close

Вход

Забыли?

вход по аккаунту

?

ars.2017.7023

код для вставкиСкачать
Antioxidants and Redox Signaling
© Mary Ann Liebert, Inc.
DOI: 10.1089/ars.2017.7023
1
Forum Original Research Communication
Effects of ferroportin-mediated iron depletion in cells
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 1 of 158
representative of different histological subtypes of prostate cancer
Abbreviated title: Ferroportin-mediated iron depletion in prostate cancer
Zhiyong Deng1, David H. Manz1,2, Suzy V. Torti1*, Frank M. Torti3
1
Department of Molecular Biology and Biophysics, 2School of Dental Medicine and
3
Department of Medicine, UCONN Health, Farmington, Connecticut 06032
*To whom correspondence should be addressed:
Phone: 860-679-6503
Fax:
860-679-1255
storti@uchc.edu
Keywords: Prostate Cancer, Iron, Ferroportin, Cell Cycle, Autophagy, Chelator
Word Count: 6710
Reference Number: 79
Number of Total Images: 11
Number of Color Images: 6 (1 hardcopy and online [Figure 8], 5 online only (Figures 3, 4, 5,
9, and 11)
2
Abstract
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 2 of 158
Aims: Ferroportin (FPN) is an iron exporter that plays an important role in cellular and
systemic iron metabolism. Our previous work has demonstrated that ferroportin is
decreased in prostate tumors. We sought to identify molecular pathways regulated by
ferroportin in prostate cancer cells.
Results: We show that overexpression of FPN induces profound effects in cells
representative of multiple histological subtypes of prostate cancer by activating different
but converging pathways. Induction of FPN induces autophagy and activates the
transcription factors p53 and KLF6 and their common downstream target, p21. FPN also
induces cell cycle arrest and stress-induced DNA-damage genes. Effects of FPN are
attributable to its effects on intracellular iron and can be reproduced with iron chelators.
Importantly, expression of FPN not only inhibits proliferation of all prostate cancer cells
studied, but also reduces growth of tumors derived from castrate-resistant
adenocarcinoma C4-2 cells in vivo.
Innovation: We use a novel model of FPN expression to interrogate molecular pathways
triggered by iron depletion in prostate cancer cells. Since prostate cancer encompasses
different subtypes with highly variable clinical course, we further explore how
histopathological subtype influences the response to iron depletion. We demonstrate that
prostate cancer cells that derive from different histopathological subtypes activate
converging pathways in response to FPN-mediated iron depletion. Activation of these
pathways is sufficient to significantly reduce the growth of treatment-refractory C4-2
prostate tumors in vivo.
Conclusions: Our results may explain why FPN is dramatically suppressed in cancer cells,
and suggest that FPN agonists may be beneficial in treatment of prostate cancer.
3
Introduction
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 3 of 158
Ferroportin is a cellular iron efflux pump that is critical to maintenance of systemic iron
homeostasis (23,75). When expressed on the apical surface of enterocytes, ferroportin
mediates efflux of dietary iron into the circulation. Ferroportin is also expressed on the
surface of macrophages and hepatocytes, where it participates in recycling of iron from
cellular stores and senescent red blood cells. Since ferroportin is the only known protein
with an iron export function in vertebrates, loss of its activity is not compensated for by
functionally redundant proteins. Germline FPN mutations result in the iron overload
disease hemochromatosis (52,66).
Apart from its expression in tissues that regulate systemic iron balance, ferroportin is also
expressed in peripheral tissues and is markedly reduced in a number of tumors (70). Our
laboratory and others have reported that ferroportin is decreased in prostate cancer
transcriptionally, posttranscriptionally by hepcidin, a negative regulator of ferroportin (69),
and epigenetically through methylation of CpG islands in the prostate promoter (69,77).
Induction of hepcidin, a negative regulator of FPN, also contributes to the decrease in
ferroportin in prostate cancer. The consequence of decreased ferroportin is increased
retention of labile iron in tumors, which facilitates tumor growth (70).
Prostate cancer is the most common malignancy and the second most frequent cause of
cancer death in men (64). The vast majority of prostate cancers are adenocarcinomas, with
varying degrees of luminal organization, glandular formation and expression of the
androgen receptor (AR) (11,13). Targeting of the AR is a successful therapy for prostatic
adenocarcinoma; however, most patients become resistant to such therapies (castrateresistant disease), which leads to disease progression (35). A smaller fraction of prostatic
epithelial malignancies are of other histological types, including small cell
(neuroendocrine) carcinoma (SCNC), which occurs in approximately 0.5-2 % of men with
prostate cancer (28). SCNC do not express AR, are clinically more aggressive than
adenocarcinoma, and are treated with different therapeutic regimens (28).
Cell culture models of these various types of prostate cancer have been developed. LNCaP
cells, which express AR and prostate specific antigen (PSA), are among the most widely
4
used cell line to model androgen responsive prostate adenocarcinoma (65). Derivatives of
LNCaP cells that are androgen independent, such as C4-2 cells, have been created to
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 4 of 158
model castrate resistant adenocarcinoma (65). The PC3 cell line, historically used to model
aggressive castrate resistant adenocarcinoma, is now thought to derive from a
neuroendocrine subtype of prostate cancer (67).
Here, we use LNCaP, C4-2, and PC3 cells to probe the mechanisms by which modulation of
FPN expression affects prostate cancer. We show that enhanced iron efflux mediated by
overexpression of FPN is sufficient to trigger substantial iron depletion and induce
profound effects in prostate cancer cells by activating different but convergent pathways.
Results
FPN is a key regulator of iron metabolism in prostate cancer
FPN is a cell surface iron efflux pump that is expressed in a variety of tissues (23,75). It is
down-regulated in several tumor types, including prostate cancer (69,77). To determine
whether FPN affects iron homeostasis and whether its effects are similar in prostate
adeonocarcinoma and SCNC prostate cancer, we constructed a lentiviral vector carrying a
CMV promoter-driven FPN expression cassette. This virus was used to infect LNCaP
prostate adenocarcinoma and PC3 SCNC prostate cancer cells to generate cells with
overexpression of FPN (referred to as FPN OE cells) (Figure 1A, S1).
To determine the consequences of FPN expression on cellular iron metabolism, we
measured levels of iron regulatory protein 2 (IRP2) and its downstream targets transferrin
receptor 1 (TfR1) and ferritin (45). IRP2 is a master regulator of cellular iron that
posttranscriptionally controls levels of ferritin, an intracellular iron storage protein, and
transferrin receptor, the primary protein responsible for iron uptake (56). When levels of
intracellular iron are low, IRP activity increases, which represses ferritin and stabilizes
transferrin receptor, resulting in the accumulation of labile iron in cells and the restoration
of levels of intracellular iron.
5
Since FPN drives iron efflux, FPN overexpression should lower intracellular iron, resulting in
increased IRP2, increased TfR1, and decreased ferritin. Consistent with these predictions,
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 5 of 158
overexpression of FPN increased IRP2 (but not IRP1) in both LNCaP and PC3 cells (Figure
1A, S1). As anticipated, TfR1 and Ferritin H, downstream targets of IRP2, were increased
and reduced in the FPN overexpressing cells, respectively. To substantiate these findings,
we generated prostate cancer cells that conditionally expressed FPN driven by a
tetracycline-inducible promoter (hereafter referred to as (Tet-FPN)). Consistent with data
from FPN OE cells (Figure 1A, S1), LNCaP (Tet-FPN) cells exhibited increased IRP2 and TfR1
following Tet-mediated induction of FPN (Figure S2). To determine whether C4-2 cells, the
androgen-insensitive derivative of LNCaP cells, had a similar response to FPN, we
generated stable C4-2 (Tet-FPN) cells and examined IRP2, TfR1, and FTH. Similarly, FPN
induction increased IRP2 and TfR1 and reduced FTH in C4-2 (Tet-FPN) cells (Figure 1B, S1).
Next, we directly measured the intracellular labile iron pool (LIP) in control and FPNexpressing cells. Induction of FPN significantly reduced LIP levels in both LNCaP (Tet-FPN)
and PC3 (Tet-FPN) cells (Figure 1C). Collectively, these results indicate that overexpression
of FPN reduces intracellular iron in both adenocarcinoma and small cell (neuroendocrine)
carcinoma prostate cancer cells.
FPN induces autophagy in prostate cancer cells
Having determined that levels of ferroportin, an iron-specific efflux pump, could markedly
alter iron homeostasis in prostate cancer cells, we next sought to understand the
downstream consequences of iron depletion.
Autophagy is a physiological process that is upregulated by numerous stimuli, including
nutrient deprivation, and can function to preserve cell viability under unfavorable
environmental conditions (46). Increasing evidence indicates that autophagy contributes
to maintenance of iron balance by promoting the turnover of iron storage proteins (19,43).
Supporting this concept, iron chelators have been shown to induce autophagy in malignant
plasma cells and breast cancer cells (25,54). Whether upregulation of iron efflux is
sufficient to trigger autophagy, and whether histopathological subtypes of prostate cancer
cells differ in their response to enhanced iron efflux, is not known.
6
To test whether iron depletion induced by FPN triggered autophagy, we first examined the
effect of FPN on conversion of the microtubule-associated protein light chain 3 beta (LC3BAntioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 6 of 158
I), a marker of autophagosomes, to its phosphatidylethanolamine-conjugated form (LC3BII), a widely used indicator of autophagy (34,54). We found a substantive accumulation of
LC3B-II and a slight increase of LC3B-I in FPN overexpressing LNCaP cells (Figure 2A, S3),
consistent with an induction of autophagosome synthesis. LC3B-I and LC3B-II were likewise
upregulated in cells with tet-inducible FPN in the presence of doxycycline (Figure 2B, S3).
As a positive control, we treated cells with the iron chelator DFO, and observed a similar
effect on LC3B-I and LC3B-II in both LNCaP and PC3 cells (Figure 2C, S3).
To confirm that the increase in LC3B-I and LC3B-II reflected an increase in autophagy
(rather than a blockade in autophagosome degradation), we measured autophagic flux,
the fusion of autophagosomes with lysosomes and degradation of autophagic substrates,
using the mCherry-EGFP-LC3B reporter (33), which measures autophagic flux as the ratio
between mCherry and EGFP fluorescence (24,46). The reporter was introduced into tetinducible LNCaP FPN cells and fluorescence monitored before and after induction of FPN
expression with doxycycline. Ferroportin induction with doxycycline addition notably
increased the ratio of mCherry/EGFP in LNCaP cells (Figure 2D). FPN induction similarly
induced autophagy in C4-2 (Tet-FPN) cells as well as PC3 (Tet-FPN) cells (Figure 2E,F; S3).
Collectively, these data indicate that FPN-mediated iron depletion induces autophagy in
multiple prostate cancer cell types.
FPN inhibits prostate cancer cell proliferation through its effect on iron efflux
Another survival strategy that cells utilize at times of nutrient deprivation is to limit cellular
proliferation (9,26). We tested whether iron depletion affected cell proliferation in LNCaP,
PC3, and C4-2 cells. Vector and FPN-OE cells were seeded at the same density and cell
proliferation was evaluated by counting cells after 6-7 days. As illustrated in Figure 3A and
3B, FPN overexpression reduced cell number compared to vector control cells in both
LNCaP and PC3 cells. Similar results were observed using a tet-inducible system (Figure
3C). Doxycycline treatment did not affect control tet-inducible luciferase (Luc) cells (Figure
3D). We confirmed these results using an independent (WST-1) assay, which also
7
demonstrated an inhibition of proliferation by FPN in LNCaP cells (Figure 3E). Similarly,
FPN overexpression significantly reduced the proliferation of PC3 cells as measured by
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 7 of 158
both a clonogenic and metabolic (WST-1) assay (Figure 3F,G), as well as C4-2 cells (Figure
3H). We tested whether FPN-mediated growth arrest was permanent or transient by
measuring the rate of cell proliferation following doxycycline withdrawal in LNCaP (TetFPN) versus control cells. As shown in Figure 3I, doxycycline-treated LNCaP (Tet-FPN) cells
proliferated at a rate indistinguishable from control cells following doxycycline removal,
indicating that FPN-mediated proliferative arrest is transient.
We asked whether the iron efflux function of FPN was directly related to its observed
ability to inhibit proliferation. To accomplish this, we used FPN-A77D, a well-characterized
FPN mutant with impaired iron efflux function (40,62). The A77D mutation, present in the
predicted transmembrane domain 2 of FPN, results in mislocalization of FPN and reduced
display on the cell surface, and thus attenuates FPN’s iron transport function (40,62). To
confirm the preservation of this phenotype in LNCaP cells, we created the FPN A77D
mutant using site-directed mutagenesis, and generated stable LNCaP cell lines expressing
either constitutive or tet-inducible FPN (A77D) (Figure 4A,B; S4). We then used flow
cytometry to compare the level of cell surface FPN in cells expressing wildtype or mutant
FPN. Consistent with previous results (40), display of FPN (A77D) on the cell surface was
substantially reduced when compared to wildtype FPN (Figure 4C), despite higher overall
expression of the FPN mutant (Figure 4A,B; S4). We then tested the effect of the FPN A77D
mutant on proliferation by expressing both mutant and wildtype in LNCaP cells and
assessing effects on cell number. As shown in Figure 4D, FPN A77D was less effective in
reducing proliferation than wildtype. Thus, the ability of FPN to inhibit proliferation is
directly related to its iron efflux capacity, and does not represent off-target effects of this
protein.
FPN decreases prostate cancer cell proliferation by affecting cell cycle regulators
To determine the mechanism by which FPN affects prostate cancer cell proliferation, we
first used flow cytometry to ask whether expression of FPN affects a particular phase of
the cell cycle. As shown in Figure 5A and 5B, FPN expression increased the number of
8
LNCaP and C4-2 cells in G0/G1 but reduced the number in S phase. Consistent with the
ability of FPN to attenuate DNA replication, a pronounced decrease in the fraction of BrdU
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 8 of 158
positive cells was observed in a BrdU incorporation assay (Figure 5C). A similar trend of
decrease in S phase and increase in G1 phase was observed in PC3 cells, although the
magnitude of the effect was modest (Figure 5D). Collectively, these findings demonstrate
that FPN is a potent suppressor of proliferation that acts at least in part by inhibiting cell
cycle progression, most dramatically in LNCaP and C4-2 prostate adenocarcinoma cells.
We next evaluated the mechanisms responsible for FPN-mediated inhibition of
proliferation. A major G1/S checkpoint pathway involves p53-mediated activation of
cyclin-dependent inhibitor 1 (p21) (29). Since LNCaP cells express functional p53, we
hypothesized that p21 might be involved in FPN-mediated inhibition of proliferation. As
shown in Figure 6A (Figure S5), FPN overexpression did indeed activate p53 and its
downstream target p21 (Figure 6A; S5; S7C) in LNCaP cells. Elevated levels of p21 protein
were associated with increased levels of p21 mRNA (Figure 6B). Analysis of LNCaP and C42 (Tet-FPN) cells similarly showed p21 induction following doxycycline-mediated induction
of FPN (Figure 6C, S5, S6). We also assessed effects of FPN on levels of cyclins. FPN
overexpression decreased mRNA levels of Cyclin A1, Cyclin B1, and Cyclin D1 in LNCaP and
C4-2 (Tet-FPN) cells, demonstrating a profound impact of FPN on drivers of the cell cycle in
these cells (Figure 6D,E).
We tested whether the more modest G0/G1 cell cycle arrest seen in PC3 cells could be
traced to a lack of induction of p21, since PC3 cells lack functional p53, a major upstream
inducer of p21 ((12); Figure S7A). Surprisingly, similar to LNCaP cells, FPN overexpression
in PC3 cells induced p21 and downregulated expression of cyclin A1 and B1 (Figure 7A). To
explore mechanisms of FPN-mediated induction of p21 in PC3 p53 null cells, we analyzed
known transcriptional regulators of p21 (1). We observed that KLF6, a zinc finger
transcription factor, tumor suppressor, and regulator of p21 in prostate cancer cells (49),
was induced in PC3 cells following overexpression of FPN (Figure 7B, S8). Other known
transcriptional regulators of p21, including CREBBP, E2F1, AP4, SP1, SP3, cMyc, and KLF4,
were unaffected by FPN overexpression (not shown). Knockdown of KLF6 attenuated FPN-
9
mediated induction of p21, confirming the involvement of KLF6 in p21 induction in PC3
cells (Figure 7C, S9).
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 9 of 158
In addition to p21, p53 induces other proteins that inhibit the cell cycle. In particular,
members of the DNA damage-induced (GADD) gene family are upregulated by p53 (74)
and are induced by DNA damage (22), nutrition deprivation (21) or iron chelation (14,61).
Furthermore, members of the GADD gene family, GADD34 and GADD153, promote
autophagy (71). As seen in Figure 8, FPN overexpression induced GADD genes GADD45A,
GADD45B, GADD45G, GADD34, and GADD153 in all three prostate cancer cell lines,
including p53 null PC3 cells (Figure 8A-E). These data suggest that induction of GADD
genes is a widespread response to FPN-mediated iron depletion, independent of p53
status. Considering that both p53 (31) and GADD genes (22) are induced by DNA damage,
we asked whether FPN overexpression led to the accumulation of DNA damage. Indeed,
FPN overexpression significantly increased γH2AX staining (36), a marker of DNA double
stranded breaks, in C4-2 (Tet-FPN) prostate cancer cells (Figure 8F).
FPN overexpression induces cell-specific gene changes as well as changes that converge
on similar pathways
Our observations to this point suggested that the three prostate cancer cell lines we tested
activated converging pathways in response to FPN-mediated iron depletion, despite their
derivation from different histopathological subtypes of prostate cancer. To more fully
explore the similarities and differences in the response of these cells to FPN-mediated iron
depletion, we performed a microarray analysis of LNCaP (Tet-FPN), C4-2 (Tet-FPN), and
PC3 (Tet-FPN) cells as well as a vector control [LNCaP (Tet-VEC)] in the presence and
absence of doxycycline, and identified genes that were significantly differentially
expressed following overexpression of FPN (FDR <0.05.). The number of FPN-regulated
genes varied among these cell lines from 113 in LNCaP cells, 486 in PC-3 cells to 2916 in
C4-2 Tet-FPN cells (Supplementary Table 1). To map these genes to pathways, we first
removed genes that were differentially expressed in the doxycycline control from the
analysis (n=30), and then mapped the remaining differentially expressed genes to
Reactome pathways using ReactomePA (79). As expected, pathways perturbed in all three
10
prostate cell lines converged on the cell cycle and DNA repair (Figure 9). FPN-mediated
changes were also observed in unanticipated pathways, notably the senescenceAntioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 10 of 158
associated secretory phenotype (SASP). In addition to alterations in these shared
pathways, numerous pathways were perturbed in only two of the three cell lines (e.g.
chromatin modification, regulation of rRNA expression, HOX genes, sumolyation) or were
cell type specific, such as glycolysis, Wnt signaling and mitochondrial translation
(Supplementary Table 2). Thus FPN-mediated iron depletion induces divergent as well as
convergent changes in gene expression in prostate cancer cells.
FPN inhibits the growth of prostate tumor xenografts in vivo
Given the ability of FPN overexpression to induce cell cycle arrest and inhibit proliferation
of prostate cancer cells in vitro, we used mouse xenografts to assess the effect of FPN on
growth of prostate tumors in vivo. For these experiments we utilized C4-2 adenocarcinoma
cells, since they represent a clinically relevant model of hormone refractory disease. To
facilitate tracking of tumor cells in vivo, we created a stable C4-2/Luc (Tet-FPN) cell line
containing a luciferase reporter. Two days after implantation of C4-2/Luc (Tet-FPN) cells in
mice, we measured luciferase activity and divided mice into experimental and control
groups with comparable average luciferase activity (Figure 10A). Doxycycline was added to
the drinking water to induce FPN in the experimental group, while the control group was
provided with drinking water without doxycycline. Tumor growth was monitored over
time. In vivo measures of luciferase demonstrated significantly lower activity in the
doxycycline-treated mice (Figure 10B). Consistent with these results, direct measures of
tumor volume revealed a substantial inhibition of tumor growth after doxycycline
treatment at a series of time points (Figure 10C). Importantly, FPN remained
overexpressed and FTH was decreased in these tumors (Supplemental Figure S10),
consistent with a reduced iron phenotype in tumors harvested from doxycycline treated
mice. As anticipated, doxycycline had no effect on tumor growth in mice implanted with
control C4-2/Luc cells (Supplemental Figure S11). These data indicate that FPN suppresses
growth of prostate adenocarcinoma cells in vivo.
11
Discussion
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 11 of 158
A large body of evidence suggests that iron is critical to malignant growth, and that cancer
cells acquire and retain more iron than their non-malignant counterparts (70). Repression
of FPN, an iron efflux pump, is a mechanism of enhanced iron retention that has been
observed in prostate cancer cells and tumors (69,77). The use of iron chelators to deprive
cancer cells of this essential nutrient has therefore become the subject of clinical interest
and has engendered a number of ongoing clinical trials (30). However, fundamental
questions remain concerning the pathways triggered by iron depletion, whether similar
pathways are activated in different types of cancer cells, and the mechanisms that trigger
these pathways.
In this study we focused on mechanisms triggered by iron depletion in prostate cancer, a
major cause of suffering and death in older men. We used cell lines to compare three
important histological and biological subtypes of this disease: LNCaP cells, representative
of androgen receptor positive adenocarcinoma; C4-2 cells, representative of castrateresistant adenocarcinoma; and PC3 cells, representative of a neuroendocrine carcinoma of
the prostate, a rare but highly aggressive malignancy (67). We used overexpression of
ferroportin, an endogenous iron efflux pump, to identify and compare pathways triggered
by iron depletion in these cell types.
Manipulation of FPN exerted a substantial effect on iron metabolism in all three prostate
cancer cell types. Iron is an essential element required for cellular viability, and iron
metabolism is characterized by a delicate feedback system that preserves iron
homeostasis. When cells are depleted of iron, IRP activity increases, which in turn
simultaneously increases levels of the iron import protein TFR1 and decreases levels of the
iron storage protein ferritin to restore iron homeostasis (20). We observed this physiologic
feedback response in prostate cancer cells with overexpression of FPN: as seen in Figure 1,
expression of FPN activated IRP2, induced TFR1, repressed ferritin, and decreased the
labile iron pool. However, the response was insufficient to prevent the antiproliferative
effects of FPN overexpression (Figure 3). Thus, sustained expression of the iron exporter
FPN is able to override the controls put in place by the iron regulatory system, and
12
therefore results in cellular iron depletion and growth inhibition. These findings establish
FPN as a key lever in regulating iron balance and proliferation in multiple prostate cancer
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 12 of 158
cell types.
We studied downstream pathways affected by FPN-mediated iron depletion. We observed
a profound effect on three stress response pathways: autophagy, cell cycle arrest, and
environmental stress (Figure 11).
We first tested the effect of FPN overexpression on autophagy. Overexpression of FPN
induced autophagy in LNCaP, C4-2, and PC3 cells, eliciting a response similar to that
induced by DFO, a potent iron chelator (Figure 2). Supporting earlier studies (4,32), recent
work has identified a specific cargo receptor for degradation of the iron storage protein
ferritin in the autophagolysosome, and suggested that autophagy is important for recycling
of intracellular iron (19,43). Our observation that FPN induces autophagy in all prostate
cancer cells tested is consistent with this model, and further suggests that degradation of
subcellular components is a general survival mechanism by which prostate cancer cells
attempt to re-allocate iron in response to iron deprivation.
We next investigated the effect of FPN-mediated iron depletion on proliferation and cell
cycle progression. In all three prostate cancer cell types, FPN significantly decreased
proliferation (Figure 3). Cell cycle analyses revealed that FPN expression caused an
accumulation of cells in G0/G1 (Figure 5), particularly in the prostate adenocarcinoma cells
LNCaP and C4-2. This was associated with an induction of the tumor suppressor p53 and its
downstream target p21CIP/WAF1, a key cyclin-dependent kinase inhibitor (1) (Figure 6,
Supplementary Figure S7). Intriguingly, PC3 cells, which do not express functional p53
((12); Supplementary Figure S7A), also exhibited an increase in p21 mRNA (Figure 7),
suggesting the existence of an alternative mechanism through which iron depletion
induces p21. We observed that in PC3 cells, FPN induced KLF6 (Figure 7), a tumor
suppressor that has been specifically associated with prostate cancer (49). Knockdown of
KLF6 prevented FPN-mediated p21 induction, directly implicating KLF6 in p21 induction in
PC3 cells (Figure 7). KLF6 has not previously been linked to iron depletion. Other targets of
KLF6 include genes involved in motility, invasion, growth factor signaling and angiogenesis
13
(17), and it will be of interest to determine to what extent these pathways are activated in
iron depleted cells.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 13 of 158
We also examined the effect of FPN overexpression on expression of GADD genes, since
these are induced by, and play a role in the response to, nutrient and environmental stress
(39). GADD34, GADD45A, GADD45B, GADD45G, and GADD153 were induced in all prostate
cancer cells that overexpressed FPN (Figure 8). Although the GADD genes were named
based on their similar routes of discovery (21), subsequent work has revealed that they
play very different roles (39). GADD45 genes are induced by p53, trigger cell cycle arrest,
and have a tumor suppressive function, in part through interaction with p21 (8). Induction
of GADD45A and GADD45B may therefore functionally augment the anti-proliferative
activity of p21 in cells expressing FPN. Interestingly, induction of GADD45A was also
observed in PC3 cells that do not express functional p53, indicating that iron depletion can
induce GADD45A through a mechanism that is p53-independent (Figure 11). We speculate
that an increase in DNA damage (Figure 8F) may underpin the upregulation of GADD45A
and GADD45B gene expression in these cells. Further, since DNA damage induces p53
(44,63) as well as KLF6 (5), DNA damage may also underlie the induction of p53 (Figure 6A)
and KLF6 (Figure S9) following induction of FPN.
