close

Вход

Забыли?

вход по аккаунту

?

14647273.2017.1388545

код для вставкиСкачать
Human Fertility
an international, multidisciplinary journal dedicated to furthering
research and promoting good practice
ISSN: 1464-7273 (Print) 1742-8149 (Online) Journal homepage: http://www.tandfonline.com/loi/ihuf20
The association of renin–angiotensinogen system
genes polymorphisms and idiopathic recurrent
pregnancy loss
Mohammad Mehdi Heidari, Mozhgan Sheikholeslami, Mahdieh Yavari,
Mehri Khatami & Seyed Mohammad Seyedhassani
To cite this article: Mohammad Mehdi Heidari, Mozhgan Sheikholeslami, Mahdieh Yavari, Mehri
Khatami & Seyed Mohammad Seyedhassani (2017): The association of renin–angiotensinogen
system genes polymorphisms and idiopathic recurrent pregnancy loss, Human Fertility, DOI:
10.1080/14647273.2017.1388545
To link to this article: http://dx.doi.org/10.1080/14647273.2017.1388545
Published online: 23 Oct 2017.
Submit your article to this journal
Article views: 1
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at
http://www.tandfonline.com/action/journalInformation?journalCode=ihuf20
Download by: [UAE University]
Date: 25 October 2017, At: 14:18
HUMAN FERTILITY, 2017
https://doi.org/10.1080/14647273.2017.1388545
ORIGINAL ARTICLE
The association of renin–angiotensinogen system genes polymorphisms and
idiopathic recurrent pregnancy loss
Mohammad Mehdi Heidaria, Mozhgan Sheikholeslamia, Mahdieh Yavaria, Mehri Khatamia and
Seyed Mohammad Seyedhassanib
Department of Biology, Faculty of Science, Yazd University, Yazd, Iran; bDr. Seyedhassani Medical Genetic Center, Yazd, Iran
Downloaded by [UAE University] at 14:18 25 October 2017
a
ABSTRACT
ARTICLE HISTORY
The most common complication of pregnancy is idiopathic recurrent pregnancy loss (RPL). To
identify the contribution of gene polymorphisms to this condition, we evaluated the association
between RPL and the angiotensinogen (AGT), angiotensin receptor 1 (AGTR1) and
Angiotensinogen converting enzyme (ACE). In this case–control study, the frequency of AGT
(rs4762 and rs699), AGTR1 (rs5186) and ACE insertion/deletion (rs4340) polymorphisms in 202
idiopathic RPL women was compared with 210 women with no history of abortion, using tetraprimer ARMS-PCR. Polymorphisms were analysed by logistic regression analysis according to
inheritance models. The CT genotype of AGT rs4762, the CC genotype of AGT rs699 and the AC
genotype of AGTR1 rs5186 in a co-dominant inheritance model were associated with idiopathic
RPL (OR ¼ 1.63, 95% CI ¼ 1.07–2.49 of CT versus CC; OR ¼ 5.97, 95% CI ¼ 1.28–27.82 of CC versus
TT; and OR ¼ 1.99, 95% CI ¼ 1.22–3.07 of AC versus AA). The allele frequency of AGT rs699 and
AGTR1 rs5186 polymorphisms, but not AGT rs4762 and ACE rs4340 polymorphisms were significantly different between women with RPL patients and controls (p ¼ 0.020, p ¼ 0.003, p ¼ 0.105
and p ¼ 0.065, respectively). These results show that there is a significant relationship between
AGT (rs699) and AGTR1 (rs5186) polymorphisms and idiopathic RPL in the Iranian population.
Received 11 February 2017
Accepted 28 August 2017
Introduction
Recurrent pregnancy loss (RPL) is defined as the loss
of three or more consecutive pregnancies before 24th
gestational weeks (Akolekar, Bower, Flack, Bilardo, &
Nicolaides, 2011; Rull, Nagirnaja, & Laan, 2012). In
another definition, two consecutive pregnancy losses
are sufficient for inclusion in the RPL group (Jauniaux,
Farquharson, Christiansen, & Exalto, 2006; Practice
Committee of American Society for Reproductive
Medicine, 2012; Su, Lin, & Chen, 2011). The prevalence
of RPL has been estimated at one in 300 pregnancies
(Berry et al., 1995; Branch, Gibson, & Silver, 2010).
Factors that increase the risk of RPL include parental
chromosomal rearrangements, uterine anatomic abnormalities, endocrine dysfunction, familial thrombophilia,
immunological disorders, diabetes mellitus, lifestyle
factors
and
maternal
infection
(Christiansen,
Steffensen, Nielsen, & Varming, 2008; Hefler et al.,
2002; Rai & Regan, 2006). Statistical studies showed
that miscarriage occurs increasingly in families with a
history of idiopathic RPL. At least 50% of all abortions
are frequently of unknown origin and remain unexplained. These cases are considered idiopathic
CONTACT Mohammad Mehdi Heidari
ß 2017 The British Fertility Society
Heidarimm@yazd.ac.ir
KEYWORDS
Recurrent pregnancy loss;
renin–angiotensin system;
AGT; AGTR1; ACE;
polymorphism
(Andersen, Wohlfahrt, Christens, Olsen, & Melbye,
2000; Kolte et al., 2011).
