close

Вход

Забыли?

вход по аккаунту

?

acssynbio.7b00258

код для вставкиСкачать
Subscriber access provided by GRIFFITH UNIVERSITY
Technical Note
Construction and Characterization of Broadspectrum Promoters for Synthetic Biology
Sen Yang, Qingtao Liu, Yunfeng Zhang, Guocheng Du, Jian Chen, and Zhen Kang
ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.7b00258 • Publication Date (Web): 23 Oct 2017
Downloaded from http://pubs.acs.org on October 25, 2017
Just Accepted
“Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted
online prior to technical editing, formatting for publication and author proofing. The American Chemical
Society provides “Just Accepted” as a free service to the research community to expedite the
dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts
appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been
fully peer reviewed, but should not be considered the official version of record. They are accessible to all
readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered
to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published
in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just
Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor
changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers
and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors
or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
ACS Synthetic Biology is published by the American Chemical Society. 1155 Sixteenth
Street N.W., Washington, DC 20036
Published by American Chemical Society. Copyright © American Chemical Society.
However, no copyright claim is made to original U.S. Government works, or works
produced by employees of any Commonwealth realm Crown government in the course
of their duties.
Page 1 of 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
ACS Synthetic Biology
1
Construction
and
Characterization
of
2
Broad-spectrum Promoters for Synthetic Biology
3
Sen Yanga, Qingtao Liua, Yunfeng Zhanga, Guocheng Dua,b, Jian Chena,b*, Zhen
4
Kanga,b*
5
a
6
Biotechnology, Jiangnan University, Wuxi 214122, China
7
b
8
Wuxi, Jiangsu 214122, China
9
S Supporting Information
○
The Key Laboratory of Industrial Biotechnology, Ministry of Education, School of
Synergetic Innovation Center of Food Safety and Nutrition, Jiangnan University,
10
11
12
*
13
Zhen Kang, Phone: +86-510-85918307
14
Fax: +86-510-85918309, E-mail: zkang@jiangnan.edu.cn
15
Jian Chen, Phone: +86-510-85918307
16
Fax: +86-510-85918309, E-mail: jchen@jiangnan.edu.cn
Corresponding authors,
17
18
1
ACS Paragon Plus Environment
ACS Synthetic Biology
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
19
ABSTRACT: Characterization of genetic circuits and biosynthetic pathways in
20
different hosts always requires promoter substitution and redesigning. Here, a strong,
21
broad-spectrum promoter, Pbs, for Escherichia coli, Bacillus subtilis, and
22
Saccharomyces cerevisiae was constructed, and it was incorporated into the minimal
23
E. coli–B. subtilis–S. cerevisiae shuttle plasmid pEBS (5.8 kb). By applying a random
24
mutation strategy, three broad-spectrum promoters Pbs1, Pbs2, and Pbs3, with different
25
strengths were generated and characterized. These broad-spectrum promoters will
26
expand the synthetic biology toolbox for E. coli, B. subtilis, and S. cerevisiae.
27
28
KEYWORDS: Broad-spectrum promoter; Shuttle plasmid; Bacillus subtilis;
29
Saccharomyces cerevisiae; Escherichia coli
30
31
2
ACS Paragon Plus Environment
Page 2 of 17
Page 3 of 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
ACS Synthetic Biology
32
Promoters, which are the basic transcriptional regulatory elements, have been used
33
widely for gene expression and pathway engineering.1,
34
occurring promoters, especially for model organisms such as Escherichia coli,3,
35
Bacillus subtilis,5 and Saccharomyces cerevisiae,6 have been identified and
36
characterized. The structure of natural prokaryotic promoter motifs is well
37
understood.7 Thus, many random,8 semi-rational,9 and rational10 approaches have
38
been developed to engineer prokaryotic promoters in the past decades. As a result,
39
numerous constitutive or inducible promoters with desirable properties have been
40
constructed and applied for enzyme expression, metabolic engineering, and synthetic
41
biology.11-13 In contrast, because of their comparatively more complex structure, only
42
a few promoter-engineering studies of yeast and mammalian cells have been reported
43
in the past decade.14 To realize gene expression across a full continuum of possible
44
expression levels, Nevoigt et al.