In contrast to the GADD45 genes, GADD34 and GADD153 are upregulated by agents that
trigger ER stress, such as nutrient deprivation and protein misfolding, and play a role in
rectifying ER stress (24). ER stress can be induced by iron chelation (37) and can trigger
autophagy (24,55), which we observed in all prostate cancer cells we studied (Figure 2).
We therefore speculate that FPN-mediated iron depletion may induce an ER stress
response, and that this may contribute to the induction of autophagy in prostate cancer
cells. Indeed, two markers of ER stress (50), spliced X-box binding protein 1 (sXBP1) and
activating transcription factor 4 (ATF4) were transcriptionally upregulated following FPN
overexpression (Supplemental Figure S12). ATF4 is a known activator of GADD34 and
GADD153 (CHOP) genes (42) and is likely involved in upregulation of these genes following
FPN overexpression. This model is presented in Figure 11.
14
Pathways induced by ferroportin overexpression are similar to those activated by iron
chelators. In addition to their use as medicinal agents, iron chelators have been used to
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 14 of 158
elucidate mechanisms of iron trafficking and regulation. However, like any drug, iron
chelators have the potential to exhibit off-target effects, and their ability to abstract
intracellular iron in a manner that truly mimics physiological iron depletion has
occasionally been questioned (51,56). Although we did not directly address this issue, we
observed that pathways activated by overexpression of FPN, an endogenous iron efflux
pump, show remarkable similarity to pathways triggered in cells treated with iron
chelators (41). This includes induction of p53 (41), induction of p21 (41), induction of
GADD genes (61), induction of autophagy (54) and inhibition of proliferation (38), all of
which have been observed in cells treated with iron chelators. Since FPN is presumably
unable to liberate iron from non-physiological targets, our findings not only confirm that
upregulation of this efflux pump has far-reaching physiological consequences, but
reinforce the notion that iron chelators can be used as effective probes of intracellular iron
pathways.
FPN-mediated iron depletion activated different molecular pathways in prostate cancer
cells representative of different histopathological subtypes of prostate cancer. For
example in LNCaP cells, FPN overexpression induced p21 via a p53-mediated pathway,
whereas in p53 null PC3 cells, KLF6 subsumed this role (Figures 6,7). KLF6 is a tumor
suppressor that exhibits both p53-dependent and p53-independent activities. KLF6
suppresses proliferation through p53-independent p21 transactivation (49) and cyclin D1
sequestration (7), but also stabilizes p53 through repression of mdm2 (68). p53 and KLF6
can also interact directly to control transcription of genes important in prostate cancer
such as IGFI (59). Thus the role(s) played by each of these multifaceted tumor suppressors
in the response to iron depletion is likely to be multifactorial, and modulated by the extent
to which each is expressed in a given tumor. Although the details of the molecular
interaction between KLF6 and p53 in response to iron depletion remain to be elucidated,
in our experiments we observed that pathways modulated by these proteins converged on
a similar phenotype characterized by G1 arrest, inhibition of DNA synthesis, induction of
15
autophagy, and induction of GADD genes involved in cell cycle arrest (GADD45A,
GADD45B, and GADD45G) and ER stress (GADD34 and GADD153).
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 15 of 158
We performed a microarray analysis to gain additional insight into pathways perturbed by
FPN in prostate cancer cells (Figure 9, Supplemental Tables 1 and 2). This analysis revealed
five pathways that were significantly perturbed by ferroportin overexpression in all three
prostate cancer cell lines tested (Figure 9). Of these five pathways, four mapped to
alterations in the cell cycle or DNA damage (Figure 9), consistent with other data
presented here. However, our microarray analysis also uncovered a new pathway
perturbed by ferroportin overexpression: the senescence-associated secretory phenotype
(SASP), a pathway that has not been previously linked to iron depletion (Figure 9). SASP
refers to the altered secretome exhibited by senescent cells. It includes survival factors,
cytokines, and growth factors (3,72,76,78). SASP is induced by several senescent triggers
including DNA damage (57), consistent with our finding of DNA damage following FPN
overexpression. Further, p53 and p21, which are increased following FPN overexpression
(Figure 6, 7, S5), play a role in coordinating DNA damage-mediated SASP (2). Interestingly,
SASP is known to induce autophagy, which we observed following FPN overexpression
(Figures 2), as well as ER stress (18,60). Thus SASP may represent a bridge between
induction of DNA damage, autophagy and ER stress in cells that overexpress FPN. Further
work will be required to test this hypothesis.
In addition to the induction of common pathways by FPN overexpression, microarray
analysis also revealed cell-type specific responses to FPN, perhaps reflecting the different
histopathological origin of the cell types studied. These pathways included glycolysis in
LNCaP cells, mitochondrial translation in C4-2 cells, Wnt signaling in PC3 cells, and several
others (Supplemental Table 2). The extent to which these reinforce or amplify FPNmediated effects on cell proliferation will require further investigation. Nevertheless, the
profound effects of FPN-mediated iron depletion on a variety of key intracellular targets
suggests that iron may be a broadly useful target in the treatment of prostate cancer,
despite the wide variability in pathology and clinical course exhibited by prostate cancer
subtypes.
16
FPN-mediated effects on iron metabolism were sufficient to inhibit growth of castrateresistant prostate tumors in vivo (Figure 10). This finding underscores the critical
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 16 of 158
contribution of iron metabolism to tumor growth, and in particular demonstrates that
manipulation of a single nutrient – iron – is sufficient to dramatically affect tumor growth.
It is also notable that therapeutic options for castrate-resistant prostate cancer are limited
(28). The ability of iron depletion to effectively retard growth of this prevalent and
treatment-refractory tumor type suggests that deeper exploration of anti-tumor strategies
targeting iron may prove clinically useful in the treatment of prostate cancer.
Innovation
Pathways triggered by iron depletion have been traditionally explored using iron chelators.
Here we use expression of ferroportin, an endogenous iron efflux pump markedly
downregulated in prostate cancer, as a novel approach to interrogate molecular responses
to iron depletion. Focusing on cells representative of three different, clinically important,
histolopathological subtypes of prostate cancer, we observe that iron depletion induces
DNA damage, autophagy, cell cycle arrest, and a stress response in all subtypes of prostate
cancer by activating different but converging molecular pathways. Using microarray
analysis, we further show that FPN-mediated iron depletion induces additional pathways
that are both overlapping and cell-type specific. We demonstrate that ferroportinmediated iron depletion is sufficient to significantly reduce the growth of treatmentrefractory C4-2 prostate tumors in vivo. These results may provide a molecular explanation
for why ferroportin is suppressed in prostate cancer tissue.
Our results also support the further study of iron depletion as an anti-tumor strategy.
Synthetic iron chelators represent one strategy for inducing iron depletion that has shown
considerable promise (27), and remains an area of active investigation (6). Our work
suggests that other approaches to targeting tumor iron dependence, such as FPN agonists,
may also merit exploration. For example, pharmacological agents that inhibit hepcidin, a
negative regulator of FPN, might be modified and repurposed for use in cancer therapy.
The recent interest in the development of multiple hepcidin inhibitors may accelerate this
process (10).
17
Materials and Methods
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 17 of 158
Cells and cell culture
The prostate cancer cell lines LNCaP and PC3 were obtained from American Type Culture
Collection (ATCC). Cells were grown in RPMI medium (GIBCO Life Technologies,
Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (Gemini) and
incubated at 37°C in a humidified atmosphere with 5% CO2. The C4-2 cell line was a gift of
Dr. Robert Sikes at the University of Delaware. The cell lines were authenticated by ATCC.
DNA vectors, viral package and infection
A human FPN cDNA clone was obtained from Open Biosystems (Biosystems/GE
Dharmacon, Lafayette, CO, USA), and was used as a PCR template to introduce FPN into
pSL2 lentiviral overexpression vector (16) and pLVX-TetOne-puro, a lentiviral tetracycline
(tet) inducible vector (Clontech Laboratories, Mountain View, CA, USA). The FPN A77D
mutant was created using site-directed mutagenesis and cloned into pSL2 and pLVXTetOne-puro vectors. The retroviral construct pBABE-puro-mCherry-EGFP-LC3B, an
autophagic reporter (48), was obtained from Addgene (catalog #22418). The LUC2 gene
and zeocin resistance gene from the pGL4 vector (Promega Co., Madison, WI, USA) were
subcloned into the pLKO.1-shCtr vector (Addgene catalog #10879) (47) to create a
luciferase lentiviral expression vector. To do this, the shRNA expression cassette was first
deleted. Next, the puromycin resistance gene was replaced with the LUC2 coding region,
an internal ribosome entry site (IRES), and the zeocin resistance gene. These modifications
resulted in expression of luciferase and zeocin driven by the original phosphoglycerate
kinase (PGK) promoter.
Lentiviral shRNAs against KLF6 gene were obtained from Sigma-Aldrich (Sigma-Aldrich, St.
Louis, MO, USA). To prepare lentiviral particles, the lentiviral expression vector was
cotransfected with third generation packaging plasmids (pVSV-G, pRSV-REV, and
pMDLg/pRRE) into 293FT cells as described previously (15). Lentiviral particles were
concentrated by ultracentrifugation and incubated with cells in the presence of polybrene
(8µg/ml). Retrovirus was prepared by transfecting GP2-293 cells (Clontech Laboratories,
Inc., Palo Alto, CA, USA, catalog #631458) with pBABE-mCherry-EGFP-LC3B vector and the
18
packaging plasmid PCL10A-1. Three days after transfection, virus-containing medium was
harvested and filtered with 0.45 µM filter. Retroviral infection was performed by adding
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 18 of 158
virus-containing medium to cells grown in 6-well plates. A stably infected cell population
was acquired by fluorescence-activated cell sorting (FACS) on BD FacsAria II.
Cell cycle analysis
Cells were harvested by trypsinization and washed twice with pre-chilled wash buffer (1x
PBS containing 0.1% FBS). After centrifugation, cells were resuspended at about 1 x 106
cells/ml and fixed by dropwise addition of three volumes of cold (-20°C) absolute ethanol
while vortexing and stored at -20°C for at least 1 hour. After washing twice with PBS, fixed
cells were stained with FxCycle™ PI/RNase Staining Solution (Life Technologies, Carlsbad,
CA, catalog #F10797) according to the manufacturer’s instruction. Cell cycle analysis was
performed using MACSQuant flow cytometer (Miltenyi Biotec, Bergisch Gladbach,
Germany). The data were analyzed with ModFit LT 3.0 software (Verity Software House,
Topsham, ME, USA).
Cell growth assay
Cell proliferation assays were conducted as described previously (73). To determine if FPNmediated inhibition of cell proliferation was permanent or transient, cells were first
treated with 1 µg/ml doxycycline for 2 days. The media was then replaced with
doxycycline-free media for 6 days. Cells were then replated at 10,000 cells per well and cell
proliferation measured by counting cells with a hemocytometer after 3, 5, and 7 days. As a
control, cell proliferation was measured at the same time in cells that had not been pretreated with doxycycline.
Cell surface localization of FPN and A77D
Cell surface proteins were determined by flow cytometry. Antibodies used were Ab-FPN
38C8 (Amgen) (58) and Alexa Fluor® 488 AffiniPure Goat Anti-Human IgG (Jackson
ImmunoResearch Laboratories, West Grove, PA, catalog #109-545-098).
19
5-bromo-2’-deoxy (BrdU) incorporation assay
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 19 of 158
BrdU incorporation was measured using a FITC BrdU flow kit (BD Biosciences, San Diego,
CA, USA, catalog #559619) essentially following the manufacturer’s protocol, except that
labeling was performed only with BrdU and nuclear DNA was not further stained. The
labeled cell populations were analyzed by flow cytometry.
Labile Iron Pool (LIP) assay
The labile iron level in cells was determined by calcein-acetoxymethyl ester (CA-AM)-based
measurement as previously described (53).
Immunofluorescence Imaging
Cells were plated on an 8-chamber slide (BD Falcon) and treated ± 1 μg/ml doxycycline
(Sigma) for 72 hours or with 10 µM cisplatin (cis-Diamineplatinum(II) dichloride, Sigma,
479306). Cells were fixed with 4% paraformaldehyde for 15 minutes and blocked with 5%
BSA at 4°C for 2 hours. Anti-human phospho-histone H2A.X (Cell Signaling, 9718S) was
applied overnight followed by Alexa Fluor 488-conjugated secondary antibody (Abcam,
ab150077) incubation for 1 hour. Coverslips were mounted to chamber slides with
ProLong™ Gold Antifade reagent with DAPI (Life Technologies, P36935). Fluorescent
images were acquired using an Axio Vert.A1 microscope (Ziess) and ZEN software (Zeiss).
Nuclear γH2AX foci were detected using Fuji (https://fiji.sc/).
Real-time PCR and western blotting
Total RNA was extracted using the High Pure RNA Isolation Kit (Roche) and the
concentration of RNA was quantified with a Nanodrop ND-2000 spectrophotometer
(Thermo Scientific, Rockford, IL, USA). Taqman reverse transcription kit (Thermofisher) was
used for reverse transcription. Amplification was performed on an Applied Biosystems
ViiA™ 7 Real-Time PCR system. Primers used in the real-time PCR are detailed in
Supplementary Table 3.
To detect FPN by western blotting, protein samples were prepared in SDS reducing buffer
without boiling and run on 10% SDS polyacrylamide gel. Antibodies used in western
20
blotting were glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Fitzgerald), FPN
(Amgen), TfR1 (Invitrogen-Life Technologies), ferritin H (73), IRP1 (Medimabs, Montreal,
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 20 of 158
Quebec, Canada), IRP2 (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), KLF6
(Thermofisher), LC3B (Novus Biological, Littleton, Colorado, USA). Blots shown in the
figures were cropped for clarity. Uncropped blots are shown in Supplementary Figures S1,
S3, S4, S5, S8 and S13.
Xenograft experiments
All animal procedures were approved by the UConn Health Institutional Animal Care and
Use Committee (IACUC). C4-2/Luc cells were generated by infection with a LUC2 lentiviral
expression vector. C4-2/Luc (Tet-FPN) cells were generated by infection with a LUC2
lentiviral expression vector in which a tet-on FPN expression cassette had been introduced
through infection with pLVX-TetOne-puro-FPN lentivirus. Cells were subcutaneously
injected into the lower flank of 8-week-old male immunodeficient nude mice (Crl:NU(NCr)Foxn1nu, Charles River) (2 x 106 cells/mouse). The mice were divided into mock and
doxycycline treated groups (8-12 mice per group). Mice were provided with water
containing 4% sucrose with or without 2 mg/ml doxycycline three days after cell
implantation until the termination of the experiment at 6 weeks. Tumor size was
measured twice a week using digital calipers. In vivo bioluminescent imaging was
performed on IVIS imaging system (Perkin Elmer) and analyzed using Living Image software
(version 4.4).
Microarray analysis
LNCaP (Tet-Vec), LNCaP (Tet-FPN), C4-2 (Tet-FPN), and PC3 (Tet-FPN) cells were treated ± 1
µg/ml doxycycline for 48 hours. RNA was isolated from harvested cells using the High Pure
RNA Isolation Kit (Roche, 11828665001). Three biological replicates were sent to the Yale
Center for Genome Analysis (Yale University, West Haven, CT) for analysis on human
Clariom D microarray chips (Thermofisher Scientific, 902923). Data was normalized using
Expression Console software (Affymetrix, Version 1.4.1.46). Differential expression analysis
was performed in R (https://www.r-project.org/) with the Bioconductor package limma. A
gene was considered differentially expressed if the FDR < .05. Pathway analysis was
21
performed in R with the Bioconductor package ReactomePA (79). Differentially expressed
genes in LNCaP (Tet-Vec) cells were removed from pathway analysis of Tet-FPN cells if the
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 21 of 158
direction of differential expression was consistent between Tet-Vec and all Tet-FPN cell
lines. Data analysis was limited to fully annotated genes.
Statistics
All in vitro experiments were performed independently at least three times. Data used for
quantitative analyses were collected from representative triplicate experiments, which are
presented as mean ± standard deviation (SD), unless indicated otherwise. Student’s t-test
was used to test for a significant difference between the means in two independent
groups using GraphPad Prism software (Graphpad Software Inc. San Diego, CA, USA). A Pvalue < 0.05 was considered statistically significant.
Acknowledgements
We are grateful to laboratory members Dr. David Lemler, Ph.D. and Erica Lemler for their
generous assistance in measurements of the labile iron pool and tumor growth. This work
was supported in part by grants F30 DE026380 and T90 DE021989 from the NIDCR
(D.H.M.), and NCI grants R01 CA188025 (S.V.T), and R01 CA171101 (F.M.T).
Author Disclosure Statement
No competing financial interests exist.
22
References
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 22 of 158
1.
Abbas T, Dutta A. p21 in cancer: intricate networks and multiple activities. Nat Rev
Cancer 9: 400-14, 2009.
2.
Acosta JC, Banito A, Wuestefeld T, Georgilis A, Janich P, Morton JP, Athineos D, Kang
TW, Lasitschka F, Andrulis M, Pascual G, Morris KJ, Khan S, Jin H, Dharmalingam G,
Snijders AP, Carroll T, Capper D, Pritchard C, Inman GJ, Longerich T, Sansom OJ,
Benitah SA, Zender L, Gil J. A complex secretory program orchestrated by the
inflammasome controls paracrine senescence. Nat Cell Biol 15: 978-90, 2013.
3.
Acosta JC, O'Loghlen A, Banito A, Guijarro MV, Augert A, Raguz S, Fumagalli M, Da
Costa M, Brown C, Popov N, Takatsu Y, Melamed J, d'Adda di Fagagna F, Bernard D,
Hernando E, Gil J. Chemokine signaling via the CXCR2 receptor reinforces
senescence. Cell 133: 1006-18, 2008.
4.
Asano T, Komatsu M, Yamaguchi-Iwai Y, Ishikawa F, Mizushima N, Iwai K. Distinct
mechanisms of ferritin delivery to lysosomes in iron-depleted and iron-replete cells.
Mol Cell Biol 31: 2040-52, 2011.
5.
Banck MS, Beaven SW, Narla G, Walsh MJ, Friedman SL, Beutler AS. KLF6
degradation after apoptotic DNA damage. FEBS Lett 580: 6981-6, 2006.
6.
Basu A, Sohn YS, Alyan M, Nechushtai R, Domb AJ, Goldblum A. Discovering Novel
and Diverse Iron-Chelators in Silico. J Chem Inf Model 56: 2476-2485, 2016.
7.
Benzeno S, Narla G, Allina J, Cheng GZ, Reeves HL, Banck MS, Odin JA, Diehl JA,
Germain D, Friedman SL. Cyclin-dependent kinase inhibition by the KLF6 tumor
suppressor protein through interaction with cyclin D1. Cancer Res 64: 3885-91,
2004.
8.
Berkers CR, Maddocks OD, Cheung EC, Mor I, Vousden KH. Metabolic regulation by
p53 family members. Cell Metab 18: 617-33, 2013.
9.
Bieging KT, Mello SS, Attardi LD. Unravelling mechanisms of p53-mediated tumour
suppression. Nat Rev Cancer 14: 359-70, 2014.
10.
Blanchette NL, Manz DH, Torti FM, Torti SV. Modulation of hepcidin to treat iron
deregulation: potential clinical applications. Expert Rev Hematol 9: 169-86, 2016.
11.
23
Bostwick DG. The pathology of early prostate cancer. CA Cancer J Clin 39: 376-93,
1989.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 23 of 158
12.
Carroll AG, Voeller HJ, Sugars L, Gelmann EP. p53 oncogene mutations in three
human prostate cancer cell lines. Prostate 23: 123-34, 1993.
13.
Culig Z, Hobisch A, Bartsch G, Klocker H. Androgen receptor--an update of
mechanisms of action in prostate cancer. Urol Res 28: 211-9, 2000.
14.
Darnell G, Richardson DR. The potential of iron chelators of the pyridoxal
isonicotinoyl hydrazone class as effective antiproliferative agents III: the effect of
the ligands on molecular targets involved in proliferation. Blood 94: 781-92, 1999.
15.
Deng Z, Sui G, Rosa PM, Zhao W. Radiation-induced c-Jun activation depends on
MEK1-ERK1/2 signaling pathway in microglial cells. PLoS One 7: e36739, 2012.
16.
Deng Z, Wan M, Cao P, Rao A, Cramer SD, Sui G. Yin Yang 1 regulates the
transcriptional activity of androgen receptor. Oncogene 28: 3746-57, 2009.
17.
DiFeo A, Martignetti JA, Narla G. The role of KLF6 and its splice variants in cancer
therapy. Drug Resist Updat 12: 1-7, 2009.
18.
Dorr JR, Yu Y, Milanovic M, Beuster G, Zasada C, Dabritz JH, Lisec J, Lenze D,
Gerhardt A, Schleicher K, Kratzat S, Purfurst B, Walenta S, Mueller-Klieser W, Graler
M, Hummel M, Keller U, Buck AK, Dorken B, Willmitzer L, Reimann M, Kempa S, Lee
S, Schmitt CA. Synthetic lethal metabolic targeting of cellular senescence in cancer
therapy. Nature 501: 421-5, 2013.
19.
Dowdle WE, Nyfeler B, Nagel J, Elling RA, Liu S, Triantafellow E, Menon S, Wang Z,
Honda A, Pardee G, Cantwell J, Luu C, Cornella-Taracido I, Harrington E, Fekkes P, Lei
H, Fang Q, Digan ME, Burdick D, Powers AF, Helliwell SB, D'Aquin S, Bastien J, Wang
H, Wiederschain D, Kuerth J, Bergman P, Schwalb D, Thomas J, Ugwonali S,
Harbinski F, Tallarico J, Wilson CJ, Myer VE, Porter JA, Bussiere DE, Finan PM, Labow
MA, Mao X, Hamann LG, Manning BD, Valdez RA, Nicholson T, Schirle M, Knapp MS,
Keaney EP, Murphy LO. Selective VPS34 inhibitor blocks autophagy and uncovers a
role for NCOA4 in ferritin degradation and iron homeostasis in vivo. Nat Cell Biol 16:
1069-79, 2014.
20.
Eisenstein RS. Iron regulatory proteins and the molecular control of mammalian
iron metabolism. Annu Rev Nutr 20: 627-62, 2000.
21.
24
Fornace AJ, Jr., Jackman J, Hollander MC, Hoffman-Liebermann B, Liebermann DA.
Genotoxic-stress-response genes and growth-arrest genes. gadd, MyD, and other
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 24 of 158
genes induced by treatments eliciting growth arrest. Ann N Y Acad Sci 663: 139-53,
1992.
22.
Fornace AJ, Jr., Nebert DW, Hollander MC, Luethy JD, Papathanasiou M, Fargnoli J,
Holbrook NJ. Mammalian genes coordinately regulated by growth arrest signals and
DNA-damaging agents. Mol Cell Biol 9: 4196-203, 1989.
23.
Ganz T. Cellular iron: ferroportin is the only way out. Cell Metab 1: 155-7, 2005.
24.
Gump JM, Thorburn A. Sorting cells for basal and induced autophagic flux by
quantitative ratiometric flow cytometry. Autophagy 10: 1327-34, 2014.
25.
Gutierrez E, Richardson DR, Jansson PJ. The anticancer agent di-2-pyridylketone 4,4dimethyl-3-thiosemicarbazone (Dp44mT) overcomes prosurvival autophagy by two
mechanisms: persistent induction of autophagosome synthesis and impairment of
lysosomal integrity. J Biol Chem 289: 33568-89, 2014.
26.
Gwinn DM, Shackelford DB, Egan DF, Mihaylova MM, Mery A, Vasquez DS, Turk BE,
Shaw RJ. AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol
Cell 30: 214-26, 2008.
27.
Hatcher HC, Singh RN, Torti FM, Torti SV. Synthetic and natural iron chelators:
therapeutic potential and clinical use. Future Med Chem 1: 1643-70, 2009.
28.
Hotte SJ, Saad F. Current management of castrate-resistant prostate cancer. Curr
Oncol 17 Suppl 2: S72-9, 2010.
29.
Johnson DG, Walker CL. Cyclins and cell cycle checkpoints. Annu Rev Pharmacol
Toxicol 39: 295-312, 1999.
30.
Kalinowski DS, Stefani C, Toyokuni S, Ganz T, Anderson GJ, Subramaniam NV, Trinder
D, Olynyk JK, Chua A, Jansson PJ, Sahni S, Lane DJ, Merlot AM, Kovacevic Z, Huang
ML, Lee CS, Richardson DR. Redox cycling metals: Pedaling their roles in metabolism
and their use in the development of novel therapeutics. Biochim Biophys Acta 1863:
727-48, 2016.
31.
Kastan MB, Onyekwere O, Sidransky D, Vogelstein B, Craig RW. Participation of p53
protein in the cellular response to DNA damage. Cancer Res 51: 6304-11, 1991.
32.
Kidane TZ, Sauble E, Linder MC. Release of iron from ferritin requires lysosomal
25
activity. Am J Physiol Cell Physiol 291: C445-55, 2006.
33.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 25 of 158
Kimura S, Noda T, Yoshimori T. Dissection of the autophagosome maturation
process by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy 3:
452-60, 2007.
34.
