.25U/mL chondroitin
ABC lyase (Sigma). Samples were then blocked with 3%
bovine serum albumin and 1% normal goat serum
(Sigma). Immunostained sections were postfixed in 80%
and 50% ethanol, equilibrated in PBS, and mounted in
10% PBS-90% glycerol containing 100 mg/mL 1,4-diazabicyclo (2,2,2) octane (DABCO; Sigma). Sections were
viewed using an Olympus BX-40 microscope equipped
with epifluorescence optics and images captured using a
SPOT-RT camera and software (Diagnostic Instruments,
Sterling, MI). Matched control and experimental images
were processed with equal adjustment of fluorescence levels for brightness and/or contrast for the entire image.
Fig. 1. Real-time PCR evaluation of versican knockdown. A: Histogram representing reduction of versican mRNA in HH35 CEFs in vitro
2 days following infection with versican shRNA adenoviruses. qRTPCR results demonstrate 70% mRNA knockdown with the adeno-320
shRNA and 50% with adeno-5334 shRNA (three biological replicates
per treatment). P-values obtained from Student t-test indicate significant reduction in versican transcript levels compared with the
untreated control CEF. B: Real-time PCR assessment of versican
mRNA knockdown at HH35 in ovo following coinjection of presumptive elbow with a 1:1 combination of adeno-320 þ adeno-5334 shRNA
(combined 1 and 2) at HH25. Data show an average reduction of 65%
in versican mRNA levels in ovo for combined adeno-320 þ adeno5334 injections (three replicates per sample) as compared with adenoshRNA control.
TUNEL Assay
Terminal deoxynucleotidyl transferase dUTP nick end
labeling (TUNEL) assay for apoptotic cells was performed using ApopTag Peroxidase In Situ Apoptosis
Detection Kit (Chemicon, Temecula, CA) according to
manufacturer’s instructions. Briefly, deparaffinized sections were incubated in 20 lg/mL proteinase K 15 min
at room temperature, washed and endogenous peroxide
quenched in 3% hydrogen peroxidase. Sections were
equilibrated in terminal transferase buffer and incubated 1 hr in reaction buffer containing TdT enzyme and
digoxigenin-11-dUTP at 37 C. Following serial PBS
washes, specimens were incubated in antidigoxigenin
peroxidase conjugate 30 min at room temperature.
Specimens were PBS washed and incubated in diaminobenzidine substrate (Sigma) until characteristic brown
cells were visible.
RESULTS
To better understand versican function during early
stages of synovial joint development, we employed an
adenoviral-mediated shRNA interference strategy to
facilitate site-directed cleavage and degradation of
mRNA transcripts. Quantitative real-time PCR assessment of gene silencing activity of adeno-shRNA
constructs on CEFs in vitro resulted in an average 70%
knockdown in versican mRNA levels with adeno-320
shRNA virus and 50% knockdown with adeno-5334
shRNA after 2 days of infection as compared to
untreated negative controls (Fig. 1A). Both experimental
CEF groups showed significant (P < 0.05) knockdown of
versican mRNA. Furthermore, in ovo coinjection of
adeno-320 þ adeno-5334 into presumptive chick elbows
at HH25 led to an average reduction of 65% in versican
mRNA levels 4 days following injection when compared
with adenocontrol shRNA (Fig. 1B).
Sites of recombinant adeno-shRNA infection in the
limb could be readily detected and verified by histochemical staining for the b-galactosidase reporter encoded by
adenoviral constructs at HH34 (Fig. 2), demonstrating
that developing joint tissues could be reproducibly targeted by microinjection into presumptive joint at HH25.
VERSICAN KNOCKDOWN IN CHICK JOINT RUDIMENT
401
Fig. 2. Adenocontrol shRNA injection at HH25 does not reduce versican in the developing chick elbow joint at HH34. A: Versican immunolocalization in the developing elbow joint interzone in specimen
treated with control adeno-shRNA. Note strong versican signal
throughout the interzone ECM. B: Areas of adenocontrol shRNA
expression in panel (A) are indicated by lacZ reporter staining. C: Representative control section in which primary antibody was omitted. In
other control preparations, little or no specific immunoreactivity was
observed following incubation with either irrelevant mouse IgG monoclonal supernatant or nonimmune rabbit IgG. D: Higher magnification
of matrix versican immunolocalization in humeroulnar and radiohumeral joint interzones in CLC elbow. E: Higher magnification of versican
localization shown in boxed region of panel (A). F: Corresponding
higher magnification of lacZ staining shown in same area of panel (B).
h, humerus; r, radius; u, ulna. Scale bar in (A) ¼ 100 lm for panels (A–
C and D) ¼ 25 lm for (D–F).
Different wing joint primordia were utilized for versican
knockdown; however, reproducibility was best achieved
through microinjection directed to the presumptive dorsal aspect of the elbow, which could be easily targeted
due to its characteristic flexure at HH25. Care was
taken to compare CLC and experimental tissue sections
taken from similar areas within the developing joint
structure and elbow images were rotated such that the
humerus was in a similar position in all figure panels to
aid orientation.
Little or no difference in versican reactivity was noted
with adenocontrol shRNA-treated samples relative to
uninjected CLCs at HH34 (Fig. 2A,B,D–F) with versican
localization spanning the radiohumeral and humeroulnar joint interzone and presumptive articular surface
ECM as reported previously (Shepard et al., 2007). Similar levels of versican reactivity between experimental
and control specimens verified that adenoviral infection
was without nonspecific effects on versican expression
and furthermore that the X-gal precipitate used to visualize sites of adenoviral infection did not interfere with
immunodetection of antigens. Sections incubated with
control immunoreagents showed little or no specific reactivity with joint tissues (Fig. 2C).