45
from 8% to 120% of the wild-type TEF1 promoter. By applying a synthetic
46
hybrid-promoter approach, Blazeck et al.
47
metabolic engineering and synthetic biology in S. cerevisiae. After analyzing the
48
promoter architecture and applying the Gibson DNA assembly method, a promoter
49
library with 128 members variants of the PHO5 promoter was generated rapidly by
50
modifying both Pho4 binding sites of the PHO5 promoter.17 To facilitate operational
51
processes and minimize unexpected background interactions, lists of short, synthetic
52
core promoters with different activities have been provided for S. cerevisiae,18, 19
53
Pichia pastoris,20, 21 Yarrowia lipolytica,22, 23 and mammalian cells.24 More recently,
54
by applying a computational, multifactor design approach, Portela et al. successfully
55
generated universal core promoters for different yeast species.22
15
2
To date, many naturally
4
constructed 11 promoters whose activities ranged
16
created strong promoter libraries for
3
ACS Paragon Plus Environment
ACS Synthetic Biology
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
56
With the rapid development of synthetic biology, many novel enzyme-encoding
57
genes25, genetic circuits,26 and biosynthetic pathways27 that were designed for a
58
specific organism should require comparative investigations in conventional model
59
microorganisms, for instance, E. coli, B. subtilis, and S. cerevisiae. Additionally,
60
identification and characterization of natural unknown DNA fragments or gene
61
clusters in different contexts and hosts is required frequently.28 However, in most
62
cases, many existing promoters are incompatible in different species.29 As a result, the
63
gene clusters or biosynthetic pathways have to be reconstructed with specific
64
promoters and plasmids in different hosts, which results in a tedious construction
65
process. Consequently, the development of a broad-spectrum promoter library
66
comprising promoters of varying strengths is attractive and meaningful. In the present
67
study, our aim was to construct broad-spectrum promoters and a small shuttle plasmid
68
for E. coli (a Gram-negative bacterium), B. subtilis (a Gram-positive bacterium), and
69
S. cerevisiae (a eukaryote).
70
RESULTS
71
Design and Characterization of the Broad-spectrum Promoter Pbs. In E. coli and B.
72
subtilis, the sequences of the conserved −35 box and −10 box that are recognized by
73
the housekeeping σ70 and σ43 factors are identical, and their sequences are
74
5′–TTGACA–3′ and 5′–TATAAT–3′, respectively.7 Thus, to obtain an ideal
75
broad-spectrum promoter, the core regions of constitutive promoters from E. coli, B.
76
subtilis, and S. cerevisiae were combined. Here, a strong S. cerevisiae synthetic
77
minimal promoter, Pmin, comprising comprehensive promoter elements,18 was chosen
78
as a platform because it contains a 5′–TTGAAA–3′ sequence in its upstream
79
activating sequence (UAS) region, as well as a 5′–TTAAT–3′ sequence in its AT-rich
4
ACS Paragon Plus Environment
Page 4 of 17
Page 5 of 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
ACS Synthetic Biology
80
region. Thus, the 5′–TTGAAA–3′ sequence in the Pmin UAS region and the
81
5′–TTAAT–3′ sequence in the AT-rich region were modified to 5′–TTGACA–3′ and
82
5′–TATAAT–3′, respectively. In consideration of an ideal 17-bp interval between the
83
−35 box and −10 box, an adenine and a thymine in the UAS2 region were removed.