The renin–angiotensin system (RAS) plays an
important role in many functions including regulation
of the cell cycle and apoptosis and its activation is
vital to many common physiological conditions including growth and differentiation during very early
human organogenesis (Hall, 2003; Lv & Liu, 2015; Paul,
Mehr, & Kreutz, 2006; Wegman-Ostrosky, Soto-Reyes,
Vidal-Millan, & Sanchez-Corona, 2015). In the RAS pathway, angiotensinogen (AGT) is cleaved by renin to
produce the inactive angiotensin I, which is then converted to angiotensin II by endothelial angiotensinconverting enzyme (ACE). This circulating pathway
controls blood volume, blood pressure and homeostasis (Branch et al., 2010). According to recent findings,
predisposition to thrombophilia, a tendency for blood
clot formation due to genetic or non-genetic causes,
has been shown to play a critical role in the development of RPL (Hyde & Schust, 2015). Genetic nucleotide
changes in the RAS genes, such as AGT, angiotensinogen II type-1 receptor (AGTR1) and ACE genes have
been considered as candidates that increase the risk of
Department of Biology, Faculty of Science, Yazd University, Yazd, Iran
2
M. M. HEIDARI ET AL.
Table 1. Clinical characteristics of patients and control groups.
Groups
No.
Age
(year)
RPL
Controls
202
210
27.32 ± 5.46a
29.68 ± 4.74
BMI
(kg/m2)
Gestation age in
miscarriage time
(week)
No. of
abortion
(range)
No. of
pregnancy
(range)
24.06 ± 3.54
22.95 ± 3.25
10.42 ± 4.32
0
4.53 ± 1.63 (3–9)
0
0
2.63 ± 0.82 (2–3)
Downloaded by [UAE University] at 14:18 25 October 2017
RPL: recurrent pregnancy loss.
a
Data are presented as mean ± SD.
thrombotic events (Kusmierska-Urban, Rytlewski, &
Reron, 2013; Rigat et al., 1990; Wang et al., 2013).
Thus, according to this new hypothesis, patients carrying predisposing polymorphisms in AGT, AGTR1 and
ACE genes may be prone to developing RPL (Alkanli,
Sipahi, Kilic, & Sener, 2014; Buchholz, Lohse, Kosian, &
Thaler, 2004; Choi et al., 2011).
AGT is a critical regulatory system of electrolyte
homeostasis and blood pressure. The rs4762 (T207M)
and rs699 (M235T) polymorphisms in the AGT gene
consist of nucleotide substitutions in exon 2 that lead
to threonine to methionine and methionine to threonine substitutions at positions 207 and 235 in the
amino acid sequence. These polymorphisms are associated with alterations in the production of angiotensin
II (Abdollahi et al., 2005; Guo, Furuta, Mizukoshi, &
Inagami, 1994). In the human, the AGTR1 gene comprises five exons, and spans over 55 kb of 3q21-25
(Guo et al., 1994). The rs5186 (A1166C) polymorphism
is located in the 30 untranslated region, and includes
an A to C transversion at nucleotide 1166. In addition,
the human ACE gene on 17q23.3 contains 26 exons
and 25 introns. Recent studies have also reported the
presence of a 287-bp fragment (insertion, I) or its
absence (deletion, D) in intron 16, affecting the plasma
level and tissue specific ACE activity. The ACE DD
genotype may be associated with increased expression
of plasminogen activator inhibitor-1 (PAI-1), reduced
levels of fibrinolysis and risk of thrombotic events,
compared with the lowest ACE activity in carriers of
the angiotensin II genotype. (Fatini et al., 2003; Rigat
et al., 1990; Yang et al., 2012).
Several studies have explored nucleotide variations
of RAS genes with numerous disorders including cardiovascular disease, several types of cancers, Alzheimer
disease, hypertension, diabetic nephropathy and pregnancy complications (Bagheri, Abdi Rad, Omrani, &
Nanbaksh, 2010; Ding et al., 2012; Khatami et al., 2017;
Xi et al., 2011; Zhang, Zhou, & Zhang, 2013). It is
thought that increased angiotensinogen levels could
be a result of the association of AGT, AGTR1 and ACE
polymorphisms with vascular diseases and pregnancy
related diseases, such as abortion, and may increase
susceptibility to RPL. Despite many studies on AGT,
AGTR1 and ACE gene polymorphisms, the present
research is the first to evaluate the association
between these gene polymorphisms with idiopathic
recurrent pregnancy loss in a population of Iranian
women.
Materials and methods
Patients
We enrolled 202 women with a history of RPL; 3–9
miscarriages with fetal loss referred to Dr. Seyed
Hassani at the Medical Genetics Center, Yazd, Iran. All
subjects gave written informed consent. The
mean ± SD age of the women with RPL and the gestational age at the time of miscarriages were
27.32 ± 5.46 years and 10.42 ± 4.32 weeks, respectively
(Table 1). Exclusion criteria were the following: anatomical disorders, abnormal karyotypes and endocrine
dysfunctions. Two hundred and ten healthy women
without previous history of thromboembolic disease
and other known causes for RPL were selected as a
control group.