Klionsky DJ, Abdalla FC, Abeliovich H, Abraham RT, Acevedo-Arozena A, Adeli K,
Agholme L, Agnello M, Agostinis P, Aguirre-Ghiso JA, Ahn HJ, Ait-Mohamed O, AitSi-Ali S, Akematsu T, Akira S, Al-Younes HM, Al-Zeer MA, Albert ML, Albin RL, AlegreAbarrategui J, Aleo MF, Alirezaei M, Almasan A, Almonte-Becerril M, Amano A,
Amaravadi R, Amarnath S, Amer AO, Andrieu-Abadie N, Anantharam V, Ann DK,
Anoopkumar-Dukie S, Aoki H, Apostolova N, Arancia G, Aris JP, Asanuma K, Asare
NY, Ashida H, Askanas V, Askew DS, Auberger P, Baba M, Backues SK, Baehrecke EH,
Bahr BA, Bai XY, Bailly Y, Baiocchi R, Baldini G, Balduini W, Ballabio A, Bamber BA,
Bampton ET, Banhegyi G, Bartholomew CR, Bassham DC, Bast RC, Jr., Batoko H, Bay
BH, Beau I, Bechet DM, Begley TJ, Behl C, Behrends C, Bekri S, Bellaire B, Bendall LJ,
Benetti L, Berliocchi L, Bernardi H, Bernassola F, Besteiro S, Bhatia-Kissova I, Bi X,
Biard-Piechaczyk M, Blum JS, Boise LH, Bonaldo P, Boone DL, Bornhauser BC,
Bortoluci KR, Bossis I, Bost F, Bourquin JP, Boya P, Boyer-Guittaut M, Bozhkov PV,
Brady NR, Brancolini C, Brech A, Brenman JE, Brennand A, Bresnick EH, Brest P,
Bridges D, Bristol ML, Brookes PS, Brown EJ, Brumell JH, Brunetti-Pierri N, Brunk UT,
Bulman DE, Bultman SJ, Bultynck G, Burbulla LF, Bursch W, Butchar JP, Buzgariu W,
Bydlowski SP, Cadwell K, Cahova M, Cai D, Cai J, Cai Q, Calabretta B, Calvo-Garrido J,
Camougrand N, Campanella M, Campos-Salinas J, Candi E, Cao L, Caplan AB,
Carding SR, Cardoso SM, Carew JS, Carlin CR, Carmignac V, Carneiro LA, Carra S,
Caruso RA, Casari G, Casas C, Castino R, Cebollero E, Cecconi F, Celli J, Chaachouay
H, Chae HJ, Chai CY, Chan DC, Chan EY, Chang RC, Che CM, Chen CC, Chen GC, Chen
GQ, Chen M, Chen Q, Chen SS, Chen W, Chen X, Chen X, Chen X, Chen YG, Chen Y,
Chen Y, Chen YJ, Chen Z, Cheng A, Cheng CH, Cheng Y, Cheong H, Cheong JH, Cherry
S, Chess-Williams R, Cheung ZH, Chevet E, Chiang HL, Chiarelli R, Chiba T, Chin LS,
Chiou SH, Chisari FV, Cho CH, Cho DH, Choi AM, Choi D, Choi KS, Choi ME, Chouaib
S, Choubey D, Choubey V, Chu CT, Chuang TH, Chueh SH, Chun T, Chwae YJ, Chye
ML, Ciarcia R, Ciriolo MR, Clague MJ, Clark RS, Clarke PG, Clarke R, Codogno P, Coller
26
HA, Colombo MI, Comincini S, Condello M, Condorelli F, Cookson MR, Coombs GH,
Coppens I, Corbalan R, Cossart P, Costelli P, Costes S, Coto-Montes A, Couve E,
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 26 of 158
Coxon FP, Cregg JM, Crespo JL, Cronje MJ, Cuervo AM, Cullen JJ, Czaja MJ, D'Amelio
M, Darfeuille-Michaud A, Davids LM, Davies FE, De Felici M, de Groot JF, de Haan
CA, De Martino L, De Milito A, De Tata V, Debnath J, Degterev A, Dehay B, Delbridge
LM, Demarchi F, Deng YZ, Dengjel J, Dent P, Denton D, Deretic V, Desai SD, Devenish
RJ, Di Gioacchino M, Di Paolo G, Di Pietro C, Diaz-Araya G, Diaz-Laviada I, Diaz-Meco
MT, Diaz-Nido J, Dikic I, Dinesh-Kumar SP, Ding WX, Distelhorst CW, Diwan A,
Djavaheri-Mergny M, Dokudovskaya S, Dong Z, Dorsey FC, Dosenko V, Dowling JJ,
Doxsey S, Dreux M, Drew ME, Duan Q, Duchosal MA, Duff K, Dugail I, Durbeej M,
Duszenko M, Edelstein CL, Edinger AL, Egea G, Eichinger L, Eissa NT, Ekmekcioglu S,
El-Deiry WS, Elazar Z, Elgendy M, Ellerby LM, Eng KE, Engelbrecht AM, Engelender S,
Erenpreisa J, Escalante R, Esclatine A, Eskelinen EL, Espert L, Espina V, Fan H, Fan J,
Fan QW, Fan Z, Fang S, Fang Y, Fanto M, Fanzani A, Farkas T, Farre JC, Faure M,
Fechheimer M, Feng CG, Feng J, Feng Q, Feng Y, Fesus L, Feuer R, Figueiredo-Pereira
ME, Fimia GM, Fingar DC, Finkbeiner S, Finkel T, Finley KD, Fiorito F, Fisher EA,
Fisher PB, Flajolet M, Florez-McClure ML, Florio S, Fon EA, Fornai F, Fortunato F,
Fotedar R, Fowler DH, Fox HS, Franco R, Frankel LB, Fransen M, Fuentes JM, Fueyo J,
Fujii J, Fujisaki K, Fujita E, Fukuda M, Furukawa RH, Gaestel M, Gailly P, Gajewska M,
Galliot B, Galy V, Ganesh S, Ganetzky B, Ganley IG, Gao FB, Gao GF, Gao J, Garcia L,
Garcia-Manero G, Garcia-Marcos M, Garmyn M, Gartel AL, Gatti E, Gautel M,
Gawriluk TR, Gegg ME, Geng J, Germain M, Gestwicki JE, Gewirtz DA, Ghavami S,
Ghosh P, Giammarioli AM, Giatromanolaki AN, Gibson SB, Gilkerson RW, Ginger ML,
Ginsberg HN, Golab J, Goligorsky MS, Golstein P, Gomez-Manzano C, Goncu E,
Gongora C, Gonzalez CD, Gonzalez R, Gonzalez-Estevez C, Gonzalez-Polo RA,
Gonzalez-Rey E, Gorbunov NV, Gorski S, Goruppi S, Gottlieb RA, Gozuacik D,
Granato GE, Grant GD, Green KN, Gregorc A, Gros F, Grose C, Grunt TW, Gual P,
Guan JL, Guan KL, Guichard SM, Gukovskaya AS, Gukovsky I, Gunst J, Gustafsson AB,
Halayko AJ, Hale AN, Halonen SK, Hamasaki M, Han F, Han T, Hancock MK, Hansen
M, Harada H, Harada M, Hardt SE, Harper JW, Harris AL, Harris J, Harris SD,
Hashimoto M, Haspel JA, Hayashi S, Hazelhurst LA, He C, He YW, Hebert MJ,
27
Heidenreich KA, Helfrich MH, Helgason GV, Henske EP, Herman B, Herman PK, Hetz
C, Hilfiker S, Hill JA, Hocking LJ, Hofman P, Hofmann TG, Hohfeld J, Holyoake TL,
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 27 of 158
Hong MH, Hood DA, Hotamisligil GS, Houwerzijl EJ, Hoyer-Hansen M, Hu B, Hu CA,
Hu HM, Hua Y, Huang C, Huang J, Huang S, Huang WP, Huber TB, Huh WK, Hung TH,
Hupp TR, Hur GM, Hurley JB, Hussain SN, Hussey PJ, Hwang JJ, Hwang S, Ichihara A,
Ilkhanizadeh S, Inoki K, Into T, Iovane V, Iovanna JL, Ip NY, Isaka Y, Ishida H, Isidoro C,
Isobe K, Iwasaki A, Izquierdo M, Izumi Y, Jaakkola PM, Jaattela M, Jackson GR,
Jackson WT, Janji B, Jendrach M, Jeon JH, Jeung EB, Jiang H, Jiang H, Jiang JX, Jiang
M, Jiang Q, Jiang X, Jiang X, Jimenez A, Jin M, Jin S, Joe CO, Johansen T, Johnson DE,
Johnson GV, Jones NL, Joseph B, Joseph SK, Joubert AM, Juhasz G, JuilleratJeanneret L, Jung CH, Jung YK, Kaarniranta K, Kaasik A, Kabuta T, Kadowaki M,
Kagedal K, Kamada Y, Kaminskyy VO, Kampinga HH, Kanamori H, Kang C, Kang KB,
Kang KI, Kang R, Kang YA, Kanki T, Kanneganti TD, Kanno H, Kanthasamy AG,
Kanthasamy A, Karantza V, Kaushal GP, Kaushik S, Kawazoe Y, Ke PY, Kehrl JH, Kelekar
A, Kerkhoff C, Kessel DH, Khalil H, Kiel JA, Kiger AA, Kihara A, Kim DR, Kim DH, Kim
DH, Kim EK, Kim HR, Kim JS, Kim JH, Kim JC, Kim JK, Kim PK, Kim SW, Kim YS, Kim Y,
Kimchi A, Kimmelman AC, King JS, Kinsella TJ, Kirkin V, Kirshenbaum LA, Kitamoto K,
Kitazato K, Klein L, Klimecki WT, Klucken J, Knecht E, Ko BC, Koch JC, Koga H, Koh JY,
Koh YH, Koike M, Komatsu M, Kominami E, Kong HJ, Kong WJ, Korolchuk VI, Kotake
Y, Koukourakis MI, Kouri Flores JB, Kovacs AL, Kraft C, Krainc D, Kramer H, KretzRemy C, Krichevsky AM, Kroemer G, Kruger R, Krut O, Ktistakis NT, Kuan CY,
Kucharczyk R, Kumar A, Kumar R, Kumar S, Kundu M, Kung HJ, Kurz T, Kwon HJ, La
Spada AR, Lafont F, Lamark T, Landry J, Lane JD, Lapaquette P, Laporte JF, Laszlo L,
Lavandero S, Lavoie JN, Layfield R, Lazo PA, Le W, Le Cam L, Ledbetter DJ, Lee AJ, Lee
BW, Lee GM, Lee J, Lee JH, Lee M, Lee MS, Lee SH, Leeuwenburgh C, Legembre P,
Legouis R, Lehmann M, Lei HY, Lei QY, Leib DA, Leiro J, Lemasters JJ, Lemoine A,
Lesniak MS, Lev D, Levenson VV, Levine B, Levy E, Li F, Li JL, Li L, Li S, Li W, Li XJ, Li YB,
Li YP, Liang C, Liang Q, Liao YF, Liberski PP, Lieberman A, Lim HJ, Lim KL, Lim K, Lin
CF, Lin FC, Lin J, Lin JD, Lin K, Lin WW, Lin WC, Lin YL, Linden R, Lingor P, LippincottSchwartz J, Lisanti MP, Liton PB, Liu B, Liu CF, Liu K, Liu L, Liu QA, Liu W, Liu YC, Liu Y,
Lockshin RA, Lok CN, Lonial S, Loos B, Lopez-Berestein G, Lopez-Otin C, Lossi L, Lotze
28
MT, Low P, Lu B, Lu B, Lu B, Lu Z, Luciano F, Lukacs NW, Lund AH, Lynch-Day MA, Ma
Y, Macian F, MacKeigan JP, Macleod KF, Madeo F, Maiuri L, Maiuri MC, Malagoli D,
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 28 of 158
Malicdan MC, Malorni W, Man N, Mandelkow EM, Manon S, Manov I, Mao K, Mao
X, Mao Z, Marambaud P, Marazziti D, Marcel YL, Marchbank K, Marchetti P,
Marciniak SJ, Marcondes M, Mardi M, Marfe G, Marino G, Markaki M, Marten MR,
Martin SJ, Martinand-Mari C, Martinet W, Martinez-Vicente M, Masini M,
Matarrese P, Matsuo S, Matteoni R, Mayer A, Mazure NM, McConkey DJ, McConnell
MJ, McDermott C, McDonald C, McInerney GM, McKenna SL, McLaughlin B,
McLean PJ, McMaster CR, McQuibban GA, Meijer AJ, Meisler MH, Melendez A,
Melia TJ, Melino G, Mena MA, Menendez JA, Menna-Barreto RF, Menon MB,
Menzies FM, Mercer CA, Merighi A, Merry DE, Meschini S, Meyer CG, Meyer TF,
Miao CY, Miao JY, Michels PA, Michiels C, Mijaljica D, Milojkovic A, Minucci S,
Miracco C, Miranti CK, Mitroulis I, Miyazawa K, Mizushima N, Mograbi B, Mohseni S,
Molero X, Mollereau B, Mollinedo F, Momoi T, Monastyrska I, Monick MM,
Monteiro MJ, Moore MN, Mora R, Moreau K, Moreira PI, Moriyasu Y, Moscat J,
Mostowy S, Mottram JC, Motyl T, Moussa CE, Muller S, Muller S, Munger K, Munz C,
Murphy LO, Murphy ME, Musaro A, Mysorekar I, Nagata E, Nagata K, Nahimana A,
Nair U, Nakagawa T, Nakahira K, Nakano H, Nakatogawa H, Nanjundan M, Naqvi NI,
Narendra DP, Narita M, Navarro M, Nawrocki ST, Nazarko TY, Nemchenko A, Netea
MG, Neufeld TP, Ney PA, Nezis IP, Nguyen HP, Nie D, Nishino I, Nislow C, Nixon RA,
Noda T, Noegel AA, Nogalska A, Noguchi S, Notterpek L, Novak I, Nozaki T, Nukina N,
Nurnberger T, Nyfeler B, Obara K, Oberley TD, Oddo S, Ogawa M, Ohashi T,
Okamoto K, Oleinick NL, Oliver FJ, Olsen LJ, Olsson S, Opota O, Osborne TF,
Ostrander GK, Otsu K, Ou JH, Ouimet M, Overholtzer M, Ozpolat B, Paganetti P,
Pagnini U, Pallet N, Palmer GE, Palumbo C, Pan T, Panaretakis T, Pandey UB,
Papackova Z, Papassideri I, Paris I, Park J, Park OK, Parys JB, Parzych KR, Patschan S,
Patterson C, Pattingre S, Pawelek JM, Peng J, Perlmutter DH, Perrotta I, Perry G,
Pervaiz S, Peter M, Peters GJ, Petersen M, Petrovski G, Phang JM, Piacentini M,
Pierre P, Pierrefite-Carle V, Pierron G, Pinkas-Kramarski R, Piras A, Piri N, Platanias
LC, Poggeler S, Poirot M, Poletti A, Pous C, Pozuelo-Rubio M, Praetorius-Ibba M,
Prasad A, Prescott M, Priault M, Produit-Zengaffinen N, Progulske-Fox A, Proikas-
29
Cezanne T, Przedborski S, Przyklenk K, Puertollano R, Puyal J, Qian SB, Qin L, Qin ZH,
Quaggin SE, Raben N, Rabinowich H, Rabkin SW, Rahman I, Rami A, Ramm G,
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 29 of 158
Randall G, Randow F, Rao VA, Rathmell JC, Ravikumar B, Ray SK, Reed BH, Reed JC,
Reggiori F, Regnier-Vigouroux A, Reichert AS, Reiners JJ, Jr., Reiter RJ, Ren J, Revuelta
JL, Rhodes CJ, Ritis K, Rizzo E, Robbins J, Roberge M, Roca H, Roccheri MC, Rocchi S,
Rodemann HP, Rodriguez de Cordoba S, Rohrer B, Roninson IB, Rosen K, RostRoszkowska MM, Rouis M, Rouschop KM, Rovetta F, Rubin BP, Rubinsztein DC,
Ruckdeschel K, Rucker EB, 3rd, Rudich A, Rudolf E, Ruiz-Opazo N, Russo R, Rusten
TE, Ryan KM, Ryter SW, Sabatini DM, Sadoshima J, Saha T, Saitoh T, Sakagami H,
Sakai Y, Salekdeh GH, Salomoni P, Salvaterra PM, Salvesen G, Salvioli R, Sanchez AM,
Sanchez-Alcazar JA, Sanchez-Prieto R, Sandri M, Sankar U, Sansanwal P,
Santambrogio L, Saran S, Sarkar S, Sarwal M, Sasakawa C, Sasnauskiene A, Sass M,
Sato K, Sato M, Schapira AH, Scharl M, Schatzl HM, Scheper W, Schiaffino S,
Schneider C, Schneider ME, Schneider-Stock R, Schoenlein PV, Schorderet DF,
Schuller C, Schwartz GK, Scorrano L, Sealy L, Seglen PO, Segura-Aguilar J, Seiliez I,
Seleverstov O, Sell C, Seo JB, Separovic D, Setaluri V, Setoguchi T, Settembre C,
Shacka JJ, Shanmugam M, Shapiro IM, Shaulian E, Shaw RJ, Shelhamer JH, Shen HM,
Shen WC, Sheng ZH, Shi Y, Shibuya K, Shidoji Y, Shieh JJ, Shih CM, Shimada Y, Shimizu
S, Shintani T, Shirihai OS, Shore GC, Sibirny AA, Sidhu SB, Sikorska B, Silva-Zacarin EC,
Simmons A, Simon AK, Simon HU, Simone C, Simonsen A, Sinclair DA, Singh R, Sinha
D, Sinicrope FA, Sirko A, Siu PM, Sivridis E, Skop V, Skulachev VP, Slack RS, Smaili SS,
Smith DR, Soengas MS, Soldati T, Song X, Sood AK, Soong TW, Sotgia F, Spector SA,
Spies CD, Springer W, Srinivasula SM, Stefanis L, Steffan JS, Stendel R, Stenmark H,
Stephanou A, Stern ST, Sternberg C, Stork B, Stralfors P, Subauste CS, Sui X, Sulzer D,
Sun J, Sun SY, Sun ZJ, Sung JJ, Suzuki K, Suzuki T, Swanson MS, Swanton C, Sweeney
ST, Sy LK, Szabadkai G, Tabas I, Taegtmeyer H, Tafani M, Takacs-Vellai K, Takano Y,
Takegawa K, Takemura G, Takeshita F, Talbot NJ, Tan KS, Tanaka K, Tanaka K, Tang D,
Tang D, Tanida I, Tannous BA, Tavernarakis N, Taylor GS, Taylor GA, Taylor JP, Terada
LS, Terman A, Tettamanti G, Thevissen K, Thompson CB, Thorburn A, Thumm M,
Tian F, Tian Y, Tocchini-Valentini G, Tolkovsky AM, Tomino Y, Tonges L, Tooze SA,
Tournier C, Tower J, Towns R, Trajkovic V, Travassos LH, Tsai TF, Tschan MP, Tsubata T,
30
Tsung A, Turk B, Turner LS, Tyagi SC, Uchiyama Y, Ueno T, Umekawa M, UmemiyaShirafuji R, Unni VK, Vaccaro MI, Valente EM, Van den Berghe G, van der Klei IJ, van
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 30 of 158
Doorn W, van Dyk LF, van Egmond M, van Grunsven LA, Vandenabeele P,
Vandenberghe WP, Vanhorebeek I, Vaquero EC, Velasco G, Vellai T, Vicencio JM,
Vierstra RD, Vila M, Vindis C, Viola G, Viscomi MT, Voitsekhovskaja OV, von Haefen
C, Votruba M, Wada K, Wade-Martins R, Walker CL, Walsh CM, Walter J, Wan XB,
Wang A, Wang C, Wang D, Wang F, Wang F, Wang G, Wang H, Wang HG, Wang HD,
Wang J, Wang K, Wang M, Wang RC, Wang X, Wang X, Wang YJ, Wang Y, Wang Z,
Wang ZC, Wang Z, Wansink DG, Ward DM, Watada H, Waters SL, Webster P, Wei L,
Weihl CC, Weiss WA, Welford SM, Wen LP, Whitehouse CA, Whitton JL, Whitworth
AJ, Wileman T, Wiley JW, Wilkinson S, Willbold D, Williams RL, Williamson PR,
Wouters BG, Wu C, Wu DC, Wu WK, Wyttenbach A, Xavier RJ, Xi Z, Xia P, Xiao G, Xie
Z, Xie Z, Xu DZ, Xu J, Xu L, Xu X, Yamamoto A, Yamamoto A, Yamashina S, Yamashita
M, Yan X, Yanagida M, Yang DS, Yang E, Yang JM, Yang SY, Yang W, Yang WY, Yang Z,
Yao MC, Yao TP, Yeganeh B, Yen WL, Yin JJ, Yin XM, Yoo OJ, Yoon G, Yoon SY,
Yorimitsu T, Yoshikawa Y, Yoshimori T, Yoshimoto K, You HJ, Youle RJ, Younes A, Yu L,
Yu L, Yu SW, Yu WH, Yuan ZM, Yue Z, Yun CH, Yuzaki M, Zabirnyk O, Silva-Zacarin E,
Zacks D, Zacksenhaus E, Zaffaroni N, Zakeri Z, Zeh HJ, 3rd, Zeitlin SO, Zhang H, Zhang
HL, Zhang J, Zhang JP, Zhang L, Zhang L, Zhang MY, Zhang XD, Zhao M, Zhao YF, Zhao
Y, Zhao ZJ, Zheng X, Zhivotovsky B, Zhong Q, Zhou CZ, Zhu C, Zhu WG, Zhu XF, Zhu X,
Zhu Y, Zoladek T, Zong WX, Zorzano A, Zschocke J, Zuckerbraun B. Guidelines for the
use and interpretation of assays for monitoring autophagy. Autophagy 8: 445-544,
2012.
35.
Koivisto P, Kolmer M, Visakorpi T, Kallioniemi OP. Androgen receptor gene and
hormonal therapy failure of prostate cancer. Am J Pathol 152: 1-9, 1998.
36.
Kuo LJ, Yang LX. Gamma-H2AX - a novel biomarker for DNA double-strand breaks. In
Vivo 22: 305-9, 2008.
37.
Lane DJ, Mills TM, Shafie NH, Merlot AM, Saleh Moussa R, Kalinowski DS, Kovacevic
Z, Richardson DR. Expanding horizons in iron chelation and the treatment of cancer:
role of iron in the regulation of ER stress and the epithelial-mesenchymal transition.
Biochim Biophys Acta 1845: 166-81, 2014.
38.
31
Le NT, Richardson DR. The role of iron in cell cycle progression and the proliferation
of neoplastic cells. Biochim Biophys Acta 1603: 31-46, 2002.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 31 of 158
39.
Liebermann DA, Hoffman B. Myeloid differentiation (MyD)/growth arrest DNA
damage (GADD) genes in tumor suppression, immunity and inflammation.
Leukemia 16: 527-41, 2002.
40.
Liu XB, Yang F, Haile DJ. Functional consequences of ferroportin 1 mutations. Blood
Cells Mol Dis 35: 33-46, 2005.
41.
Lui GY, Kovacevic Z, Richardson V, Merlot AM, Kalinowski DS, Richardson DR.
Targeting cancer by binding iron: Dissecting cellular signaling pathways. Oncotarget
6: 18748-79, 2015.
42.
Ma Y, Hendershot LM. Delineation of a negative feedback regulatory loop that
controls protein translation during endoplasmic reticulum stress. J Biol Chem 278:
34864-73, 2003.
43.
Mancias JD, Wang X, Gygi SP, Harper JW, Kimmelman AC. Quantitative proteomics
identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature 509: 1059, 2014.
44.
Meek DW. The p53 response to DNA damage. DNA Repair (Amst) 3: 1049-56, 2004.
45.
Meyron-Holtz EG, Ghosh MC, Iwai K, LaVaute T, Brazzolotto X, Berger UV, Land W,
Ollivierre-Wilson H, Grinberg A, Love P, Rouault TA. Genetic ablations of iron
regulatory proteins 1 and 2 reveal why iron regulatory protein 2 dominates iron
homeostasis. EMBO J 23: 386-95, 2004.
46.
Mizushima N, Yoshimori T, Levine B. Methods in mammalian autophagy research.
Cell 140: 313-26, 2010.
47.
Moffat J, Grueneberg DA, Yang X, Kim SY, Kloepfer AM, Hinkle G, Piqani B,
Eisenhaure TM, Luo B, Grenier JK, Carpenter AE, Foo SY, Stewart SA, Stockwell BR,
Hacohen N, Hahn WC, Lander ES, Sabatini DM, Root DE. A lentiviral RNAi library for
human and mouse genes applied to an arrayed viral high-content screen. Cell 124:
1283-98, 2006.
48.
N'Diaye EN, Kajihara KK, Hsieh I, Morisaki H, Debnath J, Brown EJ. PLIC proteins or
ubiquilins regulate autophagy-dependent cell survival during nutrient starvation.
EMBO Rep 10: 173-9, 2009.
49.
32
Narla G, Heath KE, Reeves HL, Li D, Giono LE, Kimmelman AC, Glucksman MJ, Narla
J, Eng FJ, Chan AM, Ferrari AC, Martignetti JA, Friedman SL. KLF6, a candidate tumor
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 32 of 158
suppressor gene mutated in prostate cancer. Science 294: 2563-6, 2001.
50.
Oslowski CM, Urano F. Measuring ER stress and the unfolded protein response
using mammalian tissue culture system. Methods Enzymol 490: 71-92, 2011.
51.
Petrat F, de Groot H, Sustmann R, Rauen U. The chelatable iron pool in living cells: a
methodically defined quantity. Biol Chem 383: 489-502, 2002.