To corroborate shRNA-mediated reduction in versican
mRNA levels as gauged by qRT-PCR, adenoviral-shRNA
knockdown of versican protein in developing joint tissues
was assessed by immunostaining with chick versican
antibody. Reduction in versican staining in HH36 synovial joint interzones and presumptive articular
chondrocytes at sites of adenoviral infection relative to
CLC wings was visible on paraffin sections of developing
wrist (Fig. 3A–C) or humeroulnar joint interzones (Fig.
3D–F) microinjected with adeno-320 þ adeno-5334. Consistent viral titers ( 7.5 106 virions) were routinely
injected during experiments. Some variability in versican
immunoreactivity in adeno-320 and adeno-5334 treated
specimens and lacZ reporter staining was observed, suggesting differences in adenoviral uptake and consequent
versican reduction among individual specimens. As significant versican knockdown could be detected after 2 days
in vitro and was effective for at least 5 days postinjection,
analysis of effects on early joint structure in ovo was
performed primarily between HH34-36 (e8-10), encompassing the period in which the joint interzone and joint
line (site of incipient cavitation) are established.
Overall effects of shRNA transfection on synovial joint
morphology in HH25 elbows were evaluated at HH36
using whole-mount Alcian Blue and Alizarin Red histochemistry. Wings injected with the adenocontrol shRNA
virus showed little or no difference in interzone area
when compared with their contralateral counterparts
(Fig. 3G). Relative to adenocontrol and uninjected contralateral limbs, a generalized decrease in elbow interzone
spacing in greater than 50% of viable HH36 specimens
was observed with adeno-320, adeno-5334, and coinjected
adeno-320 þ adeno-5334 shRNAs. Effects ranged from
relatively minor (Fig. 3H) to more severe diminution of
elbow interzone area (Fig. 3I,J). LacZ reporter staining of
whole-mount specimens at HH36 again showed successful
delivery of adenoviral constructs to the central and outer
(chondrogenic) laminae of the elbow interzone at HH25
(Fig. 3K). Estimated interzone area between epiphyseal
ends of the humerus, radius, and ulna was performed
using the area measurement tool of Image J software
(NIH, Bethesda, MD). An overall 14% average decrease
in interzone area between following coinjection of adeno320 þ adeno-5334 shRNAs was noted as compared to
CLC wings (Table 1). Early stage elbow regions independently injected with adeno-5334 and -320 shRNA showed
12% and 14% reductions, respectively. Significance of differences in interzone areas between adenoinjected and
402
NAGCHOWDHURI ET AL.
Fig. 3. Versican immunolocalization in sections of the developing
wrist/elbow interzone (A–F) and whole-mount Alcian blue/Alizarin red
histochemistry of wings (G–K) at HH36 injected with adeno-shRNA
constructs at HH25. A: Versican localization in the CLC interzone ECM
between ulna (u) and ulnar carpal (c). B: Versican is reduced (arrow) in
the wrist joint interzone of adeno-320 versican shRNA-treated wing.
C: Same section as panel (B) shows adeno-320 expressing interzone
cells (arrow) as detected by lacZ reporter histochemistry. D: Versican
localization in the humeroulnar (h, u) interzone of the CLC wing. E: Versican immunoreactivity is reduced in regions of the elbow interzone
(white arrowhead) injected with adeno-5334 shRNA. F: LacZ reporter
staining showing areas of adeno-5334 expression that correlates with
reduced versican in panel (E). G: Control shRNA-injected wing shows
normal elbow morphology and interzone has similar dimensions to
corresponding CLC (bracket). H: Adeno-5334 versican shRNA expression results in slight reduction of elbow interzone (dark arrowhead)
area relative to control in this specimen. I: Coinjection of combined
adeno-320 þ adeno-5334 shRNAs (comb) results in dramatic alteration in elbow interzone spacing (dark arrowhead). J: Higher magnification of adeno-320 þ adeno-5334 shRNA-treated interzone in panel (I).
K: LacZ reporter histochemistry using RedGal shows adeno-320 þ
adeno-5334 shRNA expression (dark arrows) along interzone and
developing articular surface of the humerus. Scale bars ¼ 25 lm (A–
C), 100 lm (D–F), and 1 mm (G-K).
CLC wings resulting from control and experimental treatments were examined using matched pairs analysis and
t-test (STATDISK; Triola, 2005). A statistically significant
decrease in elbow interzone area was noted for wings
injected with adeno-320 and adeno-5334 as well as the
combined adeno-320 þ adeno-5334 shRNAs when compared with respective CLCs (Table 1).
Several possibilities existed as the underlying mechanism(s) leading to reduction in interzone area in
response to localized decreases in versican. TUNEL
assay was used to assess apoptosis at sites at versican
knockdown. In agreement with a previous report (Kavanaugh et al., 2002), overall levels of apoptosis in the
joint interzone were low in uninjected CLC, control
adeno-shRNA and combined 320/5334 adeno-injected
specimens. Similar numbers of TUNEL-positive cells
appeared in elbow interzone sections (n ¼ 8–11 at
HH36; not shown) suggesting that increased apoptosis
in response to adeno-shRNA treatments was not the
causative factor for reduction of interzone area. In
403
VERSICAN KNOCKDOWN IN CHICK JOINT RUDIMENT
TABLE 1. Estimated whole-mount elbow interzone area in square-millimeters (mm ) 6 SD at HH36 in versican
shRNA-treated embryos at HH25
2
shRNA (n)
Control (6)
320 (7)
5334 (7)
320 þ 5334 (8)
CLC
0.117 6 0.04
0.124 6 0.02
0.121 6 0.03
0.113 6 0.02
Injected
Average
reduction
P-value
6
6
6
6
0
14%
12%
14%
0.36
0.03
0.04
0.02
0.121
0.107
0.106
0.098
0.04
0.01
0.02
0.03
Embryo number (n) represents whole-mount Alcian blue and Alizarin Red-stained specimens analyzed using Image J software (NIH, Bethesda MD). T-test was performed to confirm whether reduction between average area of shRNA-injected
versus CLC wing interzones was statistically significant. P value < 0.05 was deemed significant.
addition, little or no difference in cell proliferation was
observed between control and adeno-shRNA treated
wings at HH34/36. Low numbers of mitotic cells were
found scattered within epiphyseal cartilages and elbow
interzones (Fig. 4A–D), with CLC wings having similar
numbers of mitotic cells as lacZ-positive regions of
adeno-injected specimens.