Genetic analysis of AGT, AGTR1 and ACE
polymorphisms
For analysing the AGT, AGTR1 and ACE polymorphisms,
genomic DNA was isolated from blood extracted DNA
stored at 20 C. Tetra-primer ARMS-PCR was used for
genetic screening of polymorphisms in the AGT and
AGTR1 genes. All primers were designed by a web
primer design program, Primer1, accessible at http://
primer1.soton.ac.uk/primer1.html. The specificity of the
primers was assayed by ‘BLAST’ program at http://
www.ncbi.nlm.nih.gov/blast (Table 2).
PCR was performed in a total volume of 25 mL containing 50 ng of template DNA, 5 pmol of each outer
primers, 10 pmol of each inner primers, 1 Multiplex
PCR Master Mix (Yekta Tajhiz Azma Co., Tehran, Iran).
PCR amplification (touchdown) was carried out at
95 C for 2 min, followed by denaturation at 95 C for
20 s, first annealing at 69–60 C (10 cycles) and remaining 25 cycles of annealing at 60 C for 1 min and
extension at 72 C for 1 min, followed by a final extension for 5 min. The PCR products were electrophoresed
HUMAN FERTILITY
3
Table 2. Primer sequences and length of the amplified segments in tetra-primer ARMS-PCR for
AGT and AGTR1 polymorphisms and PCR for ACE I/D polymorphism.
Gene
AGT SNP ID: rs4762 (C521T)
AGT SNP ID: rs699 (T702C)
AGTR1 SNP ID: rs5185 (A1166C)
ACE SNP ID: rs4340 (I/D)
Primer sequence
Amplicon size
F1: 50 -GTCCTCTCCCCAACGGCTGTCT-30
R1: 50 -GCTGTGAACACGCCCACCAACA-30
F2: 50 -GGCCCAGCTGCTGCTGTCAAC-30
R2: 50 -GCAGCCACTTCCCCACTTCTCA-30
F1: 50 -GGACTTCACAGAACTGGATGTTG-30
R1: 50 - GCTGTGAACACGCCCACCAACA -30
F2: 50 -GGAAGACTGGCTGCTCCCTTAC-30
R2: 50 -GTGCTGTCCACACTGGCTCACA-30
F1: 50 -TGAGCACGCTTTCCTACCGC-30
R1: 50 -CCTTTGGAAACTGGACAGAAC-30
F2: 50 -AGCACTTCACTACCAAATGAACA-30
R2: 50 -TTCAATTCTGAAAAGTAGCTGAG-30
F: 50 -CCCATCCTTTCTCCCATTTCTC-30
R: 50 -CATAACAGGTCTTCATATTTCCG-30
C allele (403bp)
T allele (244bp)
Control band (606 bp)
T allele (490bp)
C allele (428bp)
Control band (875 bp)
A allele (354 bp)
C allele (188 bp)
Control band (497 bp)
I allele (491 bp)
D allele (203 bp)
Downloaded by [UAE University] at 14:18 25 October 2017
on a 1.5% Agarose gel and stained with ethidium
bromide (Figures 1 and 2).
Statistical analysis
Distributions of continuous variables in groups were
expressed as mean ± SD, and compared with unpaired
Student’s t-tests. The genotype and allele frequencies,
odds ratio (OR) and 95% confidence intervals (CI)
between the cases and the normal controls were calculated using logistic regression. The OR and 95% CI were
used as a measure of the association between genotype
and allelic frequencies and RPL. Statistical analysis was
performed with the Statistical Package for Social
Sciences (SPSS 16.0 for Windows; SPSS Inc., Chicago, IL)
and statistical significance was accepted at a p < 0.05
level.
Results
In the present study, we evaluated four types of polymorphisms in the AGT, AGTR1 and ACE genes in
women with a history of at least three miscarriages
compared with women with no history of spontaneous
abortion. The genotype distributions and allelic frequencies of AGT, AGTR1 and ACE gene polymorphisms
in patients and healthy women are shown in Tables 3
and 4. The genotype distributions of all polymorphisms in the cases and controls were in
Hardy–Weinberg equilibrium.
Of the 202 women with RPL investigated for the
AGT rs4762 (C521T) polymorphism, 63.9% had the CC
genotype and 37.1% the CT genotype. The variability
of AGT CT genotype in the patients was higher than in
the healthy women. Accordingly, the AGT CT genotype
(OR ¼ 1.63, 95% CI: 1.07–2.49, p ¼ 0.022) had a significant association with RPL. We also investigated AGT
rs699 (T702C) polymorphism in these patients. About
Figure 1. Agarose gel electrophoresis of the tetra-primer PCR
products of AGT polymorphisms. (A) The CC genotype (rs4762)
(606bp and 403bp, lanes 1, 3, 4 and 6) and the CT genotype
(606 bp, 403bp and 244bp), shown in lanes 2 and 5. (B) The TT
genotype (rs699) (875bp and 490bp), shown in lanes 2, 3 and 6,
the TC genotype (875 bp, 490 bp and 428 bp), shown in lanes 4, 5
and 7 and the CC genotype (875 bp and 428bp), shown in lane 1.