84
Moreover, a guanine downstream of the 5′–TATAAT–3′ sequence was substituted with
85
an adenine to improve transcriptional initiation (Figure 1A). In addition, a universal
86
ribosome-binding site sequence, 5′–AGGAGGAAAAA–3′, which is supposed to be
87
effective in both E. coli and B. subtilis, was designed (RBS Calculator 2.0
88
(www.denovodna.com) 30, 31 and added downstream of the modified promoter Pbs.
89
To investigate promoter activity, the green fluorescent protein (GFP) was used as
90
a reporter. Clearly, GFP was expressed successfully in E. coli, B. subtilis, and S.
91
cerevisiae using Pbs (Figure 1B). In contrast, the initial promoter Pmin failed to express
92
GFP in E. coli (data not shown). On this basis, the activity of Pbs was evaluated
93
quantitatively
94
(http://parts.igem.org/ Part:BBa_J23119) (E. coli), Pcdd (B. subtilis), and PGPD (S.
95
cerevisiae). In E. coli, Pbs was much stronger than PJ23119 (Supplementary Figure S1A),
96
while the strength of Pbs was approximately 75% of that of Pcdd in B. subtilis
97
(Supplementary Figure S1B). In S. cerevisiae, Pbs exhibited a similar activity
98
compared to Pmin, while its activity was lower than that of the strong promoter PGPD
99
(Supplementary Figure S1C). Taken together, these results indicate that Pbs (113 bp)
100
should be classified as a strong constitutive promoter in E. coli, B. subtilis, and S.
101
cerevisiae. In bacteria, a long 5′-untranslated region (UTR) might alter the translation
102
rate of target genes.30 Thus, the 70-bp 5′-UTR transcribed by Pbs could be cleaved by
103
introducing ribozyme32 or RNase E sites33 when necessary.
and
compared
with
that
of
the
strong
5
ACS Paragon Plus Environment
promoters
PJ23119
ACS Synthetic Biology
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
104
Construction of Shuttle Vectors with the Broad-Spectrum Promoter. In most
105
cases, shuttle plasmids for two hosts harbor at least two screening markers with
106
respective promoters. The large size of such plasmids not only results in difficulties
107
during subcloning, it also increases the metabolic burden on host cells . Thus, based
108
on the construction of the broad-spectrum promoter Pbs, the shuttle plasmids pEB (4.0
109
kb, E. coli and B. subtilis) (Supplementary Figure S2A), pES (4.2 kb, E. coli and S.
110
cerevisiae) (Supplementary Figure S2B), and pEBS (5.8 kb, E. coli, B. subtilis, and S.
111
cerevisiae) (Supplementary Figure S2C) were developed, in which the expression of
112
the geneticin resistance gene kanR was driven by Pbs. In detail, kanamycin was used
113
for plasmid selection in E. coli and B. subtilis, while geneticin was used for S.
114
cerevisiae. To confirm the successful transformation and replication of the constructed
115
plasmid pEBS in the three hosts, a Pbs-gfp expression cassette was constructed and
116
inserted into pEBS to generate pEBS-Pbs-gfp (Supplementary Figure S2D). In
117
consideration of the potential for homologous recombination, the kanR gene was
118
placed between the two Pbs promoters. Thus, kanR would be removed after
119
homologous recombination, guaranteeing the suppression of recombinant strains that
120
contain mutated plasmids. As expected, obvious fluorescence was observed (Figure
121
2B), demonstrating the successful replication of the shuttle plasmid pEBS in E. coli, B.
122
subtilis, and S. cerevisiae. Compared with the frequently used plasmids pP43NMK
123
and pY26TEF-GPD (6.7 kb and 7.4 kb, respectively), the smaller sizes of pEB, pES,
124
and pEBS should benefit subcloning and transformation procedures.