52.
Pietrangelo A. The ferroportin disease. Blood Cells Mol Dis 32: 131-8, 2004.
53.
Pinnix ZK, Miller LD, Wang W, D'Agostino R, Jr., Kute T, Willingham MC, Hatcher H,
Tesfay L, Sui G, Di X, Torti SV, Torti FM. Ferroportin and iron regulation in breast
cancer progression and prognosis. Sci Transl Med 2: 43ra56, 2010.
54.
Pullarkat V, Meng Z, Donohue C, Yamamoto VN, Tomassetti S, Bhatia R, Krishnan A,
Forman SJ, Synold TW. Iron chelators induce autophagic cell death in multiple
myeloma cells. Leuk Res 38: 988-96, 2014.
55.
Rashid HO, Yadav RK, Kim HR, Chae HJ. ER stress: Autophagy induction, inhibition
and selection. Autophagy 11: 1956-1977, 2015.
56.
Richardson DR, Ponka P. Development of iron chelators to treat iron overload
disease and their use as experimental tools to probe intracellular iron metabolism.
Am J Hematol 58: 299-305, 1998.
57.
Rodier F, Coppe JP, Patil CK, Hoeijmakers WA, Munoz DP, Raza SR, Freund A,
Campeau E, Davalos AR, Campisi J. Persistent DNA damage signalling triggers
senescence-associated inflammatory cytokine secretion. Nat Cell Biol 11: 973-9,
2009.
58.
Ross SL, Tran L, Winters A, Lee KJ, Plewa C, Foltz I, King C, Miranda LP, Allen J,
Beckman H, Cooke KS, Moody G, Sasu BJ, Nemeth E, Ganz T, Molineux G, Arvedson
TL. Molecular mechanism of hepcidin-mediated ferroportin internalization requires
ferroportin lysines, not tyrosines or JAK-STAT. Cell Metab 15: 905-17, 2012.
59.
Rubinstein M, Idelman G, Plymate SR, Narla G, Friedman SL, Werner H.
Transcriptional activation of the insulin-like growth factor I receptor gene by the
Kruppel-like factor 6 (KLF6) tumor suppressor protein: potential interactions
between KLF6 and p53. Endocrinology 145: 3769-77, 2004.
60.
33
Salama R, Sadaie M, Hoare M, Narita M. Cellular senescence and its effector
programs. Genes Dev 28: 99-114, 2014.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 33 of 158
61.
Saletta F, Suryo Rahmanto Y, Siafakas AR, Richardson DR. Cellular iron depletion and
the mechanisms involved in the iron-dependent regulation of the growth arrest and
DNA damage family of genes. J Biol Chem 286: 35396-406, 2011.
62.
Schimanski LM, Drakesmith H, Merryweather-Clarke AT, Viprakasit V, Edwards JP,
Sweetland E, Bastin JM, Cowley D, Chinthammitr Y, Robson KJ, Townsend AR. In
vitro functional analysis of human ferroportin (FPN) and hemochromatosisassociated FPN mutations. Blood 105: 4096-102, 2005.
63.
Shieh SY, Ikeda M, Taya Y, Prives C. DNA damage-induced phosphorylation of p53
alleviates inhibition by MDM2. Cell 91: 325-34, 1997.
64.
Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin 66: 7-30,
2016.
65.
Sobel RE, Sadar MD. Cell lines used in prostate cancer research: a compendium of
old and new lines--part 1. J Urol 173: 342-59, 2005.
66.
Subramaniam VN, Wallace DF, Dixon JL, Fletcher LM, Crawford DH. Ferroportin
disease due to the A77D mutation in Australia. Gut 54: 1048-9, 2005.
67.
Tai S, Sun Y, Squires JM, Zhang H, Oh WK, Liang CZ, Huang J. PC3 is a cell line
characteristic of prostatic small cell carcinoma. Prostate 71: 1668-79, 2011.
68.
Tarocchi M, Hannivoort R, Hoshida Y, Lee UE, Vetter D, Narla G, Villanueva A, Oren
M, Llovet JM, Friedman SL. Carcinogen-induced hepatic tumors in KLF6+/- mice
recapitulate aggressive human hepatocellular carcinoma associated with p53
pathway deregulation. Hepatology 54: 522-31, 2011.
69.
Tesfay L, Clausen KA, Kim JW, Hegde P, Wang X, Miller LD, Deng Z, Blanchette N,
Arvedson T, Miranti CK, Babitt JL, Lin HY, Peehl DM, Torti FM, Torti SV. Hepcidin
regulation in prostate and its disruption in prostate cancer. Cancer Res 75: 2254-63,
2015.
70.
Torti SV, Torti FM. Iron and cancer: more ore to be mined. Nat Rev Cancer 13: 34255, 2013.
71.
Uddin MN, Ito S, Nishio N, Suganya T, Isobe K. Gadd34 induces autophagy through
the suppression of the mTOR pathway during starvation. Biochem Biophys Res
34
Commun 407: 692-8, 2011.
72.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 34 of 158
Wajapeyee N, Serra RW, Zhu X, Mahalingam M, Green MR. Role for IGFBP7 in
senescence induction by BRAF. Cell 141: 746-7, 2010.
73.
Wang W, Deng Z, Hatcher H, Miller LD, Di X, Tesfay L, Sui G, D'Agostino RB, Jr., Torti
FM, Torti SV. IRP2 regulates breast tumor growth. Cancer Res 74: 497-507, 2014.
74.
Wang X, Simpson ER, Brown KA. p53: Protection against Tumor Growth beyond
Effects on Cell Cycle and Apoptosis. Cancer Res 75: 5001-7, 2015.
75.
Ward DM, Kaplan J. Ferroportin-mediated iron transport: expression and regulation.
Biochim Biophys Acta 1823: 1426-33, 2012.
76.
Welford SM, Giaccia AJ. Hypoxia and senescence: the impact of oxygenation on
tumor suppression. Mol Cancer Res 9: 538-44, 2011.
77.
Xue D, Zhou CX, Shi YB, Lu H, He XZ. Decreased expression of ferroportin in prostate
cancer. Oncol Lett 10: 913-916, 2015.
78.
Young AR, Narita M. SASP reflects senescence. EMBO Rep 10: 228-30, 2009.
79.
Yu G, He QY. ReactomePA: an R/Bioconductor package for reactome pathway
analysis and visualization. Mol Biosyst 12: 477-9, 2016.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 35 of 158
List of Abbreviations
35
AR: Androgen receptor
CREBBP: cAMP response element-binding protein binding protein
DFO: Desferoxamine, an iron chelator
E2F1: E2F transcription factor 1
EGFP: Enhanced green fluorescent protein
FPN: Ferroportin
FPN OE Cells: Cells constitutively overexpressing FPN driven by the cytomegalovirus
promoter
FPN A77D: Cells constitutively overexpressing a functionally impaired mutant FPN driven
by the cytomegalovirus promoter
GADD: Growth arrest DNA damage proteins
IRES: Internal ribosome entry site
IRP1: Iron regulatory protein 1
IRP2: Iron regulatory protein 2
KLF4: Kruppel Like Factor 4
KLF6: Kruppel-like factor 6
LCB-I: microtubule-associated protein light chain 3 beta
LCB-II: phosphatidylethanolamine-conjugated microtubule-associated protein light chain 3
beta
LIP: Labile iron pool
Luc: Luciferase
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 36 of 158
p21: cyclin-dependent kinase inhibitor 1A
36
p53: Tumor protein p53
PGK promotor: phosphoglycerate kinase promotor
PSA: Prostate specific antigen
SCNC: Small cell (neuroendocrine) carcinoma
TfR1: Transferrin receptor 1
(Tet-A77D): Cells infected with a tetracycline inducible, functionally impaired mutant FPN
(Tet-FPN): Cells infected with a tetracycline inducible FPN
(Tet-Vec): Cells infected with a tetracycline inducible vector control
WST-1: Water soluble tetrazolium Salt-1
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 37 of 158
Figure legends
37
Figure 1. FPN affects iron homeostasis in prostate cancer cells. (A) Western blot of
ferroportin (FPN), iron regulatory protein 2 (IRP2), transferrin receptor 1 (TFRC1), iron
regulatory protein 1 (IRP1), ferritin H (FTH) and β-actin (loading control) in LNCaP and PC3
cells expressing a control vector (Vec) or ferroportin overexpression vector (FPN OE). (B)
Western blot of proteins in C4-2 cells expressing doxycycline-inducible FPN (Tet-FPN). Cells
were untreated or treated with 1 µg/ml doxycycline for 12, 24, or 48 hours. GAPDH was
used as a loading control. (C) Labile iron pool (LIP) in LNCaP (Tet-FPN) and PC-3 (Tet-FPN)
cells ± 1 µg /ml doxycycline for 48 hours. Experiments were repeated at least three times.
Uncropped blots are shown in Figure S1. (*P<0.05, **P<.01)
38
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 38 of 158
Figure 2. FPN overexpression induces autophagy. (A) Western blot of LC3B-I and LC3B-II in
three independent infections (a-c) of LNCaP cells containing a control vector (Vec) or
ferroportin overexpression vector (FPN OE). (B) Western blot of LC3B-I and LC3B-II in
LNCaP cells expressing doxycycline-inducible FPN (Tet-FPN). Cells were untreated or
treated with 1 µg/ml doxycycline for 12, 24, 48, or 72 hours. (C) Western blot of LC3B-I and
LC3B-II in LNCaP and PC3 cells untreated or treated with 100 µM desferoxamine (DFO) for
12, 24, or 48 hours. (D-E) Ratio of mCherry/EGFP fluorescence intensity in cells expressing
a mCherry-EGFP-LC3B reporter as determined by flow cytometry in (D) LNCaP (Tet-FPN)
and (E) PC3 (Tet-FPN) cells ± 1 µg/ml doxycycline. Data were analyzed with the FlowJo
software (TreeStar Inc). (F) Western blot of LC3B-I and LC3B-II in C4-2 (Tet-FPN) cells
untreated or treated with 1 µg/ml doxycycline for 6, 12, 24, or 48 hours. (A-C,F) GAPDH
was used as a loading control. Experiments were repeated at least three times. Uncropped
blots are shown in Figure S3.
39
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 39 of 158
Figure 3. FPN overexpression inhibits prostate cancer cell proliferation and colony
formation. (A-B) Cell count by hemocytometer of (A) LNCaP and (B) PC3 cells expressing a
control vector (Vec) or ferroportin overexpression vector (FPN OE). Cells were plated in 6
well-plates at a density of 20,000 cells/well and counted six or seven days after seeding.
(C-D) Cell count by hemocytometer of LNCaP cells expressing (C) doxycycline-inducible FPN
(Tet-FPN) or (D) doxycycline-inducible luciferase (Tet-Luc). Cells were plated in 6 wellplates at a density of 10,000 cells/well and treated ± 1 µg/ml doxycycline for 3, 5, or 7
(LNCaP (Tet-FPN) only) days. (E) WST-1 assay of cell proliferation of LNCaP cells expressing
a control vector (Vec) or ferroportin overexpression vector (FPN OE). (F) Representative
plate and quantification of clonogenic assays for PC3 (Tet-FPN) and vector control (TetVec) cells. 300 cells were plated in 6-well plates for 12 days ± 1 µg/ml doxycycline. (G)
WST-1 assay for cell proliferation of PC3 cells expressing a control vector (Vec) or
ferroportin overexpression vector (FPN OE). (H) Cell count by hemocytometer of C4-2 (TetFPN) cells plated in 6-well plates at a density of 10,000 cells/well and treated ± 1 µg/ml
doxycycline for 3, 5, or 7 days. (I) Cell count by hemocytometer of LNCaP (Tet-FPN) cells
untreated or pre-treated with 1 µg/ml doxycycline for 2 days before doxycycline
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 40 of 158
40
withdrawal for 6 days. Cells were counted 0, 3, 5 and 7 days post doxycycline withdrawal.
Means and standard deviations are shown. Western blot demonstrates FPN protein levels
relative to GAPDH at indicated times. Uncropped blot is shown in Figure S4. Experiments
were repeated at least three times with the exception of 3I (n = 2). (*P<0.05; **P≤0.01) To
see this illustration in color, the reader is referred to the online version of this article at
www.liebertpub.com/ars.
41
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 41 of 158
Figure 4. A77D mutation compromises the inhibitory function of FPN in cell proliferation.
(A) Western blot of ferroportin in LNCaP cells expressing a control vector (Vec), ferroportin
overexpression vector (FPN), or a vector overexpressing a functionally impaired ferroportin
mutant (A77D). β-actin was used as a loading control. (B) Western blot of ferroportin in
LNCaP cells expressing doxycycline-inducible FPN (Tet-FPN) or doxycycline-inducible A77D
mutant FPN (Tet-A77D). Cells were treated ± 1 µg/ml doxycycline for 24 hours. GAPDH was
used as a loading control. (C) Detection of cell surface expression of FPN, or mutated FPN,
in LNCaP (Tet-FPN) and LNCaP (Tet-A77D) cells induced with 1 µg/ml doxycycline. (D) Cell
count by hemocytometer of LNCaP (Vec), LNCaP (FPN OE), and LNCaP (A77D OE) cells at 7
days. Experiments were repeated at least three times. Uncropped blots are shown in
Figure S4. (*P<0.05; **P≤0.01; ***P≤0.001) To see this illustration in color, the reader is
referred to the online version of this article at www.liebertpub.com/ars.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 42 of 158
42
Figure 5. FPN overexpression inhibits cell cycle progression. (A) LNCaP, (B) C4-2, and (C)
PC3 cells expressing doxycycline-inducible FPN (Tet-FPN) were treated ± 1 µg/ml
doxycycline for 48 hours and stained with propidium iodide. DNA content was assessed by
flow cytometry and cell cycle distribution was analyzed by ModFit LT software. (D) BrdU
incorporation assay for LNCaP (Tet-FPN) cells treated ± 1 µg/ml doxycycline. Experiments
were repeated at least three times. (*P<0.05; **P≤0.01) To see this illustration in color, the
reader is referred to the online version of this article at www.liebertpub.com/ars.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 43 of 158
43
Figure 6. FPN induces p21 and inhibits expression of cyclin genes. (A) Western blot of p53
and p21 in LNCaP cells expressing a control vector (Vec) or ferroportin overexpression
vector (FPN OE). GAPDH was used as a loading control. (B) RT-qPCR of p21 mRNA
transcripts in LNCaP (Vec and FPN OE) cells. (C) Western blot of p21 in C4-2 cells
expressing doxycycline-inducible FPN (Tet-FPN) cells untreated or treated with 1 µg/ml
doxycycline for 6, 12, 24, or 48 hours. (D, E) RT-qPCR of cyclin genes in (D) LNCaP (Vec and
FPN OE) cells 3 days after infection and (E) C4-2 (Tet-FPN) cells treated ± 1 µg/ml
doxycycline for 48 hours. Experiments were repeated at least three times. Uncropped
blots are shown in Figure S5. (*P<0.05; **P≤0.01).
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 44 of 158
44
Figure 7. KLF6-dependent induction of p21 and downregulation of cyclin genes by FPN in
PC3 cells. (A) RT-qPCR of p21, cyclin A1, and cyclin B1 in PC3 cells expressing a control
vector (Vec) or ferroportin overexpression vector (FPN OE). (B) RT-qPCR and western blots
of KLF6 in PC3 (Vec and FPN OE) cells as well as PC3 cells expressing doxycycline-inducible
FPN (Tet-FPN). (C) RT-qPCR of p21 in PC3 (Vec and FPN OE) cells in the presence of either
KLF6 knockdown or scrambled shRNA control. (A-C) Cells were analyzed three days after
infection. Experiments were repeated at least three times. Uncropped blots are shown in
Figure S8. (**P≤0.01; ***P≤0.001)
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 45 of 158
45
Figure 8. FPN induces GADD genes and DNA damage. (A-E) RT-qPCR of (A) GADD45A, (B)
GADD45B, (C) GADD45G, (D) GADD34, and (E) GADD153 in LNCaP, C4-2, and PC3 cells
expressing doxycycline-inducible FPN (Tet-FPN) treated ± 1 µg/ml doxycycline for 72 hours.
(F) C4-2 (Tet-FPN) cells were treated ± 1 µg/ml doxycycline for 72 hours or treated with 10
µM cisplatin for 24 hours as a positive control. Cells were stained with antibody to γH2AX
and DAPI. Left: representative images are shown. Scale bar = 10 µm. Right: Nuclei with
greater than 5 γH2AX foci were counted. Experiments were repeated at least three times.
(**P≤0.01; ***P≤0.001)
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 46 of 158
46
Figure 9. FPN overexpression regulates both diverse and converging pathways. Venn
diagram depicting the number of differentially expressed Reactome Pathways in LNCaP
(Tet-FPN), C4-2 (Tet-FPN), and PC3 (Tet-FPN) cells following 48 hours of FPN
overexpression (1 µg/ml doxycycline). Common pathways differentially expressed in all
three cells are shown. See Table S2 for details of other differentially expressed pathways.
To see this illustration in color, the reader is referred to the online version of this article at
www.liebertpub.com/ars.
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 47 of 158
47
Figure 10. FPN inhibits growth of C4-2 tumor xenografts in vivo. (A) Bioluminescence of
tumor xenografts formed from C4-2 cells expressing luciferase and doxycycline-inducible
FPN (C4-2/luc Tet-FPN) before treatment (measured 2 days after cell inoculation). (B)
Bioluminescence of C4-2/luc (Tet-FPN) xenografts in mice treated with and without
doxycycline for 13 and 20 days. (C) Tumor volume calculated from caliper measurements
in mice treated with and without doxycycline for up to 27 days. Data are presented as
mean ± standard error of mean (SEM) (n=12) and significant differences are indicated.
Experiment was conducted once. (NS, p>0.05; *P<0.05; **P≤0.01).
48
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 48 of 158
Figure 11. Mechanistic Model of FPN-mediated Induction of Cell Cycle Arrest and
Autophagy. Ferroportin (FPN) was overexpressed in biologically diverse prostate cancer
cell lines. Cells with functional p53 activate different mechanisms (shown in dotted lines)
than cells lacking functional p53 (shown in dashed lines). Despite differing mechanisms,
the effects of FPN overexpression in these cells converge (shown in solid lines), resulting in
autophagy and cell cycle arrest. FPN overexpression in prostate cancer cells causes
intracellular iron depletion. Subsequently, iron depletion results in DNA damage and cell
cycle arrest in part by repression of cyclin genes (Cyclin A1, Cyclin B1; Cyclin D1 is also
repressed in C4-2 and LNCaP cells) and activation of GADD genes (GADD45A GADD45B,
and GADD45G). FPN overexpression also causes cell cycle arrest through induction of p21
by p53, or KLF6 in cells lacking functional p53. FPN-mediated iron depletion induces
autophagy and upregulation of ATF4, GADD34 and GADD153, possibly by causing
endoplasmic reticulum (ER) stress. To see this illustration in color, the reader is referred to
the online version of this article at www.liebertpub.com/ars.