As Choocheep et al. (2010) presented evidence that
versican may sequester TGFB family members in the
interzone of the mouse autopod, we also examined
TGFB3 expression in double-labeled specimens of the
chick humeroulnar interzone at HH34. Cell-associated
TGFB3 was noted in both adeno-320 þ adeno-5334 coinjected specimens and uninjected controls, particularly
toward the peripheral aspect (Fig. 4G,H). No clear difference in staining intensity or numbers of TGFB3expressing interzone cells between control and versican
knockdown samples was observed in our study.
At HH34/36, the extent of early cavitation of the
elbow interzone was variable among control as well as
experimental specimens, thus it was difficult to ascertain with certainty specific impacts of versican
knockdown on initial stages of synovial cavity formation.
Numbers of distinguishable cell layers comprising the
interzone between opposing epiphyses of the humeroulnar joint were similar with only insignificant differences
(P ¼ 0.41) between experimental adeno-shRNA treated
specimens and matched CLCs at HH34/36 (14.8 6 2.7
and 15.9 6 1.4, respectively; n ¼ 6 sections from five
specimens for each). Interestingly, however, the typical
laminar structure of the central interzone was often less
organized in versican knockdown specimens with cell
alignment not as well defined relative to similar regions
of control samples (Fig. 4A,B,E,F).
Since reduction in the number of proliferative cells or
increased apoptosis did not offer a suitable explanation
for decreased interzone spacing at early stages of joint
development, a third alternative was investigated. As
versican has numerous interactions with other molecules
implicated previously in skeletal/joint formation (Pacifici
et al., 2005; Khan et al., 2007; Pitsilledes and Ashhurst,
2008), targeted reduction of versican protein in the
elbow joint interzone could impact localization and/or
accumulation of other matrix and cell surface molecules
that might compromise early interzone structure. Microarray analysis to analyze changes in gene expression in
the elbow joint region at HH35 in response to targeted
versican misexpression showed that in addition to
reduced versican, downregulation of several matrix-associated transcripts were evident, including tenascin C,
collagen II (alpha I), link protein, hyaluronan synthase 2
and the hyaluronan receptor, CD44 (Table 2). Overall
changes in mRNA were less than twofold, ranging from
0.2 to 1.0, however, these molecules are also
expressed in tissues associated with the adjacent skeletal template such that effects of lowered versican on
gene expression specifically in the developing joint could
be masked as we were unable to completely separate all
surrounding tissues from the elbow joint rudiment during dissection.
Effect of versican knockdown on expression patterns
of these molecules were investigated to determine if
changes were specifically associated with developing
joint structures. Embryos injected with experimental
adenoviral shRNAs at HH25 and examined at HH34/36
were histochemically stained for lacZ reporter activity to
localize sites of viral infection, sectioned, and subsequently processed for immunolocalization studies. As
with versican immunodetection (Fig. 2), control adenoshRNA injections showed little or no difference in collagen II, tenascin, hyaluronan, CD44 or link protein
staining patterns when compared to uninjected contralateral wings at HH34/36 (not shown).
Localization of collagen II in the cartilage ECM in the
developing humeroulnar joint at HH36 showed strong
uniform labeling along the presumptive articular surfaces in control limbs (Fig. 5A) with signal extending into
the interzone, suggesting ongoing chondrogenesis in the
outer interzone lamina that may contribute to the articular chondrocyte population (Archer et al., 1994; Ito and
Kida, 2000). In contrast, collagen II staining along the
periphery of the humeral epiphysis was dampened in intensity and did not extend as far into the interzone in
adeno-5334 infected areas (Fig. 5B,C). Double labeling of
this same section for versican (Fig. 3E) verified attenuation of versican signal in this same location. Tenascin C
has also been suggested as an important ECM constituent necessary for establishment of articular cartilages
(Koyama et al., 1995; Pacifici, 1993, 1995) and combined
adeno-320 þ adeno-5334-shRNA treatment resulted in
attenuation of pericellular tenascin associated with distal humeral chondrocytes of the presumptive articular
surface along the interzone boundary in areas of adenoviral infection (Fig. 5D–F).
Hyaluronan and its CD44 receptor have been previously demonstrated as crucial to joint morphogenesis
(Craig et al., 1990; Archer et al., 1994; Edwards et al.,
1994; Pitsillides et al., 1995; Dowthwaite et al., 1998;
Matsumoto et al., 2007) and versican may interact with
both (reviewed in Wight, 2002; Wu et al., 2005). Because
the chick CD44 antibody (ID10) did not work well on
paraffin-sectioned specimens, cryosectioned material was
404
NAGCHOWDHURI ET AL.