125
Construction of Broad-spectrum Promoters with Different Strengths. Precise
126
regulation and optimization of genetic circuits or biosynthetic pathways is always
127
required for synthetic biology. Thus, the development of broad-spectrum promoters
128
with different strengths is meaningful and attractive. Here, based on the construction
6
ACS Paragon Plus Environment
Page 6 of 17
Page 7 of 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
ACS Synthetic Biology
129
of the strong promoter Pbs in E. coli, B. subtilis, and S. cerevisiae, and its
130
corresponding vector pEBS, the broad-spectrum promoter Pbs was engineered using a
131
random mutation strategy. As shown in Figure 2A, the partial UAS1 and UAS2
132
fragments CCTCC and CTGAATT, respectively, that are close to the −35 box, as well
133
as the partial AT-rich region TAACTTAATATT that is close to the −10 box, was
134
randomly mutated to construct the library. After constructing a mutant library and
135
analyzing GFP fluorescence, three new broad-spectrum promoters, Pbs1, Pbs2, and Pbs3,
136
with different activities were constructed and analyzed by flow cytometry.
137
Specifically, the activity of Pbs in E. coli, B. subtilis, and S. cerevisiae was set as 1. As
138
shown in Figure 2B, the activities of Pbs1, Pbs2, and Pbs3 were 12.0%, 29.8%, and
139
55.7% that of Pbs in E. coli, respectively; 8.3%, 17.2%, and 48.6% that of Pbs in B.
140
subtilis, respectively; and 11.4%, 22.5%, and 44.3% that of Pbs in S. cerevisiae,
141
respectively. In parallel, a quantitative real-time polymerase chain reaction (qRT-PCR)
142
was also performed to directly investigate the transcriptional strength of Pbs1, Pbs2, Pbs3,
143
and Pbs in E. coli, B. subtilis, and S. cerevisiae. As shown in Figures 2C, 2D, and 2E,
144
the activities of Pbs1, Pbs2, and Pbs3 were 5.5%, 12.8%, and 34.4% that of Pbs in E. coli,
145
respectively; 5.8%, 18.7%, and 36.4% that of Pbs in B. subtilis, respectively; and
146
10.5%, 19.8%, and 41.3% that of Pbs in S. cerevisiae, respectively. The results
147
confirmed that the activities of the shuttle promoters are in the order of Pbs1 < Pbs2 <
148
Pbs3 < Pbs in E. coli, B. subtilis, and S. cerevisiae. Therefore, these broad-spectrum
149
promoters could be used for optimizing genetic circuits or biosynthetic pathways in
150
different hosts, which can simplify or shorten the operational process.
151
Conclusions. A small E. coli–B. subtilis–S. cerevisiae shuttle plasmid was constructed,
152
in which the expression of the sole selection marker, a kanamycin resistance gene,
153
was driven by the broad-spectrum promoter Pbs. After random mutation and screening,
7
ACS Paragon Plus Environment
ACS Synthetic Biology
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
154
three new broad-spectrum promoters, Pbs1, Pbs2, and Pbs3, were constructed, and their
155
activities, which were in the order of Pbs1 < Pbs2 < Pbs3 < Pbs in E. coli, B. subtilis, and
156
S. cerevisiae, were characterized. These broad-spectrum promoters will expand the
157
synthetic biology toolbox for E. coli, B. subtilis, and S. cerevisiae.
158
ASSOCIATED CONTENT
159
S Supporting Information
○
160
Supplementary data including Materials and Methods, Supplementary tables, and Supplementary
161
figures associated with this article can be referenced in the supplementary materials. This material
162
is available free of charge via the Internet at http://pubs.acs.org.
163
■ AUTHOR INFORMATION
164
Corresponding Authors
165
Zhen Kang, *E-mail: zkang@jiangnan.edu.cn.
166
Jian Chen, *E-mail: jchen@jiangnan.edu.cn
167
Author Contributions
168
Z.K. designed the research. S.Y., Q.T.L. and Y.F.Z. performed the experiments. Z.K.,
169
S.Y., G.C.D. and J.C. analyzed the data and wrote the manuscript.
170
Notes
171
The authors declare no competing financial interest.