49
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 49 of 158
Table 1
List of differentially Expressed Genes following Vec overexpression in LNCaP (TetVec) cells
Gene Symbol
Entrez ID
Log Fold Change
FDR
CHAC1
79094
1.840386667
2.18E-07
TM4SF1
4071
-1.06327 0.001212574
UGT2B15
7366
-1.125523333 0.001212574
CLIC4
25932
0.925516667 0.001827335
SLC7A11
23657
0.876753333 0.002677208
OR7E108P
81363
1.57204 0.004665167
ADAM9
8754
1.050986667 0.005984861
BEST1
7439
1.062816667 0.006004871
P4HA1
5033
-0.86068 0.010480878
RXRB
6257
0.802453 0.010480878
SLC25A36
55186
0.823796667 0.010480878
CRACR2A
84766
-0.807208333 0.011965365
EXO1
9156
-0.732916667 0.017360481
TES
26136
0.68152
0.02064242
GAA
2548
0.730717333 0.021190847
LTF
4057
0.899720667 0.021190847
C5orf49
134121
-1.129336333 0.021190847
LOC102724467
102724467
0.886446667 0.021190847
UGT2B17
7367
-0.896776667 0.026123616
STC2
8614
0.775396667 0.026123616
LOC101928259
101928259
0.880338667 0.026123616
PCK2
5106
1.149286
0.02830432
SLC6A9
6536
0.918473333 0.028748911
TTLL1
25809
0.783798 0.031174444
PSAT1
29968
0.57653 0.039243452
SLC39A8
64116
-0.701203333 0.039449429
TSPAN31
6302
0.651256667 0.041103024
HSPH1
10808
-0.619093333 0.043516024
ULBP1
80329
0.782566667 0.046166155
SIGLEC6
946
-0.789008333 0.048986966
CHAC1
79094
2.362693333
8.69E-10
PLOD2
5352
3.056016333
8.69E-10
SLC40A1
30061
3.045188667
2.35E-08
ALDOC
230
1.724206667
4.41E-08
PDK1
5163
1.341433333
8.83E-07
BEST1
7439
1.544444
1.36E-05
SLC7A11
23657
1.12465
2.59E-05
UGT2B15
7366
-1.280716667
3.47E-05
DDIT4
54541
1.365473333
6.73E-05
NDUFA4L2
56901
1.860117333
6.73E-05
GPT2
84706
1.254470333
7.70E-05
50
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 50 of 158
SLC7A5
STC1
VEGFA
UGT2B17
ANKZF1
BNIP3
PFKP
STC2
MIR3189
FAM72C
GDF15
SLC6A9
HIST1H2BM
ACAT2
HSPH1
RNF187
PCK2
VLDLR-AS1
ASPM
ATF3
CLIC4
DYNLL1
MELK
PGK1
TM4SF1
PSAT1
RBL1
SUV39H2
ACTRT3
NOP58
SLC39A8
BHLHE40
MAP1B
PCNA
WDR74
RPS6KA2
TRIB3
CDKN3
CTH
PIAS2
SHCBP1
LRRC8D
MRPL18
NUSAP1
ALDH2
8140
6781
7422
7367
55139
664
5214
8614
100422943
554282
9518
6536
8342
39
10808
149603
5106
401491
259266
467
25932
8655
9833
5230
4071
29968
5933
79723
84517
51602
64116
8553
4131
5111
54663
6196
57761
1033
1491
9063
79801
55144
29074
51203
217
1.303986333
1.564029667
1.029773333
-1.23309
0.94308
0.914953333
0.980896667
0.995796667
1.587720333
-0.909163333
1.22215
1.147016667
-0.901073333
-0.861956667
-0.781743333
0.968356667
1.322059
1.519416667
-0.840061
0.965070333
0.770393333
-0.686466667
-0.815846667
0.74461
-0.84607
0.66499
-0.856166667
-0.882468667
-0.974357667
-0.617266667
-0.76972
1.42684
0.772433333
-0.77386
-0.90459
0.936948333
1.092806667
-0.852563333
0.731223
0.663873333
-0.664306667
0.729543333
-0.8259
-0.612036667
0.776059667
0.000138
0.000181
0.000181
0.000304
0.000714
0.000714
0.000714
0.000726
0.000972
0.001183
0.001183
0.001183
0.001421
0.001766
0.001831
0.002342
0.003145
0.003298
0.003636
0.003636
0.003636
0.003636
0.003636
0.003636
0.003636
0.003814
0.004062
0.004283
0.004454
0.004865
0.007092
0.007185
0.007185
0.007185
0.007185
0.008046
0.009476
0.010117
0.012544
0.012544
0.012544
0.014267
0.014267
0.015102
0.016189
51
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 51 of 158
POLR3G
CARS
CHCHD4
STYX
ULBP1
SPDL1
PTTG1
IKZF2
BNIP3L
GOLGA8B
EFHC2
LOC102724467
APOBEC1
FAM72D
ITGA7
MIR8057
CACYBP
BRIX1
FOXN2
SKP2
TES
TFF1
NDRG1
RIMKLA
YARS
FBXO43
UHRF1
CCNB2
COL4A3BP
DEPDC1
CCNA2
BRCA2
ANAPC1
ATAD2
CDK1
CENPE
CHORDC1
CSF1R
DNAJC19
LTF
MTHFD2
PAK1IP1
SLC25A36
VLDLR
PPP2R3C
10622
833
131474
6815
80329
54908
9232
22807
665
440270
80258
102724467
339
728833
3679
102466874
27101
55299
3344
6502
26136
7031
10397
284716
8565
286151
29128
9133
10087
55635
890
675
64682
29028
983
1062
26973
1436
131118
4057
10797
55003
55186
7436
55012
-0.770513
0.771596667
-0.570136667
-0.695696667
0.790297
-0.634006667
-0.66193
-0.734570667
0.58172
0.711349333
-0.950642
0.790133
0.849436
-0.73935
-0.558840333
-1.067815667
-0.646023333
-0.562063333
-0.647923
-0.56292
0.5762
-0.715204
1.144328333
0.631290333
0.752963333
-0.760220333
-0.644889667
-0.775706667
-0.671293333
-0.672416667
-0.52353
-0.76258
-0.647623333
-0.641203333
-0.634823333
-0.67542
-0.571736667
-0.665442
-0.659096667
0.741121
0.58678
-0.547336667
0.6189
1.066757
-0.826646
0.016189
0.01622
0.01622
0.019402
0.019402
0.019859
0.020376
0.020689
0.023349
0.023349
0.02482
0.02482
0.027364
0.027364
0.027364
0.027423
0.029306
0.032832
0.032832
0.032832
0.032832
0.034119
0.034142
0.036091
0.036707
0.039758
0.039758
0.040276
0.040276
0.040276
0.040564
0.04107
0.041156
0.041156
0.041156
0.041156
0.041156
0.041156
0.041156
0.041156
0.041156
0.041156
0.041156
0.041156
0.041332
52
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 52 of 158
UBE2T
GPR37
MED19
RNF168
FAM177B
CEBPZ
EIF4EBP1
MIR548W
WNK3
METTL8
CIART
ADAM9
LOC151760
SLC40A1
PLOD2
FAXDC2
STC1
MAP1B
GBE1
P3H2
GPNMB
SERPINB5
ALDOC
S100A10
YPEL3
GDF15
BEST1
CEACAM1
TP53I3
LDLRAD1
MMP13
TCP11L2
APOD
VIM
INSIG2
LINC01164
RORA
ZMAT3
TNFRSF10D
CDKN1A
GBP2
SH3D21
ZNF812P
CIART
HTR5A
29089
2861
219541
165918
400823
10153
1978
100422923
65267
79828
148523
8754
151760
30061
5352
10826
6781
4131
2632
55214
10457
5268
230
6281
83719
9518
7439
634
9540
388633
4322
255394
347
7431
51141
399827
6095
64393
8793
1026
2634
79729
729648
148523
3361
-0.57423
-0.912768
-0.64591
-0.568946667
0.86429
-0.61726
0.62671
0.763794667
-0.658764333
-0.561386667
0.666529
0.727173333
6.164431667
5.46877
4.477086667
5.349162
4.419680667
2.806376667
2.797068
3.031968667
3.505871333
3.835940667
2.38183
2.269631
2.916451
3.105206667
2.788401
3.419593333
2.714128667
2.792742333
3.588894
2.564447667
2.546252
1.952794333
2.21299
3.151733667
3.003830667
2.361973667
2.424396667
3.37039
2.47487
2.315237333
2.468943333
2.086250333
2.110359333
0.041332
0.041747
0.041747
0.041747
0.043962
0.044581
0.044795
0.045273
0.045273
0.045329
0.045774
0.048311
5.88E-14
8.41E-14
1.13E-13
1.16E-13
2.71E-13
9.67E-13
2.02E-12
2.67E-12
4.54E-12
8.46E-12
1.53E-11
1.94E-11
1.94E-11
2.71E-11
2.81E-11
3.81E-11
6.40E-11
9.04E-11
9.14E-11
9.50E-11
1.51E-10
1.51E-10
1.85E-10
1.85E-10
2.35E-10
3.05E-10
3.08E-10
4.84E-10
5.15E-10
5.25E-10
5.25E-10
6.14E-10
7.03E-10
53
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 53 of 158
MIR3189
AURKA
NADSYN1
RRM2B
SULF2
HIST2H3A
HHAT
SFXN3
TP53INP1
FAM72C
FAM83D
COLCA1
CREBRF
SIPA1L2
BNIP3L
GOLGA8B
NOS3
PIAS2
BLNK
TMEM45A
FAM177B
FAM72A
PLK1
ANKRA2
CECR1
P4HA1
ATF3
PTTG1
ANKZF1
CYB5R2
LMNB1
FOXM1
LINC01021
UBE2S
KPNA2
SHCBP1
GADD45A
KIF20A
SLC25A36
RNF19B
VEGFA
FAM72B
FAM72D
HIST1H2AB
KLHL24
100422943
6790
55191
50484
55959
333932
55733
81855
94241
554282
81610
399948
153222
57568
665
440270
4846
9063
29760
55076
400823
729533
5347
57763
51816
5033
467
9232
55139
51700
4001
2305
643401
27338
3838
79801
1647
10112
55186
127544
7422
653820
728833
8335
54800
3.219037333
-1.852346667
1.993133333
1.76461
2.640005333
-2.267086667
2.517398333
2.359343333
1.805463333
-1.816136667
-1.725226667
1.960890333
2.145599667
2.446453
1.48604
1.815652333
2.532790667
1.569323333
2.459272
2.252996667
2.356298667
-1.771533333
-1.461216667
1.976321333
2.196371667
1.741986667
1.944583667
-1.575316667
1.62403
1.845135333
-1.32857
-1.701346667
2.247915667
-2.049859
-1.30558
-1.450326667
2.081475667
-1.969146667
1.557913333
1.647870333
1.516696667
-1.732693333
-1.709033333
-2.300728667
1.729678667
9.27E-10
1.06E-09
1.06E-09
1.15E-09
1.24E-09
1.40E-09
1.44E-09
1.44E-09
1.44E-09
1.56E-09
2.19E-09
2.39E-09
2.78E-09
2.92E-09
3.36E-09
3.36E-09
3.36E-09
3.85E-09
4.13E-09
4.13E-09
5.53E-09
5.91E-09
6.22E-09
6.45E-09
6.45E-09
6.45E-09
6.85E-09
8.63E-09
8.79E-09
8.92E-09
1.28E-08
1.37E-08
1.38E-08
1.47E-08
1.51E-08
1.51E-08
1.66E-08
1.69E-08
1.69E-08
1.96E-08
2.26E-08
2.30E-08
2.42E-08
2.42E-08
2.42E-08
54
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 54 of 158
MCM3
NDC80
HIST1H2BM
CDC20
TACC3
TK1
CCNA2
CENPF
TNFSF15
ERO1A
HIST1H2AJ
CHAC1
NCAPD2
HIST1H2AI
NDRG1
EXO1
HJURP
HIST1H3B
PDK1
FEN1
P4HA2
TES
RANBP1
NUSAP1
HSD17B11
HBP1
ZWINT
HIST1H1B
ELOVL6
RIT1
CA5B
RB1CC1
AURKB
UBE2C
XPC
PCNXL2
H2AFX
MCM7
PGM1
TTLL3
MXI1
PTPRM
BHLHE40
MFSD6
PRC1
4172
10403
8342
991
10460
7083
890
1063
9966
30001
8331
79094
9918
8329
10397
9156
55355
8358
5163
2237
8974
26136
5902
51203
51170
26959
11130
3009
79071
6016
11238
9821
9212
11065
7508
80003
3014
4176
5236
26140
4601
5797
8553
54842
9055
-1.423433333
-1.542093333
-1.518146667
-1.910346667
-1.610406
-1.363816667
-1.212163333
-1.227843333
2.080368333
1.41475
-1.346513333
1.551583333
-1.374666667
-1.306113333
2.483750667
-1.31123
-1.197736667
-1.77121
1.272063333
-1.394276667
1.638668667
1.221363333
-1.16861
-1.182066667
1.958637667
1.472323333
-1.49039
-1.709856667
-1.534942667
1.579564
1.413096667
1.258466667
-1.340467
-1.366012667
1.21909
1.505216
-1.236086667
-1.155983333
1.416188
1.560068333
1.32391
1.414323333
2.427656667
1.929097667
-1.333773333
2.58E-08
3.44E-08
3.72E-08
4.29E-08
4.72E-08
4.72E-08
5.78E-08
5.78E-08
5.78E-08
6.31E-08
7.63E-08
7.68E-08
8.73E-08
8.87E-08
1.21E-07
1.23E-07
1.25E-07
1.30E-07
1.30E-07
1.33E-07
1.52E-07
1.58E-07
1.63E-07
1.68E-07
1.76E-07
1.89E-07
1.89E-07
2.03E-07
2.36E-07
2.36E-07
2.54E-07
2.59E-07
2.70E-07
2.70E-07
2.77E-07
2.79E-07
3.58E-07
3.58E-07
3.85E-07
3.85E-07
4.04E-07
4.10E-07
4.19E-07
4.34E-07
4.69E-07
55
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 55 of 158
RNASEH2A
CCNB1
MYL9
SERPINE2
CLIC4
EBP
HTR5A-AS1
TCAF2
PPFIBP1
TMEM2
WSB1
PFKP
TTK
LOC101927501
ZNF841
HIST2H2BF
SLC25A10
DBF4
BUB1B
CKS2
TMSB4X
ANK1
SLC7A11
DCTPP1
KDM3A
RIOK3
C4orf3
NEK2
PLK2
IMP4
HIST1H1E
DSP
HIST1H3I
SLC25A27
HIST1H2AG
SMARCD2
CKAP2L
TYMS
CTH
DUSP1
CCDC60
TRIM14
GINS2
FAS
GAB1
10535
891
10398
5270
25932
10682
100128264
285966
8496
23670
26118
5214
7272
101927501
284371
440689
1468
10926
701
1164
7114
286
23657
79077
55818
8780
401152
4751
10769
92856
3008
1832
8354
9481
8969
6603
150468
7298
1491
1843
160777
9830
51659
355
2549
-1.275556667
-1.559673333
2.061011333
2.181395333
1.197523333
-1.11832
1.983826
1.639264333
1.171433333
1.728888667
2.472086
1.306586667
-1.31206
2.663466333
1.300369
-1.068583333
-1.364786667
-1.287936667
-1.24509
-1.335123333
1.995256667
1.756262
1.147883333
-1.350876667
1.727586667
1.579423333
1.61896
-1.199803333
1.725997667
-1.731438667
-1.176616667
1.166536667
-1.71905
1.510516
-1.33389
-1.021963333
-1.23633
-0.95438
1.20895
1.605468333
1.676657667
-1.068392333
-1.121695667
1.374524333
1.319894667
4.72E-07
5.19E-07
5.36E-07
5.57E-07
6.05E-07
6.15E-07
6.17E-07
6.17E-07
6.19E-07
6.19E-07
6.19E-07
6.33E-07
6.33E-07
6.64E-07
7.15E-07
7.26E-07
7.28E-07
7.61E-07
8.23E-07
8.23E-07
8.28E-07
8.54E-07
8.54E-07
8.64E-07
8.67E-07
8.67E-07
8.83E-07
9.36E-07
9.36E-07
9.90E-07
9.94E-07
1.09E-06
1.09E-06
1.09E-06
1.16E-06
1.21E-06
1.27E-06
1.33E-06
1.38E-06
1.38E-06
1.39E-06
1.39E-06
1.48E-06
1.51E-06
1.53E-06
56
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 56 of 158
GBP1
PGK1
GLIPR1
HIST2H2AB
UHRF1
COA7
SLC29A1
MFGE8
SESN1
TMEM140
CEL
POLD2
TOP2A
SEC61G
AGT
MDM2
C3orf58
PNRC1
LOC284930
BNIP3
HIF1A-AS2
CDCA2
FBXL19-AS1
SKP2
GPR87
PCMTD1
GABARAPL1
RACGAP1
A2MP1
DLGAP5
PARPBP
PRMT1
RRAGC
GAS2L3
NUF2
ZNF432
KIF11
GOLGA8N
BTG2
CENPE
LPAR3
NMNAT2
SSRP1
DQX1
LY6E
2633
5230
11010
317772
29128
65260
2030
4240
27244
55281
1056
5425
7153
23480
183
4193
205428
10957
284930
664
100750247
157313
283932
6502
53836
115294
23710
29127
3
9787
55010
3276
64121
283431
83540
9668
3832
643699
7832
1062
23566
23057
6749
165545
4061
1.973181333
1.07796
1.862197667
-1.389043333
-1.194031333
-1.115386667
-1.439813333
1.384150333
1.504578
1.428726667
1.828506
-1.0354
-1.31165
0.98933
1.835984333
1.205386667
1.621477667
1.35035
1.317063
1.10456
1.840530333
-1.451136667
2.241753
-0.97576
1.828562
1.136253333
1.89523
-1.132066667
1.436770667
-1.380723333
-1.140906667
-0.94495
1.00887
-1.127646667
-1.267763333
1.393461333
-1.21775
1.753131
1.552481333
-1.1956
1.140113333
1.341013
-1.152913333
1.466482
-1.267136667
1.68E-06
1.75E-06
1.76E-06
1.77E-06
1.78E-06
1.83E-06
1.93E-06
2.13E-06
2.16E-06
2.16E-06
2.25E-06
2.34E-06
2.36E-06
2.38E-06
2.55E-06
2.56E-06
2.65E-06
2.66E-06
2.72E-06
2.77E-06
2.80E-06
2.94E-06
2.99E-06
3.37E-06
3.50E-06
3.53E-06
3.77E-06
3.87E-06
3.88E-06
3.88E-06
3.88E-06
3.88E-06
3.91E-06
4.00E-06
4.00E-06
4.00E-06
4.10E-06
4.14E-06
4.17E-06
4.65E-06
4.65E-06
4.65E-06
4.65E-06
4.81E-06
4.84E-06
57
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 57 of 158
NPC1
DEPDC1
POLH
ADAM9
TBCK
TMEM241
TBC1D3L
SLFN5
UBE2T
NUP93
LOC102723769
AFF4
PGC
PHLDA1
WDR45B
HIST1H4A
HSD17B7P2
CCNB2
RFC3
EFEMP2
CHCHD4
CDC45
HIST1H2BK
LACC1
KNSTRN
CDCA5
MELK
ZKSCAN1
HIST1H4B
FUT11
HMMR
NCAPG
CELP
CYP4F23P
ASNS
HMBS
NR1D2
TBC1D3
B4GALT2
KLF7
ASPM
KIF15
HIST1H3H
MKI67
DPYSL4
4864
55635
5429
8754
93627
85019
101060376
162394
29089
9688
102723769
27125
5225
22822
56270
8359
158160
9133
5983
30008
131474
8318
85236
144811
90417
113130
9833
7586
8366
170384
3161
64151
1057
100422238
440
3145
9975
729873
8704
8609
259266
56992
8357
4288
10570
1.044036667
-1.1647
1.090742333
1.310403333
1.181174
-1.05366
1.306322333
1.225732667
-1.004353333
-1.03866
1.622423667
1.12461
1.579016667
-1.153761667
0.96711
-1.877661333
1.579937333
-1.31939
-1.124063333
1.710143667
-0.87027
-1.172687
-0.98851
1.351041333
-0.94894
-1.410331333
-1.062766667
0.967163333
-1.077342667
1.820996
-1.275553333
-1.276236667
1.761478667
1.329091333
1.28035
-1.060696333
0.87951
1.304378667
-1.126053333
1.324916667
-1.074576333
-1.090973333
-1.37122
-0.944636667
1.440326333
4.91E-06
5.12E-06
5.12E-06
5.15E-06
5.28E-06
5.28E-06
5.49E-06
5.61E-06
5.67E-06
5.72E-06
5.93E-06
6.17E-06
6.17E-06
6.17E-06
6.17E-06
6.27E-06
6.31E-06
6.39E-06
6.48E-06
6.58E-06
6.67E-06
6.78E-06
6.78E-06
7.05E-06
7.08E-06
7.13E-06
7.13E-06
7.15E-06
7.74E-06
7.77E-06
7.77E-06
8.06E-06
8.45E-06
8.97E-06
9.14E-06
9.14E-06
9.34E-06
9.37E-06
9.56E-06
9.71E-06
9.97E-06
9.97E-06
1.01E-05
1.01E-05
1.02E-05
58
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 58 of 158
DTYMK
HIST1H2BG
HIST1H2BJ
NFAT5
NUP188
TBC1D3E
FNBP1L
DEPDC1B
BAMBI
PPFIA4
ALYREF
C1orf158
CDKN3
GINS1
KIF14
GSN
GTF2IP20
NCAPH
PFAS
RSRP1
PHB
ATXN1
FAM13C
H2BFS
HIST1H4E
LOC101927391
KIF23
DDIT3
HIST1H4C
ACTA2
LYAR
MDC1
GALNT10
CCNF
GBP1P1
NUP35
RAB31
CITED2
RLF
CTSC
OPTN
LOC154761
SCNN1G
HMGB2
TMEM68
1841
8339
8970
10725
23511
102723859
54874
55789
25805
8497
10189
93190
1033
9837
9928
2934
441124
23397
5198
57035
5245
6310
220965
54145
8367
101927391
9493
1649
8364
59
55646
9656
55568
899
400759
129401
11031
10370
6018
1075
10133
154761
6340
3148
137695
-1.052117
-1.238449333
-1.51026
1.182183333
-0.917553333
1.219303333
1.008703333
-1.215052667
1.373624
1.660894333
-1.237473333
2.044735333
-1.186843333
-0.995293333
-1.121656333
1.466057
0.88835
-1.248893333
-1.21407
1.321282
-1.002833333
1.432564
1.067388333
-0.85362
-1.119233333
1.373786
-1.23568
1.489927
-0.9746
1.24673
-1.100293333
-1.463879667
1.243052333
-1.749162667
1.742141333
-1.070355333
1.380291
1.119043333
0.921336667
-1.394153333
1.251139
1.813287
1.425223667
-1.1438
0.98068
1.07E-05
1.07E-05
1.07E-05
1.07E-05
1.07E-05
1.07E-05
1.09E-05
1.10E-05
1.15E-05
1.15E-05
1.19E-05
1.20E-05
1.20E-05
1.22E-05
1.22E-05
1.23E-05
1.23E-05
1.23E-05
1.27E-05
1.32E-05
1.33E-05
1.36E-05
1.36E-05
1.36E-05
1.36E-05
1.36E-05
1.38E-05
1.42E-05
1.47E-05
1.48E-05
1.48E-05
1.54E-05
1.55E-05
1.58E-05
1.59E-05
1.59E-05
1.59E-05
1.67E-05
1.75E-05
1.76E-05
1.77E-05
1.83E-05
1.87E-05
1.89E-05
1.91E-05
59
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 59 of 158
HIST1H2BD
CCDC84
CDC14A
MOSPD1
TBXAS1
SLC27A2
LPIN2
TBC1D3H
TRIP13
TYSND1
BRIX1
CYC1
MAP3K13
MR1
PLA2G4D
ZMYM2
LGALS8
ETFB
PRMT2
ZNF337
BRI3BP
ECT2
GCC2
MAP1LC3B
MBNL2
RIC1
ATP5A1
BOLA3
RAD54L
ANKRD12
LBR
TP53INP2
CDC25A
EPPK1
HIST1H1C
HIST2H3D
TRIM22
MERTK
RPS27L
CPEB4
EFCAB10
NUPR1
SLITRK3
DDX10
CRELD2
3017
338657
8556
56180
6916
11001
9663
101060389
9319
219743
55299
1537
9175
3140
283748
7750
3964
2109
3275
26152
140707
1894
9648
81631
10150
57589
498
388962
8438
23253
3930
58476
993
83481
3006
653604
10346
10461
51065
80315
100130771
26471
22865
1662
79174
-0.922903333
1.187426667
1.068276667
1.135206667
1.380715667
-1.094983333
0.959177333
1.173504
-1.139426667
-1.049915
-0.852043333
-1.129493333
1.404438667
1.310967
1.528909667
0.933233333
0.966373333
-1.07366
1.309644333
1.054309667
-1.251703333
-1.153946667
1.138386667
1.432721333
1.547563
0.985386333
-0.848943333
-0.86588
-1.391467
1.499136
-0.89132
1.488118333
-1.493455
1.138701667
-1.808672667
-1.004233333
1.461641
1.396853
1.145876667
1.150654
1.406758
0.96724
-1.371772667
-1.062712667
-1.151234
1.92E-05
1.93E-05
1.96E-05
1.96E-05
1.96E-05
2.01E-05
2.03E-05
2.03E-05
2.04E-05
2.06E-05
2.07E-05
2.07E-05
2.08E-05
2.08E-05
2.08E-05
2.08E-05
2.09E-05
2.20E-05
2.20E-05
2.26E-05
2.27E-05
2.27E-05
2.27E-05
2.27E-05
2.32E-05
2.32E-05
2.35E-05
2.35E-05
2.35E-05
2.46E-05
2.50E-05
2.50E-05
2.53E-05
2.53E-05
2.59E-05
2.63E-05
2.64E-05
2.76E-05
2.81E-05
2.82E-05
2.84E-05
3.00E-05
3.00E-05
3.02E-05
3.05E-05
60
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 60 of 158
MIR8078
APOBEC3H
KITLG
HIST1H4J
CHEK1
OSTM1
YPEL5
MYBL2
SAT1
SMC4
ERRFI1
TMEM97
HIST1H3A
SYT11
TIMM21
FH
KIF18A
PDSS1
NARF
PPIL1
PYCRL
CHCHD10
TOE1
INCENP
LRP8
RMDN3
FTX
ZNF654
CCNG1
CDC6
NIPAL2
N4BP2L2-IT2
RNF24
HIST1H4K
PRR11
GPS1
IDH3A
EDN2
FAM198B
TMPRSS11E
LINC01347
POLR3G
APEH
CCDC86
CHEK2P2
102466878
164668
4254
8363
1111
28962
51646
4605
6303
10051
54206
27346
8350
23208
29090
2271
81930
23590
26502
51645
65263
400916
114034
3619
7804
55177
100302692
55279
900
990
79815
116828
11237
8362
55771
2873
3419
1907
51313
28983
731275
10622
327
79080
646096
1.828930667
1.459705
1.594402
-0.960676667
-1.077713333
1.103756667
1.22178
-0.925336667
1.289864333
-0.829963333
0.846016667
-1.286923333
-1.775873667
1.377006667
-0.869373333
-0.838486667
-1.069855
-1.057818
0.981833333
-0.949136667
-1.148361667
-0.96018
-0.927536667
-1.557997
-1.119070333
-0.94442
1.443720333
1.249811333
0.849673333
-1.053196667
1.1275
1.82727
0.843066667
-0.922655
-1.01187
-0.787236667
-0.91149
1.313124667
1.198731
1.057532667
1.367293333
-1.008843333
-1.07652
-1.064133667
-0.95694
3.13E-05
3.15E-05
3.16E-05
3.21E-05
3.24E-05
3.24E-05
3.24E-05
3.25E-05
3.27E-05
3.33E-05
3.40E-05
3.52E-05
3.54E-05
3.62E-05
3.64E-05
3.72E-05
3.79E-05
3.82E-05
3.85E-05
3.87E-05
3.88E-05
3.95E-05
3.95E-05
4.00E-05
4.13E-05
4.14E-05
4.16E-05
4.16E-05
4.28E-05
4.30E-05
4.39E-05
4.47E-05
4.47E-05
4.49E-05
4.50E-05