55.9% had the TT genotype, 39.1% the TC genotype,
and 5.0% the CC genotype. In a co-dominant model
with univariate logistic regression analysis, the d CC
genotype had a significant association with RPL
4
M. M. HEIDARI ET AL.
statistically significant difference in the AGT rs4762 C
allele and ACE rs4340 I allele prevalence between
patients and controls (p ¼ 0.105 and p ¼ 0.65, respectively), whereas the AGT rs699 T allele prevalence was
significantly higher in the patients (p ¼ 0.020). For
AGTR1 rs5186 polymorphism, results of allelic frequencies analysis showed a significant association between
RPL and AGTR1 rs5186 A allele (p ¼ 0.003).
Downloaded by [UAE University] at 14:18 25 October 2017
Discussion
Figure 2. Agarose gel electrophoresis of (A) the tetra-primer
PCR products of AGTR1. The AA genotype (rs5185) (497 bp and
354), shown in lanes 1, 2, 4 and 5 and the AC genotype
(497 bp, 354 bp and 188bp), shown in lanes 3 and 6. (B) the
PCR products of ACE. The II genotype (rs4340) (491 bp), the I/D
genotype (491 bp and 203 bp), the D/D genotype (203 bp).
(OR ¼ 5.97, 95% CI: 1.28–27.82, p ¼ 0.015). According to
the recessive model, an association was found in
women with RPL (OR: 0.18, 95% CI: 0.04–0.85;
p ¼ 0.031) (Table 3). The results of AGTR1 rs5186
(A1166C) polymorphism analysis in RPL women were
as follows: 68.3% had the AA genotype, 30.2% the AC
genotype, and 1.5% the CC genotype. According to
the co-dominant model with univariate logistic regression analysis, the AC genotype had an association with
RPL (OR ¼ 1.99, 95% CI: 1.22–3.07, p ¼ 0.004).
Dominant models also showed, an association
between AC genotype and RPL (dominant model OR:
1.98, 95% CI: 1.25–3.12; p ¼ 0.003) (Table 4).
The results of ACE rs4340 (insertion/deletion) polymorphism analysis in RPL women showed that 25.2%
had the II genotype, 50.5% the ID genotype, and
24.3% the DD genotype. There was no significant difference in rs4340 polymorphism genotype distribution
between patients and controls (Table 4).
Finally, we investigated the allelic frequencies of
AGT, AGTR1 and ACE polymorphisms in all of the
patients and healthy subjects. There was no
Researchers in different countries have examined
many genes in patients with idiopathic RPL, including
those involved in immune tolerance, inflammation,
thrombosis and the cardiovascular system (Buchholz
et al., 2004). The molecular impairments in the RAS
system in women developing complications during
pregnancy has been widely demonstrated (Jeon et al.,
2013) and show that the plasma levels of renin activity, renin concentration, angiotensinogen and angiotensin II are all lower in women with pregnancy
complications as compared with pregnant women
who have not experienced such problems (Mignini,
Villar, & Khan, 2006). AGT, AGTR1 and ACE genes are
members of the RAS complex and human linkage
studies have shown that polymorphisms in these
genes leads to improper functioning of the RAS system and may be risk factors for RPL (Afshariani et al.,
2014). At the cellular level, these genes can impact on
growth, differentiation and apoptosis in prenatal
development (Johren, Dendorfer, & Dominiak, 2004;
Vaiman, 2015; Vinson, Barker, & Puddefoot, 2012). In
the present study, we investigated the association
between genetic variation in AGT (rs4762 and rs699),
AGTR1 (rs5186) and ACE (rs4340) in recurrent pregnancy loss. Our results show statistically significant
associations between genotype frequencies of AGT
and AGTR1 polymorphisms with Iranian idiopathic RPL.
Of the few studies which have focused on the role
of AGT and AGTR1 gene polymorphisms in the pathogenesis idiopathic RPL. Hefler et al. investigated the
single base rs699 polymorphism of AGT, but did not
observe any significant differences between genotypes
and allele frequencies with idiopathic recurrent miscarriage (Hefler et al., 2002). Choi et al. compared the
AGTR1 rs5186 and AGT rs699 polymorphisms in 251
Korean patients with idiopathic recurrent spontaneous
abortions and 126 healthy controls. Their results indicated no significant differences between patients and
controls with respect to the AGT rs699 and AGTR1
rs5186 polymorphisms (Choi et al., 2011). Fatini et al.
evaluated the AGTR1 gene polymorphisms in RAS
patients as possible risk factors for fetal loss. Their
HUMAN FERTILITY
5
Table 3. Genotype and allele frequencies and dominant and the recessive models of inheritance
analysis of AGT rs4762 and rs699 polymorphisms in idiopathic RPL women and controls.