172
ACKNOWLEDGEMENTS
173
This work was financially supported by the National Natural Science Foundation of
174
China (31670092), the Fundamental Research Funds for the Central Universities
175
(JUSRP51707A), and the Program for Changjiang Scholars and Innovative Research
176
Team in University (grant No. IRT_15R26), and the 111 Project.
8
ACS Paragon Plus Environment
Page 8 of 17
Page 9 of 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
ACS Synthetic Biology
177
Figure legends
178
Figure 1. Design and verification of the broad-spectrum promoter Pbs. (A) Schematic
179
representation of the design of the broad-spectrum promoter Pbs based on the minimal
180
yeast promoter Pmin. The 5′–TTGAAA–3′ sequence in the Pmin UAS region and the
181
5′–TTAAT–3′ sequence in the AT-rich region were modified to 5′–TTGACA–3′ (−35
182
box, underlined) and 5′–TATAAT–3′ (−10 box, underlined), respectively. An adenine
183
and a thymine (indicated with dots) in the UAS2 region were removed to shorten the
184
distance between the −35 box and −10 box to 17 bp. A guanine downstream of the
185
5′–TATAAT–3′ sequence was substituted with an adenine (underlined) to improve
186
transcriptional initiation. In addition, a universal ribosome-binding site sequence,
187
5′–AGGAGGAAAAA–3′ (underlined), was added downstream of the modified
188
promoter Pbs. Various elements of yeast promoters and their corresponding sequences
189
are drawn in the same colors. (B) Evaluation of the broad-spectrum promoter Pbs in E.
190
coli, B. subtilis, and S. cerevisiae. The Pbs-gfp expression cassette was inserted into an
191
E. coli–S. cerevisiae shuttle plasmid and a B. subtilis plasmid to generate
192
pY26-Pbs-gfp and pUCP-Pbs-gfp, respectively. Fluorescent microscopy images of E.
193
coli, B. subtilis, and S. cerevisiae harboring the corresponding GFP expression
194
plasmids are shown.
195
Figure 2. Design and evaluation of broad-spectrum promoters with different strengths.
196
(A) Sequences of broad-spectrum promoters with different strengths. Broad-spectrum
197
promoters were designed to contain three conserved regions (the −35 box
198
[5′–TTGACA–3′], UAS3 [5′–TAGCATGTGA–3′], and the −10 box [5′–TATAAT–3′]),
199
which are shown in red, and 24 random mutation sites (N5, N7, and W3NW8), which
200
are shown in black. The upstream and downstream sequences of the modified region
201
are shown in green. (B) Single-cell analysis of E. coli, B. subtilis, and S. cerevisiae
9
ACS Paragon Plus Environment
ACS Synthetic Biology
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
Page 10 of 17
202
strains harboring pEBS-Pbsx-gfp. Cells were collected at the mid-exponential phase (6
203
h of growth for E. coli and B. subtilis and 8 h of growth for S. cerevisiae), washed
204
twice in phosphate-buffered saline, and diluted 1:100 with 0.01 M phosphate-buffered
205
saline. For each assay, 120,000 cells were recovered. Relative gfp mRNA levels in E.
206
coli (C), B. subtilis (D), and S. cerevisiae (E) strains harboring pEBS-Pbsx-gfp. The gfp
207
mRNA levels transcribed by Pbs in E. coli, B. subtilis, and S. cerevisiae were set as 1.
208
Data are presented as the mean ± standard deviation (n = 3).
209
210
211
References
1.
Paddon, C. J., and Keasling, J. D. (2014) Semi-synthetic artemisinin: a model
212
for the use of synthetic biology in pharmaceutical development. Nat Rev
213
Microbiol 12, 355-367.
214
2.
Gupta, A., Reizman, I. M., Reisch, C. R., and Prather, K. L. (2017) Dynamic
215
regulation
216
pathway-independent quorum-sensing circuit. Nat Biotechnol 35, 273-279.