4.53E-05
4.59E-05
4.60E-05
4.79E-05
4.91E-05
4.95E-05
4.95E-05
4.98E-05
5.06E-05
5.09E-05
61
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 61 of 158
SAE1
LRP1
ID2
MLLT3
PARP1
RNF26
FN3KRP
CYP2C9
GEMIN5
LRRC59
PGAM5
PNP
UBR7
TPX2
IMPA2
SNAI2
RAB6B
ALDH2
NREP
STOML2
KDM4C
CDC25B
NBR2
PLD3
STC2
XRCC2
CBX6
ACKR3
METTL7A
TIMM13
RFC2
RABGGTA
DUSP10
YEATS2
NFE2L1
TDP1
MMP24-AS1
NCAPG2
PAK1IP1
SMAD3
TTLL7
TBCCD1
LDHB
FAM86JP
RCN3
10055
4035
3398
4300
142
79102
79672
1559
25929
55379
192111
4860
55148
22974
3613
6591
51560
217
9315
30968
23081
994
10230
23646
8614
7516
23466
57007
25840
26517
5982
5875
11221
55689
4779
55775
101410538
54892
55003
4088
79739
55171
3945
100125556
57333
-0.81026
1.386846333
1.522991
1.091663333
-0.874703333
-1.053914
-1.068118
1.386347
-0.987442
-1.038363333
-1.449325
-0.980246667
-1.080177667
-1.31907
-1.040763333
1.340136333
1.162925333
0.996172333
1.298423333
-0.86264
0.929437
-1.137105
1.101613333
0.926746667
0.951716667
-0.849823333
-0.89965
-1.093261
-0.839
-1.117846667
-1.219882
1.18869
1.226713
1.027414
0.922476667
-0.91943
1.170634
-1.084443333
-0.776616667
1.483446667
1.048363333
-1.08519
-0.681666667
-0.695023333
-0.84004
5.09E-05
5.23E-05
5.24E-05
5.29E-05
5.49E-05
5.70E-05
5.84E-05
5.90E-05
5.96E-05
5.96E-05
5.96E-05
5.96E-05
5.96E-05
6.09E-05
6.17E-05
6.22E-05
6.25E-05
6.30E-05
6.30E-05
6.33E-05
6.61E-05
6.63E-05
6.63E-05
6.74E-05
6.74E-05
6.74E-05
6.84E-05
6.87E-05
6.98E-05
7.01E-05
7.18E-05
7.28E-05
7.33E-05
7.33E-05
7.42E-05
7.53E-05
7.54E-05
7.75E-05
7.77E-05
7.93E-05
7.93E-05
8.00E-05
8.05E-05
8.20E-05
8.20E-05
62
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 62 of 158
SIGMAR1
TUBG1
POLE4
FDPS
KIF4A
C7orf49
GOLGA8O
SRM
SLC29A2
ATP5G3
ID1
CALCOCO1
VLDLR-AS1
COA1
MAD2L1
TIMM10
HIST1H2BF
HOXB13
MIR7641-1
TSHZ2
TMEM59
CLK4
RRM2
ZNF33B
SC5D
CCDC146
PSD3
STK17A
VLDLR
BVES
FASN
SERTAD1
MRPL21
BUB1
ZNF143
HLA-J
CCNDBP1
CDK1
TRMU
ARSD
HSPH1
SGOL1
EXOSC2
PRKAA2
MINPP1
10280
7283
56655
2224
24137
78996
728047
6723
3177
518
3397
57658
401491
55744
4085
26519
8343
10481
102465752
128553
9528
57396
6241
7582
6309
57639
23362
9263
7436
11149
2194
29950
219927
699
7702
3137
23582
983
55687
414
10808
151648
23404
5563
9562
-0.778076667
-0.71984
-0.80175
-0.80736
-1.287484
-0.827656667
1.390650667
-0.879693333
-0.996223333
-0.948526667
1.410666667
2.036056667
1.612445667
-0.864233333
-1.228596
-0.846193333
-1.154293333
-1.049013333
-1.105276667
1.006485667
0.844206667
0.795966667
-0.825406667
0.961313333
0.845566667
1.219901
0.97603
0.985487
1.491553667
0.991700333
-1.198083333
1.163619333
-0.940733333
-1.228766667
0.758843333
1.012931333
1.045436333
-0.877816667
-1.102073333
1.11036
-0.777163333
-1.036816667
-0.913723333
1.052405333
1.18589
8.20E-05
8.20E-05
8.28E-05
8.30E-05
8.41E-05
8.43E-05
8.43E-05
8.43E-05
8.50E-05
8.54E-05
8.63E-05
8.69E-05
8.69E-05
8.70E-05
8.70E-05
8.74E-05
8.87E-05
8.99E-05
8.99E-05
8.99E-05
9.21E-05
9.54E-05
9.54E-05
9.58E-05
9.62E-05
9.89E-05
9.92E-05
9.92E-05
9.97E-05
9.98E-05
9.98E-05
9.98E-05
0.0001
0.000101
0.000101
0.000102
0.000105
0.000105
0.000106
0.000106
0.000109
0.000111
0.000112
0.000115
0.000116
63
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 63 of 158
CENPA
MCM2
LPP
ZNF528-AS1
NACC1
PIGA
ARHGAP19
GOLGA8G
HIST1H2AE
LINC01114
SF3B3
N4BP2L2
RNF103
PTPDC1
CMSS1
KRT19
TEX261
DPH2
TSTA3
E2F8
LETM1
SH3BGRL
CYTH2
GSR
GPT2
KNOP1
ZNF737
LINC01000
POU2F3
SNRPA1
LINC01133
MCM4
MYO1E
POLE3
SLC2A1
TMEM30A
ANLN
RNASEL
SPDL1
TMEM109
GYS1
EGLN1
TTLL1
GRWD1
ECHS1
1058
4171
4026
102724105
112939
5277
84986
283768
3012
284998
23450
10443
7844
138639
84319
3880
113419
1802
7264
79733
3954
6451
9266
2936
84706
400506
100129842
402483
25833
6627
100505633
4173
4643
54107
6513
55754
54443
6041
54908
79073
2997
54583
25809
83743
1892
-1.088441667
-1.203619
0.82679
1.336661
-0.772373333
1.206976667
-1.06241
1.353859333
-1.184697667
1.25258
-0.86437
0.77594
0.99902
1.129591667
-1.024735333
1.024442333
-0.774246667
-0.998744333
-0.942733333
-1.32628
-1.010565
0.814653
0.981015667
-0.80667
0.95557
-1.000632333
0.934806667
0.772836667
1.195333667
-0.72399
1.182465
-0.989893333
1.186206333
-0.929377667
1.208913333
0.894843333
-0.78185
1.324707333
-0.774523333
-0.762516667
0.87589
0.938853333
0.917455667
-0.988003667
-0.703706667
0.000118
0.000118
0.000121
0.000121
0.000122
0.000122
0.000123
0.000123
0.000123
0.000123
0.000123
0.000125
0.000125
0.000125
0.000128
0.000129
0.000129
0.00013
0.00013
0.00013
0.000133
0.000133
0.000134
0.000136
0.000142
0.000142
0.000142
0.000143
0.000143
0.000145
0.000146
0.000146
0.000148
0.000148
0.00015
0.00015
0.00015
0.000152
0.000152
0.000155
0.000158
0.000159
0.000159
0.000161
0.000162
64
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 64 of 158
RFT1
TIMM17B
MCM5
MARC1
NEU1
SNRNP25
CDK4
NUDT9
RRS1
GAL
MTHFD1
POLQ
LINC01061
KCTD11
PCAT6
TMEM147
TBC1D8B
RFC4
AGAP3
GOLGA8Q
RAB6C-AS1
EXOC1
SERINC1
TBC1D3C
MTRR
ADAM2
ZNF610
NDUFAF4
RIMKLA
PPM1D
SLC22A23
WDHD1
ARL8B
BMP1
PGP
SCHLAP1
GSTCD
LIN9
STARD7
MNS1
CCT5
CCT7
ATP11C
GPATCH4
ZFPM2-AS1
91869
10245
4174
64757
4758
79622
1019
53343
23212
51083
4522
10721
401149
147040
100506696
10430
54885
5984
116988
727909
100131320
55763
57515
414060
4552
2515
162963
29078
284716
8493
63027
11169
55207
649
283871
101669767
79807
286826
56910
55329
22948
10574
286410
54865
102723356
-0.831204
-0.79447
-1.142273667
-0.788323333
1.036797333
-0.877529
-0.78953
0.951166333
-0.888563
-1.110707333
-0.90298
-0.901973667
1.365216667
1.454663667
1.446653
-0.917816667
1.004453333
-0.73077
-0.946073333
0.883395
0.846184333
0.711833333
0.735473333
0.986204667
-0.723736667
1.224479
0.894402667
-0.819086667
0.806703333
1.031973333
1.202782333
-0.737456667
0.761913333
0.945020333
-1.205933
0.890596667
-0.89565
-0.995617333
-0.748923333
-1.053175
-0.758473333
-0.93163
0.772036667
-0.905383333
0.957083333
0.000165
0.000165
0.000168
0.000169
0.000169
0.000169
0.000169
0.000171
0.000172
0.000176
0.000177
0.00018
0.00018
0.000181
0.000184
0.000184
0.000187
0.000188
0.000192
0.000192
0.000194
0.0002
0.0002
0.000202
0.000203
0.000205
0.000205
0.000205
0.000206
0.000209
0.000212
0.000212
0.000213
0.000216
0.000216
0.000216
0.000217
0.000217
0.000223
0.000228
0.000229
0.000229
0.000231
0.000231
0.000231
65
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 65 of 158
FNIP1
CHMP3
DRAM1
ATP5G1
MCM8
PPRC1
TPM4
KIF2C
ISCU
ZBTB21
ASAP3
SCLT1
LINC01002
AHR
FAM216A
HSPB8
CLPTM1L
ARRDC3
RHNO1
APPBP2
SLC25A12
PKP4
SKA2
GART
MIR7155
FHL2
CYCS
TCAF2P1
DPAGT1
SLC16A10
PIGW
RAD1
FIGNL1
S100P
PPIF
POLR3H
SAV1
PRPF38A
ZAK
PSMC3
PGPEP1
MTIF2
ORC1
PRIM1
CLDN12
96459
51652
55332
516
84515
23082
7171
11004
23479
49854
55616
132320
399844
196
29902
26353
81037
57561
83695
10513
8604
8502
348235
2618
102466815
2274
54205
653691
1798
117247
284098
5810
63979
6286
10105
171568
60485
84950
51776
5702
54858
4528
4998
5557
9069
0.802293333
0.691503333
1.093643333
-0.745006667
-0.71545
-0.964287333
0.78255
-1.016676667
0.74709
0.824983333
1.001572667
-0.85049
0.697116667
0.945244
-0.962761
1.183770667
-0.94406
1.002773333
-0.878223333
0.728083333
-0.910264
-0.944623333
-0.76541
-0.819056667
0.958533
1.028738667
-0.79847
1.000725667
-0.70856
-1.065274333
-0.917223333
-0.91589
-1.00177
1.018409333
-0.91645
-0.773506667
0.914354333
-0.670066667
-0.771589667
-0.6614
1.027707
-0.790556667
-0.992667333
-0.908996667
0.72086
0.000233
0.000234
0.000238
0.00024
0.00024
0.000244
0.000244
0.000247
0.000247
0.000248
0.000251
0.000258
0.000261
0.000267
0.000279
0.000279
0.000282
0.000282
0.000284
0.000287
0.000287
0.000294
0.000295
0.000296
0.000296
0.000298
0.000299
0.000301
0.000301
0.000301
0.000305
0.000305
0.000305
0.000305
0.000309
0.000317
0.000317
0.000321
0.000322
0.000327
0.000327
0.00033
0.000334
0.000339
0.000344
66
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 66 of 158
STIP1
CDCA8
IL1R1
SPC25
DDX56
FANCI
MRPL57
NPIPB5
CTBS
PMS2P9
PRMT5
UBIAD1
RDH10
DDB2
TNFRSF10B
ANGPT2
RAB17
SLC35E1
DNAJC9
SEL1L3
GPSM2
SLC22A3
RAI14
HNRNPF
NUP85
SAR1B
MRPS34
MRPS2
TBC1D30
GTSE1
TRPM2-AS
SMG1P2
LINC01001
BUB3
FRMPD2
CDCA3
GEMIN6
GPR26
RPS27P27
SLC25A19
DUSP5
USP11
KDM5B
CENPM
NPHP3
10963
55143
3554
57405
54606
55215
78988
100132247
1486
100132832
10419
29914
157506
1643
8795
285
64284
79939
23234
23231
29899
6581
26064
3185
79902
51128
65993
51116
23329
51512
101928607
440354
100133161
9184
143162
83461
79833
2849
100271585
60386
1847
8237
10765
79019
27031
-0.68604
-0.997689667
-1.018388333
-0.806717
-0.815503333
-0.783019333
-0.7023
0.962446667
0.74918
0.7117
-0.718823333
-0.734933333
1.000764333
1.420014
0.719303333
1.579631333
0.934690333
0.6853
-0.765727667
1.399543333
-1.098622333
-0.70259
-0.881773333
-0.632156667
-0.951067
0.735486667
-1.209931
-0.865296667
-1.066554
-1.103299
0.81869
1.02985
1.328053333
-0.65571
0.963850333
-1.294410667
-0.798209333
0.898562333
1.101189667
-1.2804
0.936954
0.843441333
0.770783333
-1.119566333
0.910517667
0.000344
0.000348
0.000349
0.000357
0.00036
0.00036
0.00036
0.00036
0.000375
0.000376
0.000376
0.000378
0.000378
0.000379
0.00038
0.000382
0.000382
0.000382
0.000382
0.000382
0.000383
0.000383
0.000385
0.000386
0.000386
0.000386
0.000386
0.000388
0.000388
0.000391
0.000394
0.000396
0.000396
0.000397
0.0004
0.000402
0.000403
0.000404
0.000404
0.000414
0.000415
0.000418
0.000424
0.000424
0.000424
67
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 67 of 158
CMC2
PIK3C2A
LOC101927817
ARHGAP19-SLIT1
ZNF33A
LOC729737
EFHC1
RAB5A
ARHGAP1
FAM117B
CAPN13
ELAC2
RFC5
ASF1B
RPA1
LINC00999
ACTL6A
LYN
PUF60
TLR3
LIMK2
HLA-L
APLP1
MCM6
MRPS12
METTL8
DNAJB2
NCL
UBQLN4
WIPI1
ZNF561-AS1
ISG20L2
PRPS1
PLK4
MYL12A
BIRC5
CATSPERG
SLC25A11
LOC100190986
FARSB
POLR2L
HMGN5
ZNF160
CYP4F2
SEH1L
56942
5286
101927817
100533184
7581
729737
114327
5868
392
150864
92291
60528
5985
55723
6117
399744
86
4067
22827
7098
3985
3139
333
4175
6183
79828
3300
4691
56893
55062
284385
81875
5631
10733
10627
332
57828
8402
100190986
10056
5441
79366
90338
8529
81929
-0.815326667
0.733683333
-0.734066667
-0.997803333
0.87736
1.508250333
1.141990667
0.755556667
-0.776986667
0.64593
1.159868
-0.986938667
-0.67618
-0.760046667
-0.84281
0.99676
-0.70295
-0.7779
-0.888521667
1.158139667
0.853962
0.946548
1.104034667
-0.910453333
-0.994936
-0.69444
0.908655333
-0.669343333
-0.808463333
1.079155667
0.729683333
-0.8234
-0.626326667
-0.983014667
0.780963333
-1.547405
1.156513
-0.70158
1.51212
-0.658576667
-0.741323333
-1.061037667
1.222041
0.911331333
-0.598936667
0.000429
0.000438
0.000445
0.000446
0.000448
0.00045
0.000451
0.000451
0.000462
0.000462
0.000474
0.000474
0.000474
0.000475
0.000475
0.000481
0.000488
0.000489
0.000489
0.000501
0.000506
0.000508
0.000512
0.000512
0.000514
0.00052
0.000521
0.000525
0.000525
0.000529
0.000529
0.000535
0.00054
0.000542
0.000564
0.00057
0.000571
0.000572
0.000573
0.000574
0.000576
0.000585
0.000586
0.000589
0.000589
68
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 68 of 158
RNF40
TUBGCP4
MEN1
CAMSAP2
JMJD8
FAM102A
FAT1
TMEM261
RBM14
AKTIP
HIST1H2BH
MRPL4
SEL1L
KIF22
LOC729218
RRP1
STUB1
ZNF674
CEP78
KCNK5
CREB5
ADAM20P1
TUBA1B
VPS8
CLEC2A
TPT1-AS1
KIF18B
FAM86EP
NRM
ALDH3B2
FOXD4L6
KIAA1524
BLOC1S2
COG5
ERAL1
HSD17B7
MALT1
NPM3
CTCFL
DYRK1B
NMRK1
P3H4
ZC4H2
PARD3B
LOC100506990
9810
27229
4221
23271
339123
399665
2195
90871
10432
64400
8345
51073
6400
3835
729218
8568
10273
641339
84131
8645
9586
317760
10376
23355
387836
100190939
146909
348926
11270
222
653404
57650
282991
10466
26284
51478
10892
10360
140690
9149
54981
10609
55906
117583
100506990
-0.753653333
-0.848776667
-0.991724333
0.813793333
-0.799446667
0.919036
0.875243333
-0.703446667
-1.015316667
0.78203
-0.947978667
-0.938486667
0.666463333
-1.218226667
0.935488667
-0.949270667
-0.707206667
0.879661667
-0.78548
-0.933755
1.106801
1.50335
-0.590093333
1.037563
1.001852333
0.92051
-1.007039667
-0.679593667
-0.710993333
-0.76304
0.868679
-0.84508
0.98149
0.651303333
-0.697733333
1.20085
0.68847
-1.011962
-0.729208333
0.902804667
0.809215667
-0.853437
0.901880333
1.278103
1.126271333
0.000594
0.000594
0.000596
0.000597
0.0006
0.0006
0.000601
0.000602
0.000604
0.000605
0.000605
0.000605
0.000605
0.000605
0.000618
0.000618
0.000618
0.000618
0.000622
0.000622
0.000627
0.00063
0.000633
0.000634
0.000639
0.000645
0.000654
0.000657
0.000657
0.00066
0.000663
0.000669
0.000675
0.000675
0.000682
0.000703
0.000704
0.000704
0.000708
0.000709
0.000709
0.000709
0.000709
0.000715
0.000725
69
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 69 of 158
RNASE7
PALLD
LINC01132
NUDT19
HIST1H2APS4
RBM5
ZNF528
PBK
DCLRE1B
FBXO32
ATG14
BCL2L12
NPIPA8
EMP2
LTN1
TAS2R14
MIR4659A
ZBTB40
KLHL28
ZFAND3
KCNC3
WDR5
SLC6A9
COLGALT1
LINC00589
MBLAC2
PEBP1
LRIG3
CTNNBL1
NMU
PTPRR
TUBB4B
THEM4
DNASE1
IFRD2
MANF
TMX4
POLDIP2
DST
DSG2
FAM73A
MRPS25
LINC00657
KCTD3
PARP14
84659
23022
100506810
390916
8333
10181
84436
55872
64858
114907
22863
83596
101059953
2013
26046
50840
100616348
9923
54813
60685
3748
11091
6536
79709
619351
153364
5037
121227
56259
10874
5801
10383
117145
1773
7866
7873
56255
26073
667
1829
374986
64432
647979
51133
54625
1.139495667
0.84592
0.825771667
-0.784916667
-1.359739667
0.649006667
0.77411
-1.069393333
-1.092312
1.274843667
0.79457
-0.871114
0.828393333
-0.7438
0.867815667
1.016237667
1.587902667
0.674169667
0.915480667
0.84825
0.822101
-0.723533333
0.921503333
-1.360696667
0.979679
-0.675320667
-0.611763333
-0.980326
-0.702705667
-0.925168
1.266559
-0.655366667
-0.635976667
0.839773667
-1.098012333
-0.719176667
-0.760850667
-0.66437
1.068871333
-0.70063
0.652806
-0.651736667
0.871913333
-0.800186
1.035954
0.000725
0.000731
0.000734
0.000734
0.000742
0.000749
0.00075
0.000752
0.000752
0.000759
0.000768
0.00077
0.000772
0.000772
0.000776
0.000776
0.00079
0.000791
0.000806
0.000808
0.000814
0.000814
0.000816
0.000821
0.000821
0.000821
0.000836
0.000845
0.000849
0.000851
0.000851
0.000856
0.000857
0.00086
0.00086
0.00086
0.000873
0.000893
0.000893
0.000894
0.000898
0.000905
0.000909
0.000921
0.000927
70
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 70 of 158
GTPBP2
ZNRD1
ASNSP1
PHYH
ANKRD37
NR2C2AP
BRD7
TP53TG3C
MLKL
PARP2
MBD5
ACER2
MDH2
FAM21C
NET1
FAM162A
MIR4472-2
MAD2L2
LAMA3
LSM2
NUP155
PVRL1
APOBEC3C
FANCD2
SLC12A8
SLC46A1
ALDH1B1
ISOC2
CNN2
HMCES
HIST1H2BO
PGK1P2
ACAT2
CHCHD3
IFRD1
ZNF713
XRCC3
JADE2
NPIPA5
SLC17A5
WDR63
ACYP2
DYRK2
CISD1
PLEKHA2
54676
30834
389652
5264
353322
126382
29117
653550
197259
10038
55777
340485
4191
253725
10276
26355
100616309
10459
3909
57819
9631
5818
27350
2177
84561
113235
219
79763
1265
56941
8348
5233
39
54927
3475
349075
7517
23338
100288332
26503
126820
98
8445
55847
59339
1.430143333
-0.958569667
1.076821333
0.794743333
0.78767
-0.725343
-0.67854
0.948870333
-0.806449667
-0.680489333
0.899368333
1.055176333
-0.732063333
0.573113333
-0.6667
0.773963333
0.999803333
-0.859816667
0.835616667
-0.788173333
-0.868966667
-1.028999
1.120059333
-0.677816667
-0.83246
-0.877151667
-0.823896667
-1.177731667
1.149753667
-0.885147667
-1.361082667
0.949888333
-0.695463333
-0.644296667
0.653696667
0.863741
-0.96449
-0.879196
0.826996667
0.929459333
1.162226667
1.087575667
-0.824636667
-0.648426667
1.209207667
0.000936
0.000937
0.000937
0.000938
0.00095
0.000954
0.000963
0.000965
0.000966
0.000966
0.00098
0.000983
0.000983
0.000987
0.000988
0.000991
0.000992
0.001017
0.001021
0.001021
0.001021
0.001021
0.001023
0.001023
0.001036
0.001043
0.00105
0.00105
0.001054
0.001055
0.001059
0.001075
0.001086
0.001087
0.001087
0.001087
0.001092
0.001096
0.001097
0.001099
0.001101
0.001108
0.001111
0.001118
0.001119
71
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 71 of 158
RRP9
SCPEP1
LRP10
ZNF483
JDP2
ASPA
DDX20
USP13
LSG1
AHNAK2
BAZ2B
SSBP2
PRPS2
MPV17L2
TMC4
TRIM59
IGFBP2
FBL
MYC
TUBGCP3
PLEKHB1
PLEKHG1
ACOT7
SLC35B4
MINOS1P1
RFWD3
C11orf54
SLC35E2B
HNRNPAB
SCAMP3
ORAI1
MRPL20
PYCR1
TTF2
KIF20B
SCFD2
CDC14B
FBXO22
MRPL18
RUVBL1
THAP7
B3GALT6
PAXIP1
AZGP1
RRAGD
9136
59342
26020
158399
122953
443
11218
8975
55341
113146
29994
23635
5634
84769
147798
286827
3485
2091
4609
10426
58473
57480
11332
84912
100462953
55159
28970
728661
3182
10067
84876
55052
5831
8458
9585
152579
8555
26263
29074
8607
80764
126792
22976
563
58528
-0.887862
0.686286667
1.228524333
0.830964
0.753772333
1.403884667
-0.720884
-0.712112
-0.615346667
1.062614667
1.072441333
0.804074
-0.64982
-0.92595
0.942575333
-0.74179
-0.786249
-0.641853333
-0.929166667
-0.670901
0.779073333
1.195582333
-0.736293333
-0.672466667
1.168474333
-0.71813
0.639486667
0.620956667
-0.725516667
-0.712193333
-1.006668333
-0.583753333
-0.963823333
-0.818026667
-0.807926667
-0.70196
0.779260333
0.785813333
-0.803213333
-0.83951
-0.65605
-0.723392
-0.747803333
0.86079
0.815274
0.001119
0.001119
0.001127
0.001128
0.001131
0.001134
0.001136
0.001136
0.001142
0.001143
0.001143
0.001144
0.001145
0.001145
0.00115
0.001158
0.00116
0.00116
0.001162
0.001164
0.001165
0.001165
0.001169
0.001169
0.001189
0.001189
0.001189
0.001194
0.001197
0.001203
0.001204
0.001207
0.001216
0.001223
0.001223
0.001224
0.001228
0.001246
0.001247
0.001247
0.001267
0.001271
0.001271
0.001274
0.001302
72
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 72 of 158
CYP51A1
PHPT1
CEP55
MON2
TMPO
FDX1L
WDR77
LOC400927
UQCC2
SEC22B
NKTR
ZBTB1
EIF3K
ARMCX3
NUDC
DCLRE1A
ZFYVE1
HTATSF1
CYP4F62P
DUSP4
INPP4B
LOC642846
MYEOV2
SLC35A4
TP53TG3D
HERC3
MIR5087
SNRPB
TBCEL
RNF19A
APAF1
PRRG2
PSRC1
MTX1
NPIPA1
SUMO3
FAU
BTBD10
C7orf60
AAAS
RPL7L1
ARF6
ATAD3B
ATM
NCBP2-AS2
1595
29085
55165
23041
7112
112812
79084
400927
84300
9554
4820
22890
27335
51566
10726
9937
53349
27336
646802
1846
8821
642846
150678
113829
729264
8916
100847044
6628
219899
25897
317
5639
84722
4580
9284
6612
2197
84280
154743
8086
285855
382
83858
472
152217
-0.720883333
0.643876667
-0.805057667
0.640093333
-0.779106667
-0.665656667
-0.701993333
1.045953
-0.84991
0.66684
0.770413333
0.68483
-0.564943333
1.000416333
-1.165465667
-0.804734667
0.882189333
-0.64466
0.734628333
-0.850293333
0.89162
-0.593276667
-0.839076667
-0.599556667
1.086356333
0.69343
-1.032426667
-0.931478
0.663726667
0.837618333
1.107892333
0.686599
-1.246019333
-0.709846667
0.82455
-0.798073333
-0.72639
0.710931
0.91862
-0.595403333
-0.706553333
-0.621613333
-0.924290333
0.718183333
-0.806694
0.001303
0.001304
0.001304
0.001319
0.001319
0.001338
0.001338
0.001342
0.00135
0.001351
0.001352
0.001352
0.001364
0.001365
0.001366
0.001376
0.001376
0.001376
0.001377
0.001377
0.001377
0.001377
0.001377
0.001377