Fig. 4. Expression of combined adeno-320 þ adeno-5334 versican
shRNAs does not correlate with changes in mitosis in the HH34 humeroulnar interzone following injection at HH25 [CLC, panels (A,C,E,G) and
versican adeno-shRNA treatment, panels (B,D,F,H)]. A: CLC displaying
well-organized cell layers within central interzone lamina (bracket). h,
humerus. u, ulna. B: LacZ reporter histochemistry shows localization of
adeno-320 þ adeno-5334 shRNA (comb) expression in the elbow interzone. Bracketed area shows disorganization of interzone cells. C: Phosphohistone H3 (ser10) labeling of control interzone in boxed area of
panel (A) shows low number of mitotic cells (arrowheads) within the
control elbow joint. D: Phosphohistone H3 (ser10) labeling of section in
boxed area of panel (B) identifies similar number of mitotic cells in inter-
zone areas expressing adeno-320 þ adeno-5334 shRNA. E: Higher
magnification phase contrast image of bracketed area of panels (A) and
(C) show typical laminar organization of control interzone cells (small
arrows). F: Higher magnification phase contrast image of bracketed
area in panels (B) and (D) shows disruption of interzone cell alignment
following adeno-320 þ adeno-5334 treatment. G: Higher magnification
image of boxed area in (A) and (C) shows cell-associated TGFb3 immunolocalization in the control interzone (large arrows denote representative labeled cells). H: Higher magnification of boxed area in (B) and (D)
shows similar interzone TGFb3 localization noted in panel (G) (large
arrows) following adeno-320 þ adeno-5334 shRNA treatment. Scale
bar in (A) ¼ 100 lm for panels (A–D) and (E) ¼ 25 lm for (E–H).
utilized for immunodetection of CD44 and histochemical
localization of hyaluronan. As seen in Fig. 5G, strong
pericellular hyaluronan signal was observed in both cartilages and interzone of the HH34 humeroulnar joint
rudiment in the control wing. Hyaluronan signal was
particularly notable within the central interzone where
mesenchyme was aligned in the typical stratiform orientation parallel to the future joint line (Dowthwaite et al.,
VERSICAN KNOCKDOWN IN CHICK JOINT RUDIMENT
TABLE 2. Fold change (6) of versican and selected
skeletal/joint-associated mRNA at HH35 as determined by microarray analysis following coinjection
of adeno-320 1 5334 shRNA at HH25
Molecule (gene ID)
Fold
change
Versican/PG-M (NM_204787)
Collagen IIA-alpha 1 precursor (NM_204426)
Tenascin C (X73833)
Hyaluronan synthase 2 (NM_204806)
CD44 (CR386646)
Link protein 1 (NM_205482)
TGFB3 (NM_205454)
0.61
0.18
0.37
1.13
0.30
0.39
þ0.20
Fold change derived from average log ratios from two
arrays as compared to adenocontrol shRNA treatment.
1998). A marked decrease in expression of hyaluronan
was observed along the distal humerus in future articular and adjacent interzone regions expressing the adeno320 shRNA (Fig. 5H,I). As noted previously, the laminar
organization of the interzone also appeared disrupted in
response to reduction in versican protein. CD44 was also
highly expressed in cells of the HH34 elbow interzone of
the uninjected control (Fig. 5J) and was visibly reduced
at sites of adeno-320 expression within the joint region
(Fig. 5K,L).
Versican interaction with hyaluronan is stabilized by
link protein, which has greater affinity for versican than
aggrecan (Shi et al., 2004). Transient expression of link
protein has also been reported in the precavitation interzone of the mouse autopod (Capehart, 2010), so it was of
interest to investigate its expression in early stages of
chick joint morphogenesis. Little link protein was
observed in the control humeroulnar interzone at HH36,
but low-level cell-associated immunoreactivity was found
within the humeroulnar interzone alongside areas of
adeno-320þ adeno-5334 expression (Fig. 5M–O). As
expected, link protein was highly expressed in the cartilage matrix of humeral and ulnar epiphyses. Unlike
collagen II and tenascin, however, little link protein
expression was observed in the presumptive articular
region immediately adjacent to the central interzone
(Fig. 5M). Relative to the same region of the CLC, link
protein expression in epiphyseal chondrocytes of the humerus subjacent to the future articular surface was
notably reduced in response to adeno-320 þ adeno-5334
coinjection at HH25 (Fig. 5N,O).
DISCUSSION
Joint morphogenesis hinges on a series of physical
and molecular processes that involve specification and
formation of the joint interzone. The hyalectin proteoglycan, versican, is continuously expressed throughout the
matrix of the joint interzone during early stages of chick
limb development while at progressively later stages
(HH41) it persists in articular chondroctyes (Shepard
et al., 2007). The intent of this study was to better
understand matrix versican’s function during early
establishment of the synovial joint rudiment. We
approached this question by attempting to analyze the
morphologic and molecular consequences of ectopically
silencing versican protein levels in the synovial joint
during early stages of joint development (HH25) and
405
assessing the effects at HH34-36 using adenovirally
encoded shRNAs prepared by our laboratory in combination with in ovo microinjection. In our study using a
transient knockdown system to target versican specifically within developing joint tissues, we chose to focus
primarily on the impacts of versican silencing on the
elbow joint. This was done in part as a precaution since
microinjection into the future autopod could potentially
damage the apical ectodermal ridge or progress zone and
lead to mechanically induced skeletal deformities (Saunders, 1948), and because reproducibly targeting
adenoviral constructs to this joint location was better
achieved. Histochemical staining of HH36 embryos
resulted in significant reduction in the joint interzone
area between the opposing epiphyses in experimental
shRNA-treated elbows when compared with controls. In
addition to diminution in elbow template spacing in
whole-mount specimens, we noticed reduced immunoexpression of other synovial joint and cartilage markers in
tissue sections including collagen II, tenascin, CD44,
hyaluronan, and link protein at sites of shRNA transfection. This was often accompanied by varying degrees of
disorganization of the typical well-ordered alignment of
interzone cells that occurs parallel to and along the
future joint line (Dowthwaite et al., 1998).