217
3.
of
metabolic
flux
in
engineered
bacteria
using
a
Lara, A. R., Jaen, K. E., Sigala, J. C., Muhlmann, M., Regestein, L., and Buchs,
218
J. (2017) Characterization of endogenous and reduced promoters for
219
oxygen-limited processes using Escherichia coli. ACS Synth Biol 6, 344–356.
220
4.
Zhou, S., Ding, R., Chen, J., Du, G., Li, H., and Zhou, J. (2017) Obtaining a
221
panel of cascade promoter-5'-UTR complexes in Escherichia coli. ACS Synth
222
Biol 6, 1065-1075.
223
5.
Yang, S., Du, G., Chen, J., and Kang, Z. (2017) Characterization and
224
application of endogenous phase-dependent promoters in Bacillus subtilis.
225
Appl Microbiol Biotechnol 101, 4151-4161.
226
6.
Partow, S., Siewers, V., Bjorn, S., Nielsen, J., and Maury, J. (2010)
10
ACS Paragon Plus Environment
Page 11 of 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
ACS Synthetic Biology
227
Characterization of different promoters for designing a new expression vector
228
in Saccharomyces cerevisiae. Yeast 27, 955-964.
229
7.
bacterial sigma factors. Annu Rev Biochem 57, 839-872.
230
231
8.
Hammer, K., Mijakovic, I., and Jensen, P. R. (2006) Synthetic promoter
libraries--tuning of gene expression. Trends Biotechnol 24, 53-55.
232
233
Helmann, J. D., and Chamberlin, M. J. (1988) Structure and function of
9.
Jin, P., Kang, Z., Zhang, J., Zhang, L., Du, G., and Chen, J. (2016)
234
Combinatorial Evolution of Enzymes and Synthetic Pathways Using One-Step
235
PCR. ACS synthetic biology 5, 259-268.
236
10.
Zong, Y., Zhang, H. M., Lyu, C., Ji, X., Hou, J., Guo, X., Ouyang, Q., and Lou,
237
C. (2017) Insulated transcriptional elements enable precise design of genetic
238
circuits. Nat Commun 8.
239
11.
Jin, P., Kang, Z., Yuan, P., Du, G., and Chen, J. (2016) Production of
240
specific-molecular-weight hyaluronan by metabolically engineered Bacillus
241
subtilis 168. Metab Eng 35, 21-30.
242
12.
Kamiya, Y., Takagi, T., Ooi, H., Ito, H., Liang, X., and Asanuma, H. (2015)
243
Synthetic gene involving azobenzene-tethered T7 promoter for the
244
photocontrol of gene expression by visible light. ACS Synth Biol 4, 365-370.
245
13.
Phelan, R. M., Sachs, D., Petkiewicz, S. J., Barajas, J. F., Blake-Hedges, J. M.,
246
Thompson, M. G., Reider Apel, A., Rasor, B. J., Katz, L., and Keasling, J. D.
247
(2017) Development of next generation synthetic biology tools for use in
248
Streptomyces venezuelae. ACS Synth Biol 6, 159-166.
249
14.
Mehrotra, R., Renganaath, K., Kanodia, H., Loake, G. J., and Mehrotra, S.
250
(2017) Towards combinatorial transcriptional engineering. Biotechnol Adv 35,
251
390-405.
11
ACS Paragon Plus Environment
ACS Synthetic Biology
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
252
15.
Nevoigt, E., Kohnke, J., Fischer, C. R., Alper, H., Stahl, U., and
253
Stephanopoulos, G. (2006) Engineering of promoter replacement cassettes for
254
fine-tuning of gene expression in Saccharomyces cerevisiae. Appl Environ
255
Microb 72, 5266-5273.
256
16.
Blazeck, J., Garg, R., Reed, B., and Alper, H. S. (2012) Controlling promoter
257
strength and regulation in Saccharomyces cerevisiae using synthetic hybrid
258
promoters. Biotechnol Bioeng 109, 2884-2895.