Downloaded by [UAE University] at 14:18 25 October 2017
AGT rs4762 (C521T)
Co-dominant model
CC
CT
TT
Dominant model
CC
CT þ TT
Recessive model
TT
CC þ CT
Allele frequency
C
T
AGT rs699 (T702C)
Co-dominant model
TT
TC
CC
Dominant model
TT
TC þ CC
Recessive model
CC
TT þ TC
Allele Frequency
T
C
Patients (n ¼ 202)
Controls (n ¼ 210)
OR (95% CI)
p Value
129 (63.9%)
73 (36.1%)
0 (0.0%)
156 (74.3%)
54 (25.7%)
0 (0.0%)
1 (ref.)
1.63 (1.07–2.49)
–
0.022
–
129 (63.9%)
73 (36.1%)
156 (74.3%)
54 (25.7%)
1 (ref.)
1.63 (1.07–2.49)
0.022
0 (0.0%)
202 (100%)
0 (0.0%)
210 (100%)
–
–
–
331 (81.9%)
73 (18.1%)
336 (83.2%)
54 (16.8%)
1.37 (0.93–2.01)
0.105
113 (55.9%)
79 (39.1%)
10 (5.0%)
135 (64.3%)
73 (34.8%)
2 (0.9%)
1 (ref.)
1.30 (0.87–1.94)
5.97 (1.28–27.82)
0.210
0.015
113 (55.9%)
89 (44.1%)
135 (64.3%)
75 (35.7%)
1 (ref.)
1.42 (0.95–2.11)
0.084
10 (5.0%)
192(95.0%)
2 (0.9%)
208 (99.1%)
1 (ref.)
0.18 (0.04–0.85)
0.031
303 (73.7%)
101 (26.3%)
343 (81.7%)
77 (18.3%)
1.48 (1.06–2.07)
0.020
OR: odds ratio; CI: confidence interval.
Table 4. Genotype and allele frequencies and dominant and the recessive models of inheritance
analysis of AGTR1 rs5186 and ACE rs4340 polymorphisms in idiopathic RPL women and controls.
AGTR1 rs5186 (A1166C)
Co-dominant model
AA
AC
CC
Dominant model
AA
AC þ CC
Recessive model
CC
CC þ AC
Allele frequency
A
C
ACE rs4340 (I/D)
Co-dominant model
DD
ID
II
Dominant model
DD
ID þ II
Recessive model
II
DD þ ID
Allele frequency
D
I
Patients (n ¼ 202)
Controls (n ¼ 210)
OR (95% CI)
p Value
138 (68.3%)
61 (30.2%)
3 (1.5%)
171 (81.4%)
38 (18.1%)
1 (0.5%)
1 (ref.)
1.99 (1.22–3.07)
3.72 (0.38–36.14)
0.004
0.258
138 (68.3%)
64 (31.7%)
171 (81.4%)
40 (18.6%)
1 (ref.)
1.98 (1.25–3.12)
0.003
3 (1.5%)
199 (98.5%)
1 (0.5%)
209 (99.5%)
1 (ref.)
0.32 (0.03–3.01)
0.322
337 (83.4%)
67 (16.6%)
380 (90.5%)
40 (9.5%)
1.98 (1.24– 2.87)
0.003
51 (25.2%)
102 (50.5%)
49 (24.3%)
70 (33.4%)
99 (47.1%)
41 (19.5%)
1 (ref.)
1.41 (0.89–2.22)
1.64 (0.95–2.84)
0.135
0.087
51 (25.2%)
151 (74.8%)
70 (33.4%)
140 (66.6%)
1 (ref.)
1.48 (0.96–2.27)
0.072
49 (24.3%)
153 (75.7%)
41 (19.5%)
169 (80.5%)
1 (ref.)
0.76 (0.48–1.21)
0.246
204 (50.5%)
200 (49.5%)
239 (59.2%)
181 (40.8%)
1.29 (0.98–1.70)
0.065
OR: odds ratio; CI: confidence interval.
results showed a significant association of the AGTR1
rs5186 CC genotype in patients with fetal loss (Fatini
et al., 2000) and Buchholz et al. (2004) reported that
the prevalence of genotype AGTR1 CC is similar in RPL
patients and controls.
The association between RPL and ACE I/D polymorphism has been examined but with incompatible
results. Yang et al. (2012) described the association
between RPL and ACE I/D polymorphism by metaanalysis. This research was based on 1264 patients and
Downloaded by [UAE University] at 14:18 25 October 2017
6
M. M. HEIDARI ET AL.
845 healthy controls in 9 studies. Their most important
finding was that the D allele of the ACE I/D polymorphism emerged as a potentially major risk factor
for predisposition to RPL in some populations but not
others. In the present study population a significant
association between ACE polymorphism with unexplained RPL was not observed. Similar results were
presented by Goodman et al. and Vettriselvi et al., but
not in other studies (Aarabi et al., 2011; Bagheri et al.,
2010; Goodman, Hur, Goodman, Jeyendran, & Coulam,
2009;
Vettriselvi,
Vijayalakshmi,
Paul,
and
Venkatachalam, 2008). These findings indicate a possible role for ethnic differences as a result of genetic
background and effects of the environment; an area
for future study as is the effect of age.