A recent study utilizing a conditional versican knockout mouse reported ‘‘tilting’’ of joints of the hindlimb
autopod (Choocheep et al., 2010), which was ascribed to
close packing of mesenchymal cells at the joint interzone
and perhaps disruption of chondrocyte columns within
the epiphyseal growth plate of the digits. In the mutant,
the authors also observed aberrant nodes of chondrocyte
hypertrophy and slight delays in chondrocyte differentiation when compared with wild-type hindlimb autopod.
The joint phenotype and delays in chondrogenesis were
attributed to disruption in versican-dependent localization of TGFb family members. Interestingly, the authors
did not notice a difference in the more proximal elbow or
knee joints and concluded that the phenotype was only
observed in the autopod, since TGFb signaling is more
prevalent in that area (Choocheep et al., 2010). TGFb3
has been utilized successfully in a recent joint regeneration protocol (Lee et al., 2010); therefore, we elected to
examine TGFb3 expression in early avian joint tissues.
In this study, little or no difference in immunodetectable
TGFb3 was detected between control and versican
knockdown specimens in the elbow joint interzone and
there was actually slight upregulation of TGFb3 mRNA
in experimental elbow regions (Table 2). Although versican expression patterns in developing joint tissues
appear highly conserved between chick and mouse
(Snow et al., 2005; Shepard et al., 2007; Capehart,
2010), it is possible that species-specific differences may
occur with regard to versican/TGFb interaction in joints
proximal to the autopod.
After injection with versican shRNAs, we noted
marked reduction in expression of collagen II among
articular chondrocytes concomitant with decreased levels
of versican. Since collagen II is a well-established
marker for chondrocyte differentiation (Linsenmeyer
et al., 1973), decrease in collagen II occurring from versican knockdown at sites of articular cartilage formation
could translate into a delay or inhibition in establishment of the future articular layer. Versican has been
implicated previously in early stages of cartilage
Fig. 5. Impact of versican reduction on expression of joint-related
molecules at HH34 (G–L) and HH36 (A–F, M–O) following microinjection
at HH25. A: Collagen II (coll II) immunoreactivity is strong in the ECM
along the developing articular surface of the humerus (h) and ulna (u) in
the CLC elbow. Inset shows higher magnification of boxed area in
which collagen II staining extends into the interzone (small arrowhead).
B: Collagen II staining is reduced along the incipient articular region in
response to adeno-5334 versican shRNA treatment. Higher magnification inset shows less collagen II signal extending into the interzone in
the same area of the humerulnar joint. C: LacZ reporter staining of
panel (B) shows region of adeno-5334 shRNA expression in the interzone. Higher magnification inset confirms adeno-5334 expression along
the articular surface. D: Tenascin (tn) stains the chondrocyte matrix
intensely along the articular surface of the humerus (large arrow) in the
control elbow. E: Attenuation of tenascin signal is noted along the articular edge of specimens coinjected with adeno-320 þ adeno-5334 versican shRNA (comb). F: LacZ reporter localization of panel (E) shows
adeno-320 þ adeno-5334 shRNA along the articular edge and interzone
adjacent to the humerus. Bracket outlines central humeroulnar interzone. G: Hyaluronan (ha) is highly expressed in the epiphyses and
around well organized mesenchyme of the central humeroulnar inter-
zone (bracketed area) in CLC limb. H: Adeno-320 shRNA treatment
reduces hyaluronan levels along the articular boundary and interzone
(boxed area). Note interzone lacking well-aligned cellular arrangement.
I: LacZ reporter staining of panel H shows adeno-320 expression
(boxed area) in the articular region and interzone. Dashed line outlines
developing articular edge of the humerus. J: CD44 is also highly
expressed (small arrow) along the presumptive articular cartilage and
interzone between humerus, ulna, and radius (r) of the control elbow. K:
CD44 immunostaining is less intense in same area of adeno-320
injected elbow (boxed area). L: Adeno-320 expression in panel (K) is
confirmed by lacZ reporter staining (boxed area). M: Link protein surrounds epiphyseal chondrocytes (large arrowhead) of the humerus just
deep to the developing articular region (small asterisk) of control elbow
joints. N: Coinjection of adeno-320 þ adeno-5334 versican shRNA
(comb) resulted in reduced link protein immunoreactivity in the same
location just deep to the articular zone. Faint immunostaining is also
noted in the adjacent interzone (large asterisk). O: LacZ reporter staining of panel (N) shows adeno-320 þ adeno-5334 expression in epiphyseal and articular chondrocytes of the humerus as well as within
adjacent interzone. Scale bars in panel (C) ¼ 100 lm for panels (A–C,
G–L) and 25 lm in insets in (A–C). (F) ¼ 25 lm in (D–F, M–O).
VERSICAN KNOCKDOWN IN CHICK JOINT RUDIMENT
differentiation (Williams et al., 2005; Kamiya et al.,
2006; Shepard et al., 2008; Choocheep et al., 2010), so it
is entirely possible that it facilitates transition of outer
interzone laminae into the articular cartilage phenotype.
The expression pattern of the glycoprotein tenascin,
which is codistributed with collagen II in the epiphysis,
was also impacted by versican knockdown in the elbow
joint region, especially in the presumptive articular cartilage matrix lining the epiphyseal ends of the distal
humerus. A previous study has shown that in cartilaginous areas where reduction in tenascin occurs, the areas
become particularly vulnerable to chondrocyte maturation leading to osteogenesis (Pacifici et al., 1993). In our
experiments, we noticed reduced levels of tenascin
among articular chondrocytes concurrent with versican
silencing. It is intriguing to think that normal versican
levels may deter articular chondrocytes from transitioning into bone by helping to maintain adequate tenascin
in the extracellular environment. Such activities for versican along the developing articular cap would suggest
that its role is different, but complementary to that of
aggrecan, which provides joint cartilages with their
unique functional characteristics and is largely
expressed in a nonoverlapping pattern with versican as
joint formation proceeds (Shepard et al., 2007).