259
17.
eukaryotic promoter libraries. ACS Synth Biol 1, 483-490.
260
261
18.
Redden, H., and Alper, H. S. (2015) The development and characterization of
synthetic minimal yeast promoters. Nat Commun 6, 7810.
262
263
Rajkumar, A. S., and Maerkl, S. J. (2012) Rapid synthesis of defined
19.
Ede, C., Chen, X., Lin, M.-Y., and Chen, Y. Y. (2016) Quantitative analyses of
264
core promoters enable precise engineering of regulated gene expression in
265
mammalian cells. ACS Synth Biol 5, 395-404.
266
20.
core promoters for Pichia pastoris. ACS Synth Biol 3, 188-191.
267
268
Vogl, T., Ruth, C., Pitzer, J., Kickenweiz, T., and Glieder, A. (2014) Synthetic
21.
Portela, R. M., Vogl, T., Kniely, C., Fischer, J. E., Oliveira, R., and Glieder, A.
269
(2017) Synthetic core promoters as universal parts for fine-tuning expression
270
in different yeast species. ACS Synth Biol 6, 471-484.
271
22.
Wagner, J. M., and Alper, H. S. (2016) Synthetic biology and molecular
272
genetics in non-conventional yeasts: current tools and future advances. Fungal
273
Genet Biol 89, 126-136.
274
23.
Shabbir Hussain, M., Gambill, L., Smith, S., and Blenner, M. A. (2016)
275
Engineering promoter architecture in oleaginous yeast Yarrowia lipolytica.
276
ACS Synth Biol 5, 213-223.
12
ACS Paragon Plus Environment
Page 12 of 17
Page 13 of 17
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
ACS Synthetic Biology
277
24.
synthetic promoters for a mammalian system. ACS Synth Biol 5, 1455-1465.
278
279
Cheng, J. K., and Alper, H. S. (2016) Transcriptomics-guided design of
25.
Chen, W., Yu, H., and Ye, L. (2016) Comparative study on different expression
280
hosts for alkaline phytase engineered in Escherichia coli. Appl Biochem
281
Biotechnol 179, 997-1010.
282
26.
engineering cross-species genetic circuits and pathways. Nat Commun 6, 7832.
283
284
Kushwaha, M., and Salis, H. M. (2015) A portable expression resource for
27.
Gupta, A., Hicks, M. A., Manchester, S. P., and Prather, K. L. (2016) Porting
285
the synthetic D-glucaric acid pathway from Escherichia coli to Saccharomyces
286
cerevisiae. Biotechnol J 11, 1201-1208.
287
28.
Troeschel, S. C., Drepper, T., Leggewie, C., Streit, W. R., and Jaeger, K. E.
288
(2010) Novel tools for the functional expression of metagenomic DNA.
289
Methods Mol Biol 668, 117.
290
29.
Jopcik, M., Bauer, M., Moravcikova, J., Boszoradova, E., Matusikova, I., and
291
Libantova, J. (2013) Plant tissue-specific promoters can drive gene expression
292
in Escherichia coli. Plant Cell Tiss Org 113, 387-396.
293
30.
Espah Borujeni, A., Channarasappa, A. S., and Salis, H. M. (2014) Translation
294
rate is controlled by coupled trade-offs between site accessibility, selective
295
RNA unfolding and sliding at upstream standby sites. Nucleic Acids Res 42,
296
2646-2659.
297
31.
control protein expression. Nat Biotechnol 27, 946-950.
298
299
Salis, H. M. (2009) Automated design of synthetic ribosome binding sites to
32.
Lou, C., Stanton, B., Chen, Y. J., Munsky, B., and Voigt, C. A. (2012)
300
Ribozyme-based insulator parts buffer synthetic circuits from genetic context.
301
Nat Biotechnol 30, 1137-1142.
13
ACS Paragon Plus Environment
ACS Synthetic Biology
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
302
33.