Since recurrent pregnancy loss is a complex disorder
in which genetic backgrounds and environmental factors interact in determining its pathogenesis, further
studies are therefore needed to search for potential
influences of the AGTR1 and AGT gene polymorphisms
in pathogenesis of RPL which may be affected via gene–gene and gene–environment interactions.
Acknowledgements
This research was supported by Yazd University. The authors
thank all of the patients to provide blood samples for scientific
research and their cooperation was essential for our work.
Disclosure statement
The authors declare that they have no conflict of interests.
Funding
This research was supported by Yazd University.
References
Aarabi, M., Memariani, T., Arefi, S., Aarabi, M., Hantoosh
Zadeh, S., Akhondi, M.A., & Modarressi, M.H. (2011).
Polymorphisms of plasminogen activator inhibitor-1,
angiotensin converting enzyme and coagulation factor XIII
genes in patients with recurrent spontaneous abortion.
Journal of Maternal, Fetal and Neonatal Medicine, 24,
545–548. doi: 10.3109/14767058.2010.511331.
Abdollahi, M., Gaunt, T., Syddall, H., Cooper, C., Phillips, D.,
Ye, S., & Day, I. (2005). Angiotensin II type I receptor gene
polymorphism: anthropometric and metabolic syndrome
traits. Journal of Medical Genetics, 42, 396–401. doi: 10.
1136/jmg.2004.026716.
Afshariani, R., Roozbeh, J., Sharifian, M., Ghaedi, M., Samsami
Dehaghani, A., & Ghaderi, A. (2014). Association between
angiotensinogen M235T polymorphism and preeclampsia
in Iranian pregnant women. Journal of Family and
Reproductive Health, 8, 169–173. Retrieved from: http://
jfrh.tums.ac.ir/index.php/jfrh/article/view/190
Akolekar, R., Bower, S., Flack, N., Bilardo, C., & Nicolaides, K.
(2011). Prediction of miscarriage and stillbirth at 11–13
weeks and the contribution of chorionic villus sampling.
Prenatal Diagnosis, 31, 38–45. doi: 10.1002/pd.2644.
Alkanli, N., Sipahi, T., Kilic, T.O., & Sener, S. (2014). Lack of
association between ACE I/D and AGTR1 A1166C gene
polymorphisms and preeclampsia in Turkish pregnant
women of Trakya region. Journal of Gynecology and
Obstetrics, 2, 49–53. doi: 10.11648/j.jgo.20140204.11.
Andersen, A., Wohlfahrt, J., Christens, P., Olsen, J., & Melbye,
M. (2000). Maternal age and fetal loss: Population based
register linkage study. Bmj (Clinical Research Ed.), 320,
1708–1712. doi: 10.1136/bmj.320.7251.1708.
Bagheri, M., Abdi Rad, I., Omrani, M.D., & Nanbaksh, F. (2010).
Polymorphisms of the angiotensin converting enzyme
gene in Iranian Azeri Turkish women with unexplained
recurrent pregnancy loss. Human Fertility, 13, 79–82. doi:
10.3109/14647273.2010.484844.
Berry, C.W., Brambati, B., Eskes, T.K.A.B., Exalto, N., Fox, H.,
Geraedts, J.P.M., … Hustin, J. (1995). The EuroTeam Early
Pregnancy (ETEP) protocol for recurrent miscarriage. Human
Reproduction, 10, 1516–1520. doi: 10.1093/HUMREP/10.6.1516.
Branch, D., Gibson, M., & Silver, R. (2010). Clinical practice.
Recurrent miscarriage. The New England Journal of
Medicine, 363, 1740–1747. doi: 10.1056/NEJMcp1005330.
Buchholz, T., Lohse, P., Kosian, E., & Thaler, C. (2004).
Vasoconstrictively acting AT1R A1166C and NOS3 4/5
polymorphisms in recurrent spontaneous abortions (RSA).
American Journal of Reproductive Immunology, 51,
323–332. doi: 10.1111/j.1600-0897.2004.00163.x.
Choi, Y.S., Kwon, H., Kim, J.H., Shin, J.E., Choi, Y., Yoon, T.K.,
Choi, D.H., & Kim, N.K. (2011). Haplotype- based association
of ACE I/D, AT1R 1166A > C,and AGT M235T polymorphisms
in renin-angiotensin-aldosterone system genes in Korean
women with idiopathic recurrent spontaneous abortions.
European Journal of Obstetrics, Gynecology and Reproductive
Biology, 158, 225–228. doi: 10.1016/j.ejogrb.2011.04.028.
Christiansen, O.B., Steffensen, R., Nielsen, H., & Varming, K.
(2008). Multifactorial etiology of recurrent miscarriage and its
scientific and clinical implications. Gynecologic and Obstetric
Investigation, 66, 257–267. doi: 10.1159/000149575.