Link protein shows greater affinity toward interaction
with the G1 domain of versican than the G1 domain of
aggrecan to form stable versican-hyaluronan-link protein
complexes (Shi et al., 2004). In this study, little link protein was observed in early chick interzone tissue of
control specimens at HH36 but was predominant in the
epiphyseal cartilage matrix, just deep to the incipient
articular surface. Link protein immunoreactivity, however, was markedly reduced in this location in response
to versican knockdown. Link protein was expressed in
the interzone of the prx1-Cre conditional versican mutant (Choocheep et al., 2010) and was suggested to
stabilize hyaluronan in the absence of versican. In the
chick elbow, weak link protein immunoreactivity was
noted in the versican deficient interzone in keeping with
the previously reported compensatory mechanism for
sustaining hyaluronan.
Hyaluronan and its cell surface receptor CD44 have
long been proposed to possess key roles in synovial joint
morphogenesis. Furthermore, a recent publication has
shown that versican is involved in regulating hyaluronan and CD44 activities in extracellular signal
transduction pathways (Suwan et al., 2009). Another
study using conditional deletion of hyaluronan synthase
2 (Has2) knockout mice led to defective synovial joint
cavities along with defects in chondrocyte maturation
confirmed by reduction in extracellular aggrecan (Matsumoto et al., 2009). Defective joints were also reported
in cases where interaction between hyaluronan and
CD44 was interrupted using hyaluronan oligosaccharides (Dowthwaite et al., 1998). Interestingly, ADAMTS1 has been suggested to proteolyze versican in the early
mouse interzone, yielding a fragment containing the
hyaluronan-binding G1 domain that may function independently of the intact proteoglycan (Capehart, 2010). In
this study, versican knockdown yielded visible deficiencies in both CD44 and hyaluronan at sites of adenoshRNA infection in the early elbow region. Down regulation of CD44 and hyaluronan synthase 2 transcripts also
lends support to versican’s ties to the hyaluronan path-
407
way. It is not known at present whether versican elicits
its effects on mRNA expression of these molecules and
the others investigated herein through direct interaction
with hyaluronan and/or CD44 signaling or perhaps
through an alternative mechanism such as the TGFbsmad pathway. In any case, versican misexpression may
have impacts at the transcript or functional level in
keeping with a growing appreciation of ECM influence
on gene expression as well as on direct matrix interactions. Clearly, much remains to be learned regarding
versican’s interplay with the hyaluronan pathway during joint morphogenesis.
In this study, reduction in nonchondrogenic interzone
spacing between opposing epiphyses comprising the elbow
joint did not appear due to reduced proliferation or
increased apoptosis either as a generalized response to
adenoviral infection or to lowered versican protein. The
reduction in interzone area appeared due to alterations in
alignment and layering of interzone cells as a result of
reduction of matrix constituents including hyaluronan
and versican. Alternatively, reduction of collagen II and
tenascin along the developing articular surface or link
protein in the epiphyseal cartilage matrix could perhaps
alter signaling to the interzone through an unidentified
mechanism, thus impacting matrix structure. It was not
possible to draw unequivocal conclusions regarding effects
of versican knockdown on early joint cavitation events
due to variability in degree of interzone cell separation
among CLC or shRNA-treated specimens at HH34-36. In
addition, due to the variable size of lacZ-positive infection
sites and level of versican reduction within the developing
joint rather than its complete deletion from the entire
rudiment, it was necessary to restrict comparative observations in tissue sections to the local level in which
adenoviral mediated shRNA expression occurred. As
such, results still show that versican misexpression
within the developing joint structure can alter early
aspects of joint morphology. From our examination of several factors impacted by versican knockdown, it appears
that the reduced interzone area phenotype observed in
whole-mount specimens is likely due to a collective effect
on interzone matrix structure as a result of localized versican silencing. Taken together, results suggest that
reduced versican in combination with attenuated expression of hyaluronan, CD44, and perhaps articular tenascin
may destabilize the ECM leading to alteration of interzone area. In addition, reduction in collagen II levels
within the outer edges of the interzone along the forming
articular surface suggests that articular cartilage differentiation may be compromised or at least delayed in
response to lowered versican.
ACKNOWLEDGEMENTS
The authors would like to extend their appreciation to
Dr. Stanly Hoffman, Medical University of South Carolina, for the kind gift of chick versican antibody.
LITERATURE CITED
Archer CW, Morrison H, Pitsillides AA. 1994. Cellular aspects of
the development of diarthrodial joints and articular cartilage. J
Anat 184:447–456.
Archer CW, Dowthwaite GP, Francis-West P. 2003. Development of
synovial joints. Birth Defects Res 69:144–155.
408
NAGCHOWDHURI ET AL.
Aspberg AR, Miura S, Bourdoulous M, Shimonaka D, Heinegard
MS, Ruoslahti E, Yamaguchi Y. 1997. The C-type lectin domains
of lecticans, a family of aggregating chondroitin sulfate proteoglycans, bind tenascin-R by protein-protein interactions independent
of carbohydrate moiety. Proc Natl Acad Sci USA 94:10116–10121.
Capehart AA. 2010. Proteolytic cleavage of versican during limb
joint development. Anat Rec 293:208–214.