Pfleger, B. F., Pitera, D. J., Smolke, C. D., and Keasling, J. D. (2006)
303
Combinatorial engineering of intergenic regions in operons tunes expression
304
of multiple genes. Nat Biotechnol 24, 1027-1032.
305
14
ACS Paragon Plus Environment
Page 14 of 17
Page 15 of 17
ACS Synthetic Biology
Pbs 1
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
To
gfp
P
TTEF bsx
Escherichia coli
TADH1
kanR
Pbs
pEBS-Pbsx-gfp
repU
Bacillus subtilis
PMB1 ori
2 micron ori
Saccharomyces cerevisiae
ACS Paragon Plus Environment
Pbs 2
Pbs 3
Pbs
ACS Synthetic Biology
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
A
Page 16 of 17
B
UAS2
UAS1
AT-rich
UAS3
TATA
N30
TSS
Gene
Pmin
Pbs
TCYC1
gfp
Pbs
TADH1
gfp
T ADH1
URA3
repE
pUCP-Pbs-gfp
UAS1
-10
UAS2
UAS3
TSS
AT-rich
ampR
N30
TSS
ampR
E. coli
Gene
URA3
ampR
RBS
TATA
pY26-Pbs-gfp
repB
2 micron ori
-35
TADH1
PMB1 ori
pY26-Pbs-gfp
TATAAAAG AGCACTGTTGGGCGTGAGTGGAGGCGCCGG AAAAAAGCATCGAAAAAA-3′
TCYC1
kanR
PMB1 ori
5′-CCTCCTTGAA ACTGAAATTT TAGCATGTGA TTAATTAACTTGTAATATTCTACCCAAGCT
Pbs
gfp
Pbs
5′-CCTCCTTGAC ACTGAATT TAGCATGTGA TATAATTAACTTAATATTCTACCCAAGCT
TATAAAAG AGCACTGTTGGGCGTGAGTGGAGGCGCCGG AAAAAAGCATCGAAAAAA
GGAGGAAAAAAA-3′
ACS Paragon Plus Environment
2 micron ori
B. subtilis
S. cerevisiae
Page 17 of 17
A
B
Name
E. coli
Partial sequence (5′-3′)
Pbs1
Design GGCGCGCCNNNNNTTGACANNNNNNNTAGCATGTGATATAATWWWNWWWWWWWWCTACCCAAGCTT
Pbs1
Pbs2
GGCGCGCCCTAATTTGACAGTAGAATTAGCATGTGATATAATAAATAATTTTTACTACCCAAGCTT
Pbs3
Pbs2
GGCGCGCCGTAGATTGACACCCTCTGTAGCATGTGATATAATAAATTTTATATTCTACCCAAGCTT
Pbs
Pbs3
GGCGCGCCGTTAGTTGACACTTAGCCTAGCATGTGATATAATTATGTTATTTATCTACCCAAGCTT
Pbs
GGCGCGCCCCTCCTTGACACTGAATTTAGCATGTGATATAATTAACTTAATATTCTACCCAAGCTT
10
0
10
1
10
2
3
10
4
10
5
10
B. subtilis
Pbs1
Pbs2
1
C
D
Pbs3
E
B. subtilis
E. coli
Pbs
S. cerevisiae
10
0
10
1
10
2
3
10
4
10
5
10
S. cerevisiae
Pbs1
Pbs2
Pbs3
s
Pb
s2
s3
Pb
Pb
ACS Paragon Plus Environment
Pb
s1
s
Pb
s3
Pb
s2
Pb
s1
Pb
s
Pb
s3
Pb
s2
Pb
s1
Pbs
Pb
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
ACS Synthetic Biology
10
0
10
1
10
2
3
10
4
10
log fluorescence [a.u.]
5
10
Документ
Категория
Без категории
Просмотров
3
Размер файла
22 563 Кб
Теги
acssynbio, 7b00258
1/--страниц
Пожаловаться на содержимое документа