0.001377
0.001379
0.001379
0.001382
0.001382
0.001386
0.001421
0.001421
0.001421
0.001422
0.001422
0.001431
0.001432
0.001436
0.001436
0.001444
0.00145
0.001456
0.001458
0.001461
0.001462
73
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 73 of 158
AP3S1
SNRPG
PSMG3
ABCA5
CYFIP2
SGOL1-AS1
PSMC3IP
DNMT1
GTF2IRD2B
TOM1
ZSWIM6
SLC25A22
FAM86C2P
EFR3A
ZNF417
PRKAR2A-AS1
KRI1
TBC1D3K
ASRGL1
TAX1BP1
FAM129A
COL6A1
NPIPA7
PHYHIPL
MEF2A
RSBN1
GNPNAT1
ZDHHC18
CCDC144A
GABRQ
FBXO5
RRP7A
PRELID1
UBL3
SDCBP
ATXN3
SAMM50
SMKR1
SCARB1
LOC100507487
NGDN
TMF1
ARHGEF37
DHODH
RBM14-RBM4
1176
6637
84262
23461
26999
100874028
29893
1786
389524
10043
57688
79751
645332
23167
147687
100506637
65095
101060351
80150
8887
116496
1291
101059938
84457
4205
54665
64841
84243
9720
55879
26271
27341
27166
5412
6386
4287
25813
100287482
949
100507487
25983
7110
389337
1723
100526737
0.59443
-0.676113333
-0.674356333
1.015705667
0.975334
-0.880631667
-0.64284
-0.792081667
0.872136667
0.833723
1.134149333
-0.964651
-0.689313333
0.70496
0.64049
0.969029
-0.595176
0.860258
-0.868775667
0.818606667
1.198879667
0.587983333
0.863453333
0.999248333
0.624593333
0.959207
-0.583526667
-0.694105
1.031909667
-0.662407
-0.971365667
-0.971389667
-0.670516667
0.768173333
0.590353333
0.823628667
-0.67229
-0.745813333
-0.681183333
1.282285
-0.784134667
0.731723333
0.78814
-0.701018333
-0.844733333
0.001463
0.001488
0.001513
0.001526
0.001526
0.00153
0.001533
0.001543
0.001543
0.001543
0.001543
0.001548
0.001559
0.001559
0.00156
0.001563
0.001564
0.001564
0.001565
0.001565
0.001581
0.001591
0.001591
0.001624
0.001628
0.001628
0.001634
0.001641
0.001641
0.001641
0.001643
0.001645
0.001649
0.001651
0.001654
0.001661
0.001671
0.001671
0.001691
0.001704
0.001707
0.001712
0.001715
0.001728
0.001728
74
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 74 of 158
PODXL2
PHYKPL
NOP14
UGT8
CKMT1A
RPS6KA2
LDLRAP1
SFXN5
NTPCR
MRPL17
COLCA2
MIS12
BAZ1B
BAIAP2L1
ICT1
DLGAP1-AS2
TIMM22
NUP50
SLC2A12
NPIPA3
SERINC2
CYB5A
KIAA0513
SUPT16H
CDCA4
PPP1R3B
SLC12A4
UBTF
SSSCA1
HN1L
KIFC1
SLC25A32
BEND4
CRISP3
UQCRC1
PKP3
STX16
DFFB
PLEKHF1
STX12
PMS2P3
NPIPB3
DHX33
MAF1
TENM1
50512
85007
8602
7368
548596
6196
26119
94097
84284
63875
120376
79003
9031
55971
3396
84777
29928
10762
154091
642778
347735
1528
9764
11198
55038
79660
6560
7343
10534
90861
3833
81034
389206
10321
7384
11187
8675
1677
79156
23673
5387
23117
56919
84232
10178
-0.691533333
1.090860667
-0.999756333
-0.877875667
-0.62249
0.833747
-0.668681667
-0.699633333
0.610584333
-0.798106667
0.856453333
-0.59924
-0.563033333
0.715123333
-0.994143667
0.701299667
-0.703776667
-0.633823333
0.761193667
0.875783333
1.070943333
-0.602733333
0.700556
-0.619843333
-0.742650333
1.078725
0.759322
-0.733985667
-0.69749
-0.695916667
-1.048896333
-0.66438
-0.912624667
-0.88386
-0.76118
-0.801446
0.75848
-0.869782667
-0.733837333
0.78002
0.623016667
0.86202
-0.772047333
-0.705063333
1.150481
0.001728
0.001734
0.001737
0.001737
0.001738
0.001738
0.001756
0.001756
0.001764
0.001769
0.001785
0.001785
0.001791
0.001798
0.001799
0.001807
0.001808
0.001808
0.001808
0.001818
0.001822
0.001822
0.001822
0.001822
0.001832
0.001832
0.001835
0.001852
0.001853
0.001859
0.001859
0.001859
0.001865
0.001877
0.001877
0.00188
0.001883
0.001883
0.001884
0.001884
0.001895
0.001897
0.001897
0.001909
0.001914
75
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 75 of 158
ZNF767P
DDX54
MIR590
CALD1
DIP2C
ITGAV
FLAD1
MRPL3
CDT1
NOP16
CHMP1B
ARHGEF39
UBR1
CHAC2
LARP1
PTDSS1
FBXW7
PDCD11
BPNT1
MIR548I3
MMACHC
USP18
CCT6A
HSP90B2P
LVCAT8
VPS13D
SDHB
CREG1
GEMIN4
IDS
SLC35E2
CRIP1
LRRC6
CLK3
FKBP4
UAP1L1
GRK6
KDM6B
NEIL3
RAB33B
RGS2
APRT
BDH1
HNRNPD
MRPS24
79970
79039
693175
800
22982
3685
80308
11222
81620
51491
57132
84904
197131
494143
23367
9791
55294
22984
10380
100302186
25974
11274
908
7190
105377586
55187
6390
8804
50628
3423
9906
1396
23639
1198
2288
91373
2870
23135
55247
83452
5997
353
622
3184
64951
0.897500333
-0.61816
0.943078667
0.567623333
0.811740333
0.728376667
-0.722336667
-0.596643333
-1.093938
-0.945016667
0.709759333
-1.253453
0.663093333
-0.870188333
-0.585556667
-0.538573333
0.974293667
-0.652053333
0.637733333
0.951868333
-0.641043333
-0.725690667
-0.621416667
-0.635036667
0.970506333
0.820002667
-0.782633333
0.628896667
-0.953119667
0.738817
0.592603333
0.746744
0.972876
0.717593333
-0.712003333
0.887506667
-0.775813
0.90089
-0.622063333
0.689159
-0.851322333
-0.803166333
-1.012883333
-0.554653333
-0.797726333
0.001919
0.001943
0.001954
0.001958
0.00196
0.001966
0.00197
0.00197
0.001985
0.002006
0.002013
0.002014
0.002014
0.002015
0.002018
0.002028
0.002054
0.002063
0.002077
0.002081
0.002087
0.00209
0.002097
0.0021
0.002101
0.002101
0.002104
0.00214
0.00214
0.00214
0.00214
0.002142
0.002153
0.002154
0.002166
0.002171
0.002189
0.002189
0.002191
0.002191
0.002191
0.002191
0.002191
0.002191
0.002191
76
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 76 of 158
DSE
SOX9
PRPF40A
MORC3
NAGA
SP140L
TAB3
ZNF473
KRT80
MNX1-AS1
TRANK1
MRPL36
MRPS17
NPIPA2
HIPK3
MEST
ERVMER34-1
BCS1L
FAM13A
NPIPB8
PRKDC
EGLN3
SENP3
C10orf2
SARS
ALPK3
SRGAP3
PDP1
TEX30
BMF
PRPF31
RPLP0P2
ZNF398
TAP1
HIST1H2BL
WDR34
PPM1G
ABCA12
ZWILCH
CCDC144CP
LMBRD1
MCAT
PCK2
ARHGAP12
DDIAS
29940
6662
55660
23515
4668
93349
257397
25888
144501
645249
9881
64979
51373
642799
10114
4232
100288413
617
10144
728734
5591
112399
26168
56652
6301
57538
9901
54704
93081
90427
26121
113157
57541
6890
8340
89891
5496
26154
55055
348254
55788
27349
5106
94134
220042
0.750889
0.678771667
-0.62048
0.744383333
-0.871368667
1.423942333
0.57605
-0.658778333
0.815553333
-0.972111667
0.983363333
-0.801646667
-0.88298
0.881103333
0.919246667
-0.675093333
-1.196093
-1.084613333
0.958064333
0.809766667
-0.593523333
1.137793
-1.054231333
-0.893779333
0.88558
0.934697333
0.851116
0.953711333
-0.942490667
0.7901
-0.677486667
1.061467
-0.672951333
0.649831
-1.271607333
-0.795604
-0.67142
1.171129667
-0.810578
0.949083
0.84286
-0.630063333
1.020464
0.775610333
-0.735716
0.002197
0.002202
0.002204
0.002207
0.002207
0.00221
0.002219
0.002233
0.002243
0.002243
0.002243
0.00227
0.002284
0.002284
0.002287
0.002288
0.002295
0.002298
0.002298
0.002309
0.002309
0.00231
0.00231
0.002316
0.002318
0.002323
0.002364
0.002368
0.002369
0.002397
0.002401
0.002406
0.002406
0.002407
0.00241
0.002434
0.002448
0.002455
0.002455
0.002455
0.002458
0.002458
0.002473
0.002473
0.002477
77
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 77 of 158
PA2G4
TSC22D1
LINC-PINT
HIST2H2AC
PPP1R14BP3
ZBTB25
EFTUD2
FAM21A
TIMM50
FUS
ANKRD20A11P
GAS6-AS1
HMG20B
SAMD8
ELAVL1
SLC39A3
AURKAIP1
WDR74
LINC01249
FAF1
ANKRD20A12P
FCHO2
MRPL46
NSFL1C
PHF20L1
SMG1P1
ALG3
DFNB31
RRP7BP
TTLL12
ZNF561
IPO5
CCT3
HMGA1
SRGAP2
COASY
RPS6KB2
MYO5B
RAP1GAP2
XRCC6BP1
CLCN3
TGFBR1
POLR1E
SYNGR2
MFN2
5036
8848
378805
8338
100507617
7597
9343
387680
92609
2521
391267
650669
10362
142891
1994
29985
54998
54663
727982
11124
100874392
115548
26589
55968
51105
641298
10195
25861
91695
23170
93134
3843
7203
3159
23380
80347
6199
4645
23108
91419
1182
7046
64425
9144
9927
-0.557503333
0.718906667
1.037201667
-0.75943
-0.662996667
0.766330667
-0.67035
0.52518
-0.65793
-0.727773333
0.732669667
1.140595333
-0.753416667
0.988750333
-0.65267
-0.755693333
-1.119698333
-0.75941
-1.029278
-0.566836667
0.894166
0.815350667
-0.794333333
-0.575783333
0.659966667
0.777374667
-0.516113333
0.860957667
-0.771823333
-0.788233333
0.598906667
-0.682996667
-0.550296667
-0.791626667
-0.672436667
-0.907366667
-0.682943333
1.009527667
-0.68931
-0.846964667
0.534343333
0.793764667
-0.644976667
-0.555026667
-0.665013333
0.002477
0.002492
0.002494
0.002528
0.002528
0.002528
0.002529
0.002532
0.002562
0.002568
0.002573
0.002573
0.002573
0.002581
0.002617
0.002621
0.002639
0.002646
0.002656
0.002658
0.002659
0.002659
0.002659
0.002659
0.002659
0.002659
0.002665
0.002665
0.002665
0.002672
0.002672
0.002695
0.0027
0.002703
0.002704
0.002707
0.002709
0.00275
0.002758
0.002758
0.002761
0.002767
0.002769
0.002771
0.002772
78
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 78 of 158
UBALD2
DARS-AS1
LSM4
SERPINA7
PABPN1
FAM173A
ZNF248
PPIE
UBE2J2
SPC24
RCBTB1
AGA
NDUFB10
TWF2
TRIM28
MND1
ORAI3
CD55
EIF3J
KIF3A
CLSPN
ITGB1P1
VARS
TTL
DRAIC
ZFYVE26
LOC100288798
FEM1C
CKS1B
MIR340
JTB
ZBTB10
CYP11A1
NDUFAF3
TANK
SET
TUBB
DLX1
POLRMT
ARHGEF2
RALGPS1
GGH
DHX30
SLBP
PREB
283991
101928243
25804
6906
8106
65990
57209
10450
118424
147841
55213
175
4716
11344
10155
84057
93129
1604
8669
11127
63967
100422691
7407
150465
145837
23503
100288798
56929
1163
442908
10899
65986
1583
25915
10010
6418
203068
1745
5442
9181
9649
8836
22907
7884
10113
-0.550897
1.490598667
-0.706116667
0.773379333
-0.614003333
-0.966173667
0.879342
-0.619023333
-0.759836667
-0.80992
0.856475
0.695725667
-0.701256667
0.726358
-0.667893333
-0.680674667
0.805839333
0.717056667
-0.60138
0.779481
-0.742374333
0.536363333
-1.093566
-0.742542
0.998235667
0.781579667
0.722605
0.615253333
-1.041556667
1.169901333
-0.631013333
0.695956667
0.743543667
-0.570386667
0.805603333
-0.530686667
-0.585596667
-0.838914667
-0.952279667
0.999283667
0.702928667
-0.886640333
-0.623633333
-0.61609
-0.770514667
0.002772
0.002802
0.002802
0.002802
0.002804
0.002804
0.002807
0.002884
0.002884
0.002886
0.002892
0.002897
0.0029
0.002909
0.002913
0.00295
0.002955
0.002958
0.00296
0.002961
0.002977
0.002977
0.002977
0.002979
0.002982
0.002985
0.002986
0.003004
0.00301
0.00301
0.003024
0.003032
0.003044
0.003044
0.003045
0.003046
0.003068
0.003069
0.003085
0.003087
0.003091
0.003104
0.003104
0.003104
0.003118
79
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 79 of 158
CTPS2
NPIPB11
OSBPL9
SUV39H1
GLB1L2
NANS
TTLL6
TACO1
SGTA
APOA1BP
NIF3L1
EXOSC7
CERS5
FOXRED2
FANCF
ALCAM
GPR63
TRA2B
LOC286437
HERPUD1
FAM86B3P
KIAA1683
SPDYA
DIEXF
ABTB2
ZFP36L1
HSD17B14
ZNF84
ANKRD1
HELLS
TBC1D23
GINS4
AK4
LAD1
TSPAN31
DHRS4-AS1
TM4SF1
BTBD9
TMTC4
CDK16
DNAH1
HNRNPC
MAB21L3
PDE4C
LOX
56474
728888
114883
6839
89944
54187
284076
51204
6449
128240
60491
23016
91012
80020
2188
214
81491
6434
286437
9709
286042
80726
245711
27042
25841
677
51171
7637
27063
3070
55773
84296
205
3898
6302
55449
4071
114781
84899
5127
25981
3183
126868
5143
4015
-0.528333333
0.813626667
0.71961
-0.972516667
-0.851016667
-0.951696667
0.817067333
-0.865408
-0.694143333
-0.569546667
-0.716237
-0.620503333
0.933896333
-0.687473333
-0.65508
0.652416667
-0.774773667
-0.539043333
1.056254667
0.579466667
-0.700762
1.158898
0.892929333
-0.572823333
0.908407
0.719806667
0.841597667
0.63683
1.064889
-0.720906667
0.582986667
-0.761327667
0.686176667
-0.954213333
0.583523333
-0.674143333
-0.64631
0.762780667
-0.765311
-0.66621
0.704190667
-0.5254
0.955142667
0.714409667
1.471992333
0.00312
0.00312
0.00312
0.00312
0.003123
0.003126
0.003129
0.003133
0.003155
0.003156
0.003159
0.003165
0.003184
0.003184
0.003188
0.003193
0.003193
0.003193
0.003196
0.003207
0.00321
0.003231
0.003236
0.003237
0.003237
0.003239
0.003241
0.003272
0.003297
0.003297
0.003311
0.003313
0.003332
0.003345
0.003357
0.00338
0.003422
0.003428
0.00347
0.003473
0.003486
0.003495
0.003506
0.00352
0.003532
80
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 80 of 158
SUCLG1
SORBS2
LOC650226
TFDP1
DNASE1L1
MSI2
TMEM54
SHOC2
HNRNPM
BCAT2
KDM4A
ARHGAP11B
CARNS1
LOC100507053
RPS3AP34
GPR107
TTC39B
TFRC
ABHD14A-ACY1
NOSTRIN
MCM10
ARHGAP11A
ARRB1
FERMT1
MRPL9
SH3KBP1
BAIAP2-AS1
PJA2
NUBP2
MRPL52
UTP4
RASSF3
VRK1
ZNF142
EIF2B5
NDUFAB1
POLD3
PITX1
HGH1
COTL1
FAM35A
IMPDH2
FARSA
SLC9A6
FUOM
8802
8470
650226
7027
1774
124540
113452
8036
4670
587
9682
89839
57571
100507053
100271260
57720
158219
7037
100526760
115677
55388
9824
408
55612
65005
30011
440465
9867
10101
122704
84916
283349
7443
7701
8893
4706
10714
5307
51236
23406
54537
3615
2193
10479
282969
-0.702423333
-0.864108667
1.064713333
-0.768956667
-0.553321667
0.632026333
-0.817893333
0.66132
-0.544903333
-0.68217
0.786563333
-0.731306667
0.679128
1.051768333
1.088220333
0.58654
1.008134
0.521056667
-0.570073333
0.78695
-0.870139333
-0.985991333
-0.64675
-0.791448333
-0.625273333
0.656458667
-0.734852
0.611303333
-0.806906667
-0.518048333
-0.616923333
-0.63314
-0.712744
-0.69118
-0.892641333
-0.533206667
-0.53363
-0.750584333
-0.849452
-0.590775333
-0.544783333
-0.591706667
-0.686813333
-0.627603333
-1.029209333
0.003542
0.003543
0.003549
0.003576
0.00358
0.003618
0.003618
0.003631
0.003638
0.003667
0.003676
0.003686
0.003686
0.003686
0.003686
0.003697
0.003697
0.003704
0.003724
0.003724
0.003761
0.003776
0.003781
0.003781
0.003795
0.003806
0.003814
0.003814
0.003848
0.003848
0.00385
0.003865
0.003884
0.003886
0.003904
0.003904
0.003926
0.00394
0.003967
0.003968
0.003975
0.004001
0.004001
0.004027
0.004038
81
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 81 of 158
RAD51AP1
LYRM7
SH3BP5-AS1
PHC1
G3BP1
LPIN3
DTNA
HIST2H2BC
EPT1
GNS
MYO5C
SLC9A1
HSP90AB1
KLF10
SENP7
PSMB3
THEM6
TIGAR
ATP6V1G2-DDX39B
BEX2
EID1
ANKRD29
SRA1
TOX3
ACOT13
CHRNA2
NPIPB9
MPDU1
CCND3
CCDC163P
ZCCHC6
MAP3K12
PTPRB
MED16
NUTM2A-AS1
MIR99A
MAPRE3
NPEPPS
MAP9
ARL6IP6
U2AF2
IQCC
GOLGA6L3
ACIN1
BRWD3
10635
90624
100505696
1911
10146
64900
1837
337873
85465
2799
55930
6548
3326
7071
57337
5691
51337
57103
100532737
84707
23741
147463
10011
27324
55856
1135
100507607
9526
896
126661
79670
7786
5787
10025
728190
407055
22924
9520
79884
151188
11338
55721
100133220
22985
254065
-0.702909667
-0.54894
1.222862333
0.797912
-0.515513333
0.733210333
0.975811667
-0.636016667
-0.749346667
0.497296667
-0.589643333
0.580024
-0.507436667
0.716198
0.759154
-0.646163333
-0.853905333
1.153643333
-0.548226667
0.858153333
-0.535186667
0.553273333
-0.740647667
-0.707843333
-0.54409
0.673507333
0.771393333
-0.526066667
-0.670548667
-0.702423333
0.622963333
1.002453333
1.037333667
-0.706413333
0.59545
1.099761
0.715923667
0.839276667
0.908603333
-0.702155333
-0.69581
-0.662147667
0.909202333
-0.671511333
0.962927667
0.004042
0.004067
0.004113
0.004191
0.004193
0.004193
0.004211
0.004211
0.004223
0.004243
0.004247
0.004247
0.004249
0.004264
0.0043
0.004303
0.004306
0.004311
0.004316
0.004316
0.004316
0.004338
0.004372
0.004383
0.004411
0.004413
0.004421
0.004422
0.004425
0.004428
0.004445
0.004464
0.00447
0.004485
0.004518
0.004519
0.004532
0.004551
0.004558
0.004559
0.004561
0.004565
0.004595
0.004627
0.004627
82
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 82 of 158
CFAP69
SENP3-EIF4A1
SFMBT1
FADS3
UGT2B17
MAP4K5
SLC10A5
DUOX1
TRAP1
UGT2B11
EEF2KMT
RRP15
LRRC26
NIP7
SLC37A4
PTPMT1
MMP12
AGO4
MAP2K6
RPL23AP82
GLA
AVL9
HINT3
SUV39H2
USP3
MFSD2A
AKAP12
MGST2
MRPL23
NPIPB6
EIF5A
MIEF2
LINC00894
SLPI
REV3L
PLXNA3
POLR2C
CAPN5
FAM111A
PROCR
ZNF584
ABCF1
RAD9A
MRPS5
ERLIN1
79846
100533955
51460
3995
7367
11183
347051
53905
10131
10720
196483
51018
389816
51388
2542
114971
4321
192670
5608
284942
2717
23080
135114
79723
9960
84879
9590
4258
102724828
728741
1984
125170
100272228
6590
5980
55558
5432
726
63901
10544
201514
23
5883
64969
10613
0.804298
-0.509943333
-0.647373333
0.736145
0.733516333
0.539643333
0.917522333
0.746691667
-0.960903333
0.976704
-0.65167
-0.61914
-0.956923333
-0.5905
-0.803158667
-0.81516
0.951287333
0.792887667
-0.849850667
0.790654667
-0.662561667
0.684636667
0.752286667
-0.659802
0.56753
-0.643061667
1.124718
-0.66526
-0.900713667
0.87084
-0.53607
0.797527333
1.012676
-0.74361
0.661164333
1.257998
-0.65963
0.881036333
0.617613333
0.649471667
-0.59528
-0.668246333
-0.740331
-0.684370333
-0.829649
0.00464
0.004663
0.004663
0.004667
0.004669
0.004679
0.004682
0.004689
0.004691
0.004692
0.004693
0.004704
0.004711
0.004711
0.004711
0.004724
0.004728
0.00474
0.004748
0.004748
0.004773
0.00478
0.00478
0.00478
0.00478
0.004788
0.004801
0.004822
0.004824
0.004824
0.004847
0.004847
0.004879
0.004883
0.004911
0.004934
0.004934
0.004939
0.00497
0.004975
0.004977
0.004979
0.004982
0.005011
0.005011
83
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 83 of 158
KIAA2026
PSMG1
TFF2
CCDC7
MBNL3
RPS6KA4
ZBTB2
ALKBH2
ANXA6
FXN
UTP20
IGFBP3
LASP1
PMVK
SPAG5
C20orf27
CSE1L
MED22
NDUFB2
SLIRP
FAM86KP
NOP58
ARL5B
ARFGEF2
CCNL2
HDDC3
OGT
RBM10
TMA7
KIF5C
NPIPB4
OR8A3P
KIAA1715
ACOX3
JAGN1
HNRNPR
SEC31A
MARS2
LOC389834
LINC00893
BYSL
FAM13B
MIR1289-1
PPP1R14B
ZNF182
158358
8624
7032
79741
55796
8986
57621
121642
309
2395
27340
3486
3927
10654
10615
54976
1434
6837
4708
81892
100287013
51602
221079
10564
81669
374659
8473
8241
51372
3800
440345
403302
80856
8310
84522
10236
22872
92935
389834
100131434
705
51306
100302125
26472
7569
0.78263
-0.860913333
0.554106667
0.564603667
-0.793881667
-0.877014667
-0.786518333
-0.659966667
-0.796933
-0.68843
-0.646406667
0.632281
0.629283667
-0.840193667
-1.045383333
-1.143322667
-0.59253
-0.793963667
-0.70403
-0.517323333
-0.579108
-0.46234
0.5635
0.654036667
0.55248
-0.638562
0.50454
-0.730776
-0.52217
0.898326333
0.628336667
0.779978333
0.625357333
0.698495667
-0.790866667
-0.538193333
0.566013333
-0.876024333
0.994043333
0.781522
-0.580983333
0.629156667
0.981134667
-0.530096667
0.637812
0.005013
0.005013
0.005013
0.005021
0.005027
0.005071
0.005071
0.005076
0.005077
0.00511
0.005124
0.005134
0.005136
0.005136
0.005178
0.005186
0.005186
0.005188
0.005199
0.005206
0.005206
0.00521
0.005229
0.005232
0.005232
0.005232
0.005232
0.005232
0.005234
0.005243
0.005243
0.005243
0.005319
0.005329
0.005335
0.005351
0.005354
0.005368
0.005379
0.005386
0.005413
0.00542
0.00542
0.005444
0.005448
84
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 84 of 158
COX10
LINC01351
FBXL20
CBX4
MRPL34
PPP2R2A
TMEM40
DCAF15
RAB11B
CBLB
TIPARP
NEK4
SPRED3
YEATS4
TUBA1C
TMC7
PLEKHA1
EDN1
VPS11
JUND
ELL3
NIPSNAP1
NAA15
ANP32A-IT1
LPXN
BLOC1S5-TXNDC5
ANGEL1
DCPS
HSPD1
MYDGF
FAM96A
CXCR2
RBBP7
FAM13A-AS1
NOL6
COX8A
PPP2R4
NABP2
EIF2B3
PPP5C
DHRS7B
LOC101929224
RBL1
UQCR10
DLAT
1352
101929120
84961
8535
64981
5520
55287
90379
9230
868
25976
6787
399473
8089
84790
79905
59338
1906
55823
3727
80237
8508
80155
80035
9404
100526836
23357
28960
3329
56005
84191
3579
5931
285512
65083
1351
5524
79035
8891
5536
25979
101929224
5933
29796
1737
-0.742107
-1.086394333
0.653556667
-0.52856
-0.69975
0.530383333
0.761591333
-0.670358
0.802743333
0.929058
0.798746
-0.606211333
0.954842
-0.702913333
-0.509896667
0.763025333
0.59477
0.916210333
0.693599
1.089741333
-0.573796333
-0.730282667
-0.556043333
0.888461
0.891068
-0.527326667
-0.747121333
-0.852968667
-0.475203333
-0.611833333
-0.582746667
0.735352
-0.56129
0.638643667
-1.059528333
-0.8517
-0.60231