Ding, X., Zhang, N., Cai, Y., Li, S., Zheng, C., Jin, Y., Yu, T.,
Wang, A., & Zhou, X. (2012). Down-regulation of tumor
suppressor MTUS1/ATIP is associated with enhanced proliferation, poor differentiation and poor prognosis in oral
tongue squamous cell carcinoma. Molecular Oncology, 6,
73–80. doi: 10.1016/j.molonc.2011.11.002.
Fatini, C., Gensini, F., Battaglini, B., Prisco, D., Cellai, A.P., Fedi, S.,
Marcucci, R., Brunelli, T., Mello, G., Parretti, E., Pepe, G., &
Abbate, R. (2000). Angiotensin-converting enzyme DD genotype, angiotensin type 1 receptor CC genotype, and hyperhomocysteinemia increase first-trimester fetal-loss susceptibility.
Blood Coagulation and Fibrinolysis, 11, 657–656. Retrieved
from: https://insights.ovid.com/ pubmed?pmid¼1108528610.
1097/00001721-200010000-00010
Fatini, C., Gensini, F., Sticchi, E., Battaglini, B., Prisco, D., Fedi,
S., Brunelli, T., Marcucci, R., Conti, A.A., Gensini, G.F., &
Abbate, R. (2003). ACE DD genotype: An independent predisposition factor to venous thromboembolism. European
Journal of Clinical Investigation, 33, 642–647. doi: 10.1046/
j.1365-2362.2003.01185.x.
Downloaded by [UAE University] at 14:18 25 October 2017
HUMAN FERTILITY
Goodman, C., Hur, J., Goodman, C.S., Jeyendran, R.S., &
Coulam, C. (2009). Are polymorphisms in the ACE and PAI1 genes associated with recurrent spontaneous miscarriages? American Journal of Reproductive Immunology, 62,
365–370. doi: 10.1111/j.1600-0897.2009.00744.x.
Guo, D.F., Furuta, H., Mizukoshi, M., & Inagami, T. (1994). The
genomic organization of human angiotensin II type 1 receptor. Biochemical and Biophysical Research Communications,
200, 313–319. doi: 10.1006/bbrc.1994.1450.
Hall, J. (2003). Historical perspective of the renin-angiotensin
system. Molecular Biotechnology, 24, 27–39. doi: 10.1385/
MB:24:1:27.
Hefler, L., Tempfer, C., Bashford, M., Unfried, G., Zeillinger, R.,
Schneeberger, C., … Huber, J. (2002). Polymorphisms of the
angiotensinogen gene, the endoyhelial nitric oxide synthase
gene, and the interleukin-1b gene promotor in women with
idiopathic recurrent miscarriage. Molecular Human
Reproduction, 8, 95–100. doi: 10.1093/molehr/8.1.95.
Hyde, K.J., & Schust, D.J. (2015). Genetic considerations in
recurrent pregnancy loss. Cold Spring Harbour Perspectives
in Medicine, 5, a023119. doi: 10.1101/cshperspect.a023119.
Jauniaux, E., Farquharson, R., Christiansen, O., & Exalto, N.
(2006). Evidence-based guidelines for the investigation
and medical treatment of recurrent miscarriage. Human
Reproduction, 22, 2216–2222. doi: 10.1093/humrep/del150.
Jeon, Y.J., Kim, J.H., Lee, B.E., Rah, H.C., Shin, J.E., Kang, H., …
Kim, N.K. (2013). Association between polymorphisms in the
renin-angiotensin system genes and prevalence of spontaneously aborted fetuses. American Journal of Reproductive
Immunology, 70, 238–245. doi: 10.1111/aji.12110.
Johren, O., Dendorfer, A., & Dominiak, P. (2004).
Cardiovascular and renal function of angiotensin II type-2
receptors. Cardiovascular Research, 62, 460–467. doi: 10.
1016/j.cardiores.2004.01.011.
Khatami, M., Heidari, M., Hadadzadeh, M., Schiber-Mojdehkar,
B., Bitaraf Sani, M., & Houshmand, M. (2017). Simultaneous
genotyping of the Rs4762 and Rs699 Polymor-phisms in
angiotensinogen gene and correlation with Iranian CAD
Patients with Novel Hexa-primer ARMS-PCR. Iranian
Journal of Public Health, 46, 811–819. Retrieved from:
http://ijph.tums.ac.ir/index.php/ijph/article/view/10085
Kolte, A.M., Nielsen, H.S., Moltke, I., Degn, B., Pedersen, B.,
Sunde, L., Nielsen, F.C., & Christiansen, O.B. (2011). A genome-wide scan in affected sibling pairs with idiopathic
recurrent miscarriage suggests genetic linkage. MHR: Basic
Science of Reproductive Medicine, 17, 379–385. doi: 10.
1093/molehr/gar003.