Craig FM, Bayliss MT, Bentley G, Archer CW. 1990. A role for hyaluronan in joint development. J Anat 171:17–23.
Craig FM, Bentley G, Archer CW. 1987. The spatial and temporal
pattern of collagens I and II and keratin sulphate in the developing chick metatarsophalangeal joint. Development 99:383–391.
Choocheep K, Hatano S, Takagi H, Watanabe H, Kimata K, Kongtawelert P, Watanabe H. 2010. Versican facilitates chondrocyte dierentiation and regulates joint morphogenesis. J Biol Chem 285:
21114–21125.
de Boever S, Vangestei C, de Backer P, Croubels S, Sys S. 2008.
Identification and validation of housekeeping genes as internal
control for gene expression in an intravenous LPS inflammation
model in chickens. Vet Immunol Immunopathol 122:312–317.
Dowthwaite GP, Edwards JCW, Pitsillides AA. 1998. An essential
role for the interaction between hyaluronan and hyaluronan binding proteins during joint development. J Histochem Cytochem 46:
641–651.
Edwards JC, Wilkinson LS, Jones HM, Soothill P, Henderson KJ,
Worrall JG, Pitsillides AA. 1994. The formation of human synovial joint cavities: a possible role for hyaluronan and CD44 in
altered interzone cohesion. J Anat 185:355–367.
Fell H, Canti R. 1934. Experiments on the development in vitro of
the avian knee joint. Proc Royal Soc 116:316–327.
Guo X, Day TF, Jiang X, Garrett-Beal L, Topol L, Yang Y. 2004.
Wnt/beta-catenin signaling is sucient and necessary for synovial
joint formation. Genes Dev 18:2404–2417.
Hall BK, Miyake T. 2000. All for one and one for all: condensations
and the initiation of skeletal development. BioEssays 22:138–147.
Hamburger V, Hamilton HL. 1951. A series of normal stages in the
development of the chick embryo. J Morphol 88:49–92.
Hamburger V, Waugh M. 1940. The primary development of the
skeleton in nerveless and poorly innervated limb transplants of
chick embryos. Physiol Zool 13:367–384.
Hartmann C, Tabin CJ. 2001. Wnt-14 plays a pivotal role in inducing synovial joint formation in the developing appendicular skeleton. Cell 104:341–351.
Howlett CR. 1979. The fine structure of the proximal growth plate
of the avian tibia. J Anat 128:377–399.
Hudson KS, Andrews K, Early J, Mjaatvedt CH, Capehart AA.
2010. Versican G1 domain and V3 isoform overexpression results
in increased chondrogenesis in the developing chick limb in ovo.
Anat Rec 293:1669–1678.
Isogai Z, Aspberg A, Keene DR, Ono RN, Reinhardt DP, Sakai LY.
2002. Versican interacts with fibrillin-1 and links extracellular
microfibrils to other connective tissue networks. J Biol Chem 277:
4565–4572.
Ito MM, Kida MY. 2000. Morphological and biochemical re-evaluation of the process of cavitation in the rat knee joint: cellular and
cell strata alterations in the interzone. J Anat 197:659–679.
Jurand A. 1965. Ultrastructural aspects of early development of the
fore-limb buds in the chick and mouse. Proc Royal Soc Lond 162:
387–405.
Kamiya N, Watanabe H, Habuchi H, Takagi H, Shinomura T, Shimizu K, Kimata K. 2006. Versican/PG-M regulates chondrogenesis as an extracellular matrix molecule crucial for mesenchymal
condensation. J Biol Chem 281:2390–2400.
Kern CB, Norris RA, Thompson RP, Argraves WS, Fairey SE, Reyes
L, Hoffman S, Markwald RR, Mjaatvedt CH. 2007. Versican proteolysis mediates myocardial regression during outflow tract development. Dev Dyn 236:671–683.
Khan IM, Redman SN, Williams R, Dowthwaite GP, Oldfield SF,
Archer CW. 2007. The development of synovial joints. Curr Topics
Dev Biol 79:1–36.
Koyama E, Leatherman JL, Shimazu A, Nah HD, Pacifici M. 1995.
Syndecan-3, tenascin-C, and the development of cartilaginous
skeletal elements and joints in chick limbs. Dev Dyn 203:
152–162.
Kuczuk MH, Scott WJ. 1984. Potentiation of acetazolamide induced
ectrodactyly in SwV and C57bL/6J mice by cadmium sulfate. Teratology 29:427–435.
LeBaron RG, Zimmermann DR, Ruoslahti E. 1992. Hyaluronate
binding properties of versican. J Biol Chem 267:10003–10010.
Lee CH, Cook JL, Mendelson MS, Moioli EK, Yao H, Mao JJ. 2010.
Regeneration of the articular suface of the rabbit synovial joint by
cell homing: a proof of concept study. Lancet 376:440–448.
Lee GM, Johnstone B, Jacobson K, Caterson B. 1993. The dynamic
structure of the pericellular matrix on living cells. J Cell Biol 123:
1899–1907.
Linsenmeyer TF, Toole BP, Trelstad RL. 1973. Temporal and spatial
transitions in collagen types during embryonic chick limb development. Dev Biol 35:232–239.
Lufti AM. 1974. The ultrastructure of cartilage cells in the epiphyses of long bones in the domestic fowl. Acta Anatomica 87:12–21.
Matsumoto K, Li Y, Jakuba C, Sugiyama Y, Sayo T, Okuno M,
Dealy CN, Tool BP, Takeda J, Yamaguchi Y, Kosher RA. 2009.
Conditional inactivation of Has2 reveals a crucial role for hyaluronan in skeletal growth, patterning, chondrocyte maturation and
joint formation in the developing limb. Development 136:
2825–2835.