Kusmierska-Urban, K., Rytlewski, K., & Reron, A. (2013).
w układu renina-angiotensyna
Wybrane polimorfizmy geno
w patogenezie nadcisnienia w przebiegu cia˛_zy [Selected
polymorphisms of Renin-Angiotensin System in the pathology of hypertensive disorders of pregnancy]. Ginekologia
Polska, 84, 214–218. Retrieved from: http://68.indexcopernicus.com/abstracted.php?level ¼ 5&ICID ¼ 1043523
Lv, L.L., & Liu, B.C. (2015). Role of non-classical renin-angiotensin system axis in renal fibrosis. Frontiers in Physiology,
6, 117. doi: 10.3389/fphys.2015.00117.
Mignini, L.E., Villar, J., & Khan, K.S. (2006). Mapping the theories
of preeclampsia: The need for systematic reviews of mechanisms of the disease. American Journal of Obstetrics and
Gynecology, 194, 317–321. doi: 10.1016/j.ajog.2005.08.065.
7
Paul, M., Mehr, A.P., & Kreutz, R. (2006). Physiology of local
renin-angiotensin systems. Physiological Reviews, 86,
747–803. doi: 10.1152/physrev.00036.2005.
Practice Committee of American Society for Reproductive
Medicine. (2012). Multiple gestation associated with infertility therapy: An American Society for Reproductive
Medicine Practice Committee opinion. Fertility and Sterility,
97, 825–834. doi: 10.1016/j.fertnstert.2011.11.048.
Rai, R., & Regan, L. (2006). Recurrent miscarriage. Lancet (London,
England), 368, 601–611. doi: 10.1016/S0140-6736(06)69204-0.
Rigat, B., Hubert, C., Alhenc-Gelas, F., Cambien, F., Corvol, P., &
Soubrier, F. (1990). An insertion/deletion polymorphism in
the angiotensin I-converting enzyme gene accounting for
half the variance of serum enzyme levels. Journal of Clinical
Investigation, 86, 1343–1346. doi: 10.1172/JCI114844.
Rull, K., Nagirnaja, L., & Laan, M. (2012). Genetics of recurrent
miscarriage: Challenges, current knowledge, future directions.
Frontiers in Genetics, 3, 34. doi: 10.3389/fgene.2012.00034.
Su, M.-T., Lin, S.-H., & Chen, Y.-C. (2011). Genetic association
studies of angiogenesis- and vasoconstriction- related genes
in women with recurrentpregnancy loss: A systematic review
and meta-analysis. Human Reproduction Update, 17, 803–812.
doi: 10.1093/humupd/dmr027.
Vaiman, D. (2015). Genetic regulation of recurrent spontaneous abortion in humans. Biomedical Journal, 38, 11–24.
doi: 10.4103/2319-4170.133777.
Vettriselvi, V., Vijayalakshmi, K., Paul, S.F., & Venkatachalam,
P. (2008). ACE and MTHFR gene polymorphisms in unexplained recurrent pregnancy loss. Journal of Obstetrics and
Gynaecology Research, 34, 301–306. doi: 10.1111/j.14470756.2008.00792.x.
Vinson, G., Barker, S., & Puddefoot, J. (2012). The reninangiotensin system in the breast and breast cancer.
Endocrine Related Cancer, 19, R1–19. doi: 10.1530/ERC-110335.
Wang, Z., Wang, P., Wang, X., He, X., Wang, Z., Xu, D., Hu, J.,
& Wang, B. (2013). Significant association between angiotensin-converting enzyme gene insertion/deletion polymorphism and risk of recurrent miscarriage: A systematic
review and meta-analysis. Metabolism, 62, 1227–1238. doi:
10.1016/j.metabol.2013.03.003.
Wegman-Ostrosky, T., Soto-Reyes, E., Vidal-Millan, S., &
Sanchez-Corona, J. (2015). The renin-angiotensin system
meets the hallmarks of cancer. Journal of the ReninAngiotensin-Aldosterone System, 16, 227–233. doi: 10.1177/
1470320313496858.
Xi, B., Zeng, T., Liu, L., Liang, Y., Liu, W., Hu, Y., & Li, J. (2011).
Association between polymorphisms of the reninangiotensin system genes and breast cancer risk:
A meta-analysis. Breast Cancer Research and Treatment,
130, 561–568. doi: 10.1007/s10549-011-1602-3.
Yang, C., Fangfang, W., Jie, L., Yanlong, Y., Jie, W., Xuefei, L.,
Xuerong, Z., & Yanling, H. (2012). Angiotensin-converting
enzyme insertion/deletion (I/D) polymorphisms and recurrent pregnancy loss: a meta-analysis. Journal of Assisted
Reproduction and Genetics, 29, 1167–1173. doi: 10.1007/
s10815-012-9870-3.
Zhang, K., Zhou, B., & Zhang, L. (2013). Association study of
angiotensin II type 1 receptor: A1166C (rs5186) polymorphism with coronary heart disease using systematic
meta-analysis. Journal of the Renin-Angiotensin-Aldosterone
System, 14, 181–188. doi: 10.1177/1470320312447652.
Документ
Категория
Без категории
Просмотров
3
Размер файла
924 Кб
Теги
2017, 1388545, 14647273
1/--страниц
Пожаловаться на содержимое документа