Olin AI, Morgelin M, Sasaki T, Timpl R, Heinegard D, Aspberg A.
2001. The proteoglycans aggrecan and versican form networks
with fibulin-2 through their lectin domain binding. J Biol Chem
276:1253–1261.
Pacifici M. 1995. Tenascin-C and the development of articular cartilage. Matrix Biol 14:689–698.
Pacifici M, Iwamoto M, Golden EB, Leatherman JL, Lee YS,
Chuong CM. 1993. Tenascin is associated with articular cartilage
development. Dev Dyn 198:123–134.
Pacifici M, Koyama E, Iwamoto M. 2005. Mechanisms of synovial
joint and articular cartilage formation: recent advances, but
many lingering mysteries. Birth Defects Res 75:237–248.
Pfaff l MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:2002–2007.
Pitsillides AA, Archer CW, Prehm P, Bayliss MT, Edwards JCW.
1995. Alterations in hyaluronan synthesis during developing joint
cavitation. J Histochem Cytochem 43:263–273.
Pitsillides AA, Ashhurst DE. 2008. A critical evaluation of specific
aspects of joint development. Dev Dyn 237:2284–2294.
Rouslahti E. Proteoglycans in cell regulation. 1989. J Biol Chem
267:13369–13372.
Saunders JW. 1948. The proximo-distal sequence of the origin of the
parts of the chick wing and the role of the ectoderm. J Exp Zool
108:363–403.
Settle SH, Roundtree RB, Sinha A, Thacker A, Higgins K, Kingsley
DM. 2003. Multiple joint and skeletal patterning defects caused
by single and double mutations in the mouse Gdf5 and Gdf6
genes. Dev Biol 254:116–130.
Sheng W, Wang G, LaPierre DP, Wen J, Deng Z, Wong C-KA, Lee
DY, Yang BB. 2006. Versican mediates mesenchymal-epithelial
transition. Mol Biol Cell 17:2009–2020.
Shepard JB, Krug HA, LaFoon BA, Hoffman S, Capehart AA. 2007.
Versican expression during synovial joint morphogenesis. Int J
Biol Sci 3:380–384.
Shepard JB, Gliga DA, Morrow AP, Hoffman S, Capehart AA. 2008.
Versican knock-down compromises chondrogenesis in the embryonic chick limb. Anat Rec 291:19–27.
Shi S, Grothe S, Zhang Y, O’Conner-McCourt MD, Poole AR, Roughley PJ, Mort JS. 2004. Link protein has greater anity for versican
than aggrecan. J Biol Chem 279:12060–12066.
Shibata S, Fukada K, Imai H, Abe T, Yamashita Y. 2003. In situ
hybridization and immunohistochemistry of versican, aggrecan
and link protein, and histochemistry of hyaluronan in the developing mouse limb bud cartilage. J Anatomy 203:425–432.
Shinomura T, Jensen KL, Yamagata M, Kimata K, Solursh M.
1990. The distribution of mesenchyme proteoglycan (PG-M) during wing bud outgrowth. Anat Embryol 181:227–233.
VERSICAN KNOCKDOWN IN CHICK JOINT RUDIMENT
Shinomura T, Nishida Y, Ito K, Kimata K. 1993. cDNA cloning of
PG-M, a large chondroitin sulfate proteoglycan expressed during
chondrogenesis in chick limb buds. Alternative spliced multiforms
of PG-M and their relationships to versican. J Biol Chem 268:
14461–14469.
Snow HE, Riccio LM, Hoffman S, Mjaatvedt CH, Capehart AA.
2005. Versican expression during skeletal/joint morphogenesis
and patterning of muscle and nerve in the embryonic mouse limb.
Anat Record 282:95–105.
Storm EE, Huynh TV, Copeland NG, Jenkins NA, Kingsley DM,
Lee S. 1994. Limb alterations in brachypodism mice due to mutations in a new member of the TGFb-superfamily. Nature 368:
639–643.
Storm EE, Kingsley DM. 1996. Joint patterning defects caused by
single and double mutations in members of the bone morphogenetic protein (BMP) family. Development 122:3969–3979.
Suwan K, Choocheep K, Hatano S, Kongtawelert P, Kimata K,
Watanabe H. 2009. Versican/PG-M assembles hyaluronan into
409
extracellular matrix and inhibits CD44-mediated signaling toward premature senescence in embryonic fibroblasts. J Biol Chem
284:8596–8604.
Triola MF. 2005. Essentials of statistics. 2nd ed. Upper Saddle
River, NJ: Pearson Education.
Wight TN. 2002. Versican: a versatile extracellular matrix proteoglycan in cell biology. Curr Opin Cell Biol 14:617–623.
Williams DR, Presar AR, Richmond AT, Mjaatvedt CH, Hoffman S,
Capehart AA. 2005. Limb chondrogenesis is compromised in the
versican deficient hdf mouse. Biochem Biophys Res Commun 334:
960–966.
Wu YJ, LaPierre DP, Wu J, Yee AJ, Yang BB. 2005. The interaction
of versican with its binding partners. Cell Res 15:483–494.
Zanin MK, Bundy J, Ernst H, Wessels A, Conway SJ, Hoffman S.
1999. Distinct spatial and temporal distributions of aggrecan and
versican in the embryonic chick heart. Anat Rec 256:366–380.
Zimmermann DR, Ruoslahti E. 1990. Multiple domains of the large
fiboblast proteoglycan, versican. EMBO J 8:2975–2981.
Документ
Категория
Без категории
Просмотров
4
Размер файла
1 499 Кб
Теги
development, stage, area, joint, chick, versican, synovial, reduced, interzone, early, knockdown
1/--страниц
Пожаловаться на содержимое документа