-0.640406667
-0.592786667
-0.60613
-0.664789667
0.719641667
-0.61796
-0.52787
-0.769516667
0.005455
0.005455
0.00553
0.005543
0.005543
0.005548
0.005571
0.005573
0.005573
0.005574
0.005588
0.005599
0.00561
0.005627
0.00565
0.005689
0.005715
0.005717
0.005756
0.005789
0.005797
0.005802
0.005817
0.005864
0.005917
0.005925
0.005934
0.005977
0.005977
0.005977
0.005987
0.005987
0.005993
0.006002
0.006003
0.00602
0.006035
0.006059
0.006069
0.006073
0.006084
0.006101
0.006101
0.006114
0.006156
85
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 85 of 158
RQCD1
COPRS
CENPW
PRMT3
PTGES2
RASD1
DMTF1
INTS6
JMJD1C
SLC12A6
WDR81
NDUFB3
SNAR-A9
BHLHE41
POLA1
SUSD6
ZXDC
PIK3IP1-AS1
CA5BP1
PIGO
PHTF2
HMGN2P15
RRM1
FAM86B1
CCDC82
PLEKHH1
TBC1D22A
KIF21A
STIL
ANAPC5
CTGLF12P
DHCR7
LMTK2
MIR1206
SKA3
DNAJB9
SRPRB
MUL1
NPIPB15
CENPI
GOT1
NBPF17P
NDOR1
POTEI
TRIM64B
9125
55352
387103
10196
80142
51655
9988
26512
221037
9990
124997
4709
100169955
79365
5422
9766
79364
101929760
340591
84720
57157
100288165
6240
85002
79780
57475
25771
55605
6491
51433
414224
1717
22853
100302170
221150
4189
58477
79594
440348
2491
2805
401967
27158
653269
642446
-0.523743333
-0.625023333
-0.884945333
-0.617413333
-1.031174333
0.673961667
0.50738
0.66934
0.58403
0.594821
0.621818333
-0.555053333
-0.555853333
0.695201333
-0.747932
0.669651333
0.63994
0.729878
0.578306667
-0.591306667
-0.608632
-0.528313333
-0.478083333
-0.544326667
0.708926
0.739303333
0.785586333
-0.55344
-0.907123333
-0.58287
0.641126667
-0.577576667
0.702369333
1.269850333
-0.719443333
0.690802333
-0.542753333
-0.850787667
0.797173333
-0.789333333
-0.51276
0.680334667
-0.689201333
0.920128667
-0.70249
0.006156
0.006188
0.006191
0.006217
0.006217
0.006226
0.006246
0.006247
0.006247
0.006271
0.006271
0.006309
0.006321
0.006352
0.006352
0.006355
0.006355
0.006364
0.00641
0.006452
0.006456
0.00646
0.00647
0.00649
0.006498
0.006498
0.006498
0.006507
0.006519
0.006525
0.006556
0.006556
0.006556
0.006657
0.006679
0.0067
0.006741
0.006747
0.006754
0.006815
0.006815
0.006815
0.006815
0.006815
0.006815
86
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 86 of 158
DTL
GPR158
SLC25A4
ST20-MTHFS
ABCB11
FAM47A
KLK2
LOC101928468
SMIM12
LENG8
NUP88
SRSF1
TMEM223
CTSO
FAH
PCMTD1P2
TET2
LRFN1
MAPKAPK3
MICAL1
STXBP3
TROAP
CAP2
ATP1B1
TMCO3
FGFR1OP2
IP6K2
CTSK
SLC50A1
MIR548AQ
ZNF326
KCTD13
FLJ22447
KANSL1L
USP39
WDR55
LOC728554
NOL9
TUBA4A
TCEAL3
SEC24A
GADD45B
CLUH
ATP5D
SKIL
51514
57512
291
100528021
8647
158724
3817
101928468
113444
114823
4927
6426
79064
1519
2184
100287647
54790
57622
7867
64780
6814
10024
10486
481
55002
26127
51447
1513
55974
100847078
284695
253980
400221
151050
10713
54853
728554
79707
7277
85012
10802
4616
23277
513
6498
-0.731286667
0.735103333
0.54534
-0.606682333
-0.989216333
-0.710135
-0.485263333
0.760646
-0.677776667
0.570173333
-0.556023333
-0.489486667
-0.752732
0.919065667
-0.671792667
0.765896
0.751293
-0.835149667
-0.905762
0.61183
0.65334
-0.626722333
0.661596667
0.57488
0.522483333
0.708567
0.692583333
0.940550333
-0.721023333
0.796932
-0.651073333
0.765075333
1.030588333
1.09412
-0.544943333
-0.523896667
-0.490913333
-0.57351
-0.689586667
0.882000667
0.68106
0.68754
-0.755688667
-0.605876667
0.660720333
0.006826
0.006826
0.006826
0.006826
0.006831
0.006838
0.006838
0.006863
0.006918
0.006937
0.006947
0.006947
0.006947
0.00695
0.00695
0.00695
0.006964
0.006975
0.006975
0.006975
0.006975
0.006975
0.006978
0.006988
0.006988
0.007058
0.007058
0.007079
0.007155
0.00716
0.00716
0.007186
0.007204
0.007207
0.007207
0.007207
0.007217
0.007249
0.007264
0.00733
0.007352
0.007365
0.007366
0.007369
0.007369
87
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 87 of 158
LOC401320
CLDN1
MYBBP1A
CD4
CASP10
DRD5P2
KLHDC3
SLC16A14
FOXN3-AS1
PLCH1
TMEM201
POLR2E
ERGIC1
CHMP5
MIR99AHG
N4BP1
RPL23AP7
TSC22D3
PPP2R1A
OR5H7P
TTC6
VPS41
NAA38
TOMM5
LOC100288069
CAMKK2
C1QBP
WDR47
MS4A18
PRDM1
CYP4F3
BRCA2
FAM214B
TRIB2
LOC101927811
RSAD1
CLPB
CCT2
ARMC1
CDR2
NFIL3
RNF34
CAST
PCYT2
C6orf136
401320
9076
10514
920
843
1818
116138
151473
400236
23007
199953
5434
57222
51510
388815
9683
118433
1831
5518
79291
319089
27072
84316
401505
100288069
10645
708
22911
728588
639
4051
675
80256
28951
101927811
55316
81570
10576
55156
1039
4783
80196
831
5833
221545
0.735688667
0.995783
-0.722155
0.777409667
0.911612
0.711753333
-0.564706667
-0.748493333
-0.735915333
-0.574795
-0.802752333
-0.578186667
-0.503303333
0.510006667
0.5688
0.575436667
0.666066667
0.489529667
-0.867
-0.635505
0.784856667
0.590056667
-0.742835333
-0.76124
0.643252
-0.68111
-0.557456667
0.602721
0.705110333
0.918626667
0.666609667
-0.680776667
0.998079667
-0.631139333
-0.848714333
-0.687391
-0.585626667
-0.554726667
-0.595323333
-0.695428667
0.86569
-0.62353
0.52933
-0.938477
-0.861953
0.007382
0.007396
0.007421
0.007432
0.007441
0.007441
0.007441
0.007441
0.007453
0.007453
0.007486
0.00749
0.007505
0.007522
0.007522
0.007522
0.007522
0.007522
0.007558
0.00758
0.00758
0.007592
0.007604
0.007624
0.007678
0.007719
0.007724
0.007726
0.00776
0.007772
0.007779
0.007789
0.007795
0.007795
0.007826
0.007832
0.007832
0.007918
0.007931
0.00798
0.008015
0.008046
0.008058
0.00806
0.008062
88
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 88 of 158
HMOX2
NF2
COX10-AS1
KIAA0391
LINC01399
GABBR1
NSMCE2
CHRNA5
LAMP3
PLA2G16
POTEE
MRPS7
TTC7B
LOC101929516
MIR3143
SSSCA1-AS1
PSME3
USP40
HCG4
ASTN2
CHKA
EXOC4
ZDBF2
CD24
HLA-F
UFSP1
FDXR
CCDC34
TNPO2
TMEM106C
HMGN2P5
TPRG1L
CMTM4
FAM86B2
FAM64A
UBE2E3
ZNF425
LINC00265
BMPR2
TRAIP
DDX55
STX18-AS1
AKAP9
DNAJB1
AGAP7P
3163
4771
100874058
9692
104310353
2550
286053
1138
27074
11145
445582
51081
145567
101929516
100422934
254100
10197
55230
54435
23245
1119
60412
57683
100133941
3134
402682
2232
91057
30000
79022
727795
127262
146223
653333
54478
10477
155054
349114
659
10293
57696
100507266
10142
3337
653268
-0.644856667
-0.699460333
-0.663132
-0.497996667
-0.654834333
0.792358333
0.69221
-0.615066667
0.949554
0.739632667
0.949326333
-0.749903333
-0.754529333
-0.583438333
-1.158728667
0.913021667
-0.493046667
0.61908
0.635125
0.812235667
0.641443333
0.57986
0.864403333
0.787204667
0.633972667
-0.691737667
0.678957
-0.75889
-0.635426667
-0.50513
-0.48654
0.683879
-0.513833333
-0.564448
-0.779939333
-0.57268
0.773424
0.93759
0.526383333
-0.85511
-0.526637
-0.611493667
0.5431
-0.71014
0.69226
0.008072
0.008078
0.008096
0.008112
0.008112
0.008142
0.008142
0.008151
0.008159
0.008159
0.008173
0.008185
0.00819
0.008196
0.008202
0.008212
0.008224
0.008224
0.008236
0.00827
0.00827
0.00827
0.00827
0.008293
0.008293
0.008312
0.008315
0.008317
0.008386
0.008416
0.008433
0.008448
0.00845
0.008451
0.008493
0.008505
0.008505
0.008526
0.008527
0.008534
0.008542
0.008547
0.008551
0.008576
0.008592
89
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 89 of 158
PFKFB3
USP5
LOC283922
MXD3
CAMK1D
SGOL2
ZNF239
BLZF1
LINC00648
RNF2
CEACAM5
NLGN1
RSRC1
LENG8-AS1
DYNLL2
SMAD9
GPD2
ST6GALNAC1
PLEK2
TUBBP1
C11orf65
HSD17B8
ZNF708
IWS1
EIF4E
H1FX
ADSS
GOLGA8R
ADAT1
MED13
BCCIP
ID3
EIF3B
ACY1
MRPL12
ECHDC2
FBXO44
AK4P1
DAZAP1
VASH2
LOC374890
WBP2
PELP1
FAM86FP
COQ3
5209
8078
283922
83463
57118
151246
8187
8548
100506433
6045
1048
22871
51319
104355426
140735
4093
2820
55808
26499
92755
160140
7923
7562
55677
1977
8971
159
101059918
23536
9969
56647
3399
8662
95
6182
55268
93611
206
26528
79805
374890
23558
27043
653113
51805
0.911116333
-0.768783333
0.576090667
-0.634275333
0.68057
-0.663380333
-0.637742
0.563253333
0.807969333
-0.654716667
0.994150333
0.836053
-0.581213333
0.701819667
-0.650216667
0.825886333
-0.75984
-0.668461
-0.752087
-0.45804
0.753925333
-0.674962
0.710923333
-0.514346667
-0.511573333
-0.811698667
-0.571106667
0.804914333
-0.646733
0.519763333
-0.466756667
0.873888
-0.540713333
-0.836476667
-0.601447
0.507053333
0.740950333
0.744002667
-0.5876
-0.808861667
0.630512
0.54064
-0.60596
-0.4879
-0.858237667
0.008621
0.008639
0.008641
0.008705
0.008711
0.008718
0.008718
0.008735
0.008753
0.008753
0.008789
0.008789
0.008796
0.008802
0.008812
0.008812
0.008813
0.008826
0.008865
0.00887
0.008881
0.008891
0.008891
0.008891
0.008892
0.008942
0.008975
0.008999
0.009047
0.009064
0.009072
0.009091
0.00913
0.009252
0.009254
0.009276
0.009298
0.009314
0.009333
0.009367
0.009375
0.009385
0.009421
0.009559
0.009567
90
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 90 of 158
NDUFV1
INSIG1
PRSS3
PXDN
MFSD13A
NEIL1
SRP68
ARMC6
ZNF470
H2AFY
HMGCS2
PIGK
KCNQ5
EIF4G1
LOC100133331
SESN2
ARPC3
MIR548AV
SNU13
PRDX1
CFHR2
MRPS18B
UTP14A
GARNL3
POLA2
HAUS6
NUCB1-AS1
RAB39B
ZBTB39
C1orf112
FRK
FAM41C
BZW2
MEPCE
PRDX2
GOLGB1
ENOPH1
TMEM229B
CLN6
PRSS1
JUN
CENPH
MAZ
FRMPD1
UBE2M
4723
3638
5646
7837
79847
79661
6730
93436
388566
9555
3158
10026
56479
1981
100133331
83667
10094
100847083
4809
5052
3080
28973
10813
84253
23649
54801
100874085
116442
9880
55732
2444
284593
28969
56257
7001
2804
58478
161145
54982
5644
3725
64946
4150
22844
9040
-0.52134
-0.58759
0.826206
0.666133667
-0.631521
0.609039667
-0.463896667
-0.832627333
0.778277
-0.428496667
-0.891717
-0.66785
-0.771102667
-0.796436667
0.918444667
0.880327333
0.569623333
1.178721
-0.488386667
-0.44164
-0.650239333
-0.626986667
-0.682349667
0.735978
-0.819564667
-0.64964
-0.728965
0.742978333
-0.655503667
-0.641629667
0.83265
1.029163333
-0.615633333
-0.640926667
-0.496953333
0.597946667
-0.561336667
-0.588116333
-0.846140333
0.896781333
1.097657
-0.655476667
-0.626339667
0.747558
-0.556546667
0.00958
0.009598
0.009598
0.009638
0.009718
0.009718
0.009718
0.009739
0.009753
0.009755
0.009755
0.009755
0.009757
0.00977
0.009775
0.009832
0.009836
0.009836
0.00986
0.00986
0.009861
0.009861
0.009883
0.009948
0.009966
0.010009
0.010036
0.010036
0.010036
0.010104
0.010106
0.01012
0.010131
0.010163
0.010167
0.010243
0.01027
0.010323
0.010361
0.010361
0.010453
0.010463
0.010463
0.010505
0.010505
91
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 91 of 158
XRCC1
PDHB
DNAJC11
DDX19A
MRPS16
KIFAP3
NDUFA2
PMS2P1
MRPL2
RAB6A
RGS10
SYNRG
ZFP42
SLC29A4
AAK1
GLUL
AK9
CRNDE
HDGF
INTU
TAGLN2
SNRPGP2
RAB8A
PAK4
SLC25A16
AFF1
ARHGAP42
COX20
HIST1H2AH
LINC01291
PNO1
COQ10B
LPCAT3
RDH13
DYNC1I2P1
TCF20
MTA2
PABPC4
F8
C4orf47
CEP95
JMY
TRIP10
HEIH
PTPN21
7515
5162
55735
55308
51021
22920
4695
5379
51069
5870
6001
11276
132625
222962
22848
2752
221264
643911
3068
27152
8407
100130003
4218
10298
8034
4299
143872
116228
85235
102724515
56902
80219
10162
112724
728532
6942
9219
8761
2157
441054
90799
133746
9322
100859930
11099
-0.504808
-0.49993
-0.6314
-0.565814333
-0.57201
0.716947667
-0.606466667
0.543666667
-0.727139333
0.481266667
-0.525963333
0.585253333
-0.731454667
0.693290333
0.613283
0.50302
0.782818
0.799653333
-0.882637
0.572415667
-0.701116667
-0.642542333
-0.43384
-0.617923333
0.466683333
0.618926667
0.901267667
0.468906667
-0.774348
0.731294
-0.649019333
0.56693
-0.51003
-0.570654667
0.627404333
-0.545538333
-0.525353333
-0.80016
0.805135667
0.696716333
0.519028667
0.713618333
0.548493333
0.818049333
0.656875
0.010512
0.010565
0.010654
0.01066
0.01066
0.010661
0.010661
0.010662
0.010677
0.010713
0.010806
0.010806
0.010843
0.010845
0.010867
0.010877
0.010914
0.010922
0.010929
0.01097
0.01097
0.010979
0.01098
0.011109
0.011109
0.011139
0.011139
0.011139
0.011139
0.011139
0.011155
0.011205
0.011213
0.011213
0.011223
0.011281
0.011306
0.011343
0.011357
0.011402
0.011402
0.011402
0.011412
0.01143
0.011453
92
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 92 of 158
NSG1
TMEM177
LTV1
ZNF490
DEK
BCKDHA
CTD-2095E4.4
GPATCH2L
ZFAND2A
USP32
COQ9
LINC00161
MYBPC1
SPECC1L-ADORA2A
SLC7A2
IRF1
MRTO4
SLC25A5
MIR3166
RGL1
ARL6IP1
THAP4
ILF2
SYTL2
TRADD
KIAA0930
SPON2
SNORD93
CTSD
EFNB3
RMND5A
YPEL2
SH3RF1
ACSL1
UFM1
MIR409
CENPO
RRP1B
LINC00390
OSER1
ZNF267
SRGAP2C
SLCO3A1
SLC25A1
RAPSN
27065
80775
84946
57474
7913
593
100506596
55668
90637
84669
57017
118421
4604
101730217
6542
3659
51154
292
100423040
23179
23204
51078
3608
54843
8717
23313
10417
692210
1509
1949
64795
388403
57630
2180
51569
574413
79172
23076
105370183
51526
10308
653464
28232
6576
5913
0.67799
-0.735374333
-0.579423333
0.47711
-0.458656667
0.876407
0.487123333
0.625136667
0.518464667
0.74183
-0.50703
0.810951333
0.936503667
0.591223333
-0.679521333
0.747466
-0.730275333
-0.45975
0.836317
0.685629
-0.507676667
-0.562856667
-0.43289
0.746573333
0.656078333
-0.758113333
-0.570440667
-0.75717
1.087426667
0.509591
0.603353333
0.771842333
-0.574638333
0.48927
0.49642
-0.653797333
-1.047484
-0.595494667
0.915383333
0.59714
-0.540353333
-0.56705
-0.734157333
-0.803836667
0.516420667
0.011455
0.011455
0.011506
0.01153
0.011543
0.011601
0.011601
0.011601
0.011648
0.011652
0.011672
0.011672
0.011727
0.011727
0.011741
0.011747
0.011756
0.011767
0.011767
0.011767
0.0118
0.011816
0.011816
0.011834
0.011883
0.011892
0.011892
0.011941
0.011942
0.011946
0.011969
0.011989
0.012037
0.01205
0.01205
0.01208
0.012112
0.012142
0.012148
0.012152
0.012152
0.012187
0.01219
0.012198
0.012254
93
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 93 of 158
PARP3
PSORS1C3
AHSA2
GAMT
KMT5B
TAX1BP3
EZH2
WDR3
CERS4
HIST3H2BB
ZRANB1
OCIAD2
TMEM106B
FAM86C1
SIAH1
PSMD11
APOBEC3F
SART3
SNAR-A3
SNAR-A6
SNAR-A7
GPR174
KLHL26
ATAD2
C19orf70
POLE2
DNAJB4
SMG1P7
BTG3
MZF1
PSMB6
PCBP1
MSH6
DIAPH3-AS1
LOC101593348
MGC39584
PPWD1
SMC2
ZHX3
ZNF577
ECSIT
IGIP
FOXD4L1
CFAP20
PDLIM3
10039
100130889
130872
2593
51111
30851
2146
10885
79603
128312
54764
132299
54664
55199
6477
5717
200316
9733
100169951
100169957
100169953
84636
55295
29028
125988
5427
11080
100506060
10950
7593
5694
5093
2956
100874195
101593348
441058
23398
10592
23051
84765
51295
492311
200350
29105
27295
0.942456333
0.660624333
0.663720667
-0.860269
0.57979
0.60845
-0.59171
-0.628496667
-0.543171
-1.155134667
0.45676
0.878665333
0.631442
-0.454303333
0.69869
-0.442763333
0.711477333
-0.729012667
-0.5503
-0.5503
-0.5503
-0.785552333
-0.653913
-0.541663333
-0.804010667
-0.752434667
0.845646333
1.033116667
0.51418
1.041824
-0.681776667
-0.481986667
-0.553105667
-0.692530667
-0.740608
0.587833333
0.639246667
-0.57022
-0.61576
0.5447
-0.885973
0.713123
0.649537667
-0.463136667
0.569807333
0.012298
0.01239
0.012453
0.01246
0.01246
0.012485
0.012494
0.0125
0.012563
0.012563
0.012567
0.012642
0.012642
0.012656
0.012723
0.01278
0.012814
0.012833
0.012833
0.012833
0.012833
0.012834
0.012834
0.012861
0.012906
0.012945
0.012957
0.012957
0.012981
0.012997
0.012997
0.013055
0.013127
0.013136
0.0132
0.013273
0.013273
0.013273
0.013273
0.0133
0.0133
0.013305
0.013307
0.013307
0.013307
94
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 94 of 158
MAPK7
TMEM5
BAIAP3
PPP1CB
CNTD1
ERBB2IP
SIX4
XRCC5
LINC01338
MRPL22
POLR3K
ZNF511
GRIN3A
LOC286059
ING4
HEG1
AGAP6
HERC5
C9orf85
CPSF2
PCNA
WARS2
IST1
RMI1
HLA-A
CYP2R1
HSPA4L
ARHGDIA
CCDC91
CDC7
SFXN2
DHRS11
TAS2R31
LINC00342
DYNC2H1
MGRN1
ICMT
SNRPD2
CASC15
PARD6B
TFEC
TXNDC5
DDX18
MIR1277
SPRY1
5598
10329
8938
5500
124817
55914
51804
7520
102546175
29093
51728
118472
116443
286059
51147
57493
414189
51191
138241
53981
5111
10352
9798
80010
3105
120227
22824
396
55297
8317
118980
79154
259290
150759
79659
23295
23463
6633
401237
84612
22797
81567
8886
100302214
10252
0.500533
-0.644973333
0.674415
0.608176667
1.059142
0.485086667
-0.745165667
-0.428096667
-0.60868
-0.711173
-0.702204
-0.563113333
0.935033333
0.645806667
0.744636667
0.786366333
0.600563333
0.917471
0.690163333
-0.408536667
-0.52915
-0.524153333
0.49821
-0.4839
0.794036667
0.497503333
0.747813333
-0.651093333
0.495796667
-0.921975667
-0.55662
-0.734072333
0.741682
0.727317333
0.704057
0.489306667
-0.57406
-0.516959333
0.803255667
0.553885667
-0.634301667
-0.744536667
-0.460896667
-1.570886
0.510823333
0.013405
0.013407
0.01347
0.01347
0.013551
0.013551
0.013551
0.013551
0.013593
0.013602
0.013607
0.013607
0.013615
0.013619
0.013629
0.013732
0.013742
0.013827
0.013854
0.013854
0.013854
0.013855
0.013874
0.013874
0.013891
0.013953
0.013962
0.014
0.014
0.014
0.014
0.014007
0.014027
0.014055
0.014093
0.014093
0.014122
0.014135
0.014168
0.014195
0.014195
0.014272
0.014326
0.014326
0.014363
95
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 95 of 158
IFNA2
C12orf49
BCL2L11
TRBJ2-2
TRIM29
RNY1
CNIH4
DNAAF5
CDKN1B
GSDMB
UBE2Q2P1
ATXN7
M6PR
TBC1D3P1-DHX40P1
SASS6
PRR3
PRNCR1
GFOD1
ZNF790
SHISA3
C21orf33
UNG
RNA5S11
RNA5S12
RNA5S13
RNA5S14
RNA5S15
RNA5S16
FANCG
NUP160
UBE2H
LOC101928982
SRGAP2D
ATP6V1C1
DCXR
CLTB
MRPS23
SDC3
MRPL40
PHF12
MIR548W
PLD1
ZIC5
UQCRC2
PQBP1
3440
79794
10018
28628
23650
6084
29097
54919
1027
55876
388165
6314
4074
653645
163786
80742
101867536
54438
388536
152573
8209
7374
100169762
100169763
100169764
100169765
100169766
100169767
2189
23279
7328
101928982
100996712
528
51181
1212
51649
9672
64976
57649
100422923
5337
85416
7385
10084
-0.661522
0.573205
-0.5422
-0.698004
0.919988667
-0.51334
-0.576676667
-0.625453333
0.680446667
0.609966
0.561219333
0.625253333
-0.44184
0.596776667
-0.516443333
-0.698678
0.597731667
-0.663041333
0.695252
-0.552736667
-0.592290333
-0.786584667
-0.646206667
-0.646206667
-0.646206667
-0.646206667
-0.646206667
-0.646206667
-0.974066333
-0.572736667
0.582433333
0.650097333
-0.607411
0.646023333
-0.605503333
-0.51643
-0.684452
0.944574
-0.62805
-0.59859
0.640317
-0.683298333
-0.573560333
-0.425186667
-0.52359
0.014397
0.014431
0.014444
0.014444
0.014444
0.014566
0.014625
0.014654
0.014686
0.014707
0.014717
0.014757
0.014757
0.014757
0.014759
0.014768
0.014812
0.014833
0.014872
0.01494
0.014943
0.014943
0.014962
0.014962
0.014962
0.014962
0.014962
0.014962
0.015037
0.015037
0.015037
0.015047
0.015073
0.015084
0.01521
0.015213
0.015213
0.015258
0.01527
0.015323
0.01534
0.015405
0.015406
0.015413
0.015471
96
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 96 of 158
DNAJC1
NDUFA1
MRM1
MGST3
TBCB
CCNE2
TSPYL2
GOLGA8J
GREM2
KMT2A
SSU72
COX20P1
ALG1L14P
DAZAP2
TP53TG3B
COPS6
PXMP2
ASAH1
LRIG1
AMPD3
MVB12B
LOC102724933
GDAP2
RPL23AP76
LCLAT1
ASTL
DHX32
INIP
DIS3L
ZMYM3
STAG3L2
QSOX2
TPM1
DROSHA
MFSD5
ACER3
GREB1
LIMK1
PXN-AS1
RCC2
SNX14
LOC93622
ENO2
SMARCD1
LINC00412
64215
4694
79922
4259
1155
9134
64061
653073
64388
4297
29101
100507102
100996649
9802
729355
10980
5827
427
26018
272
89853
102724933
54834
441781
253558
431705
55760
58493
115752
9203
442582
169714
7168
29102
84975
55331
9687
3984
100506649
55920
57231
93622
2026
6602
102723332
-0.560496667
-0.4973
-0.730363667
0.58178
-0.637103333
-0.519083333
0.797396667
0.601142667
0.762093
0.52419
-0.4796
0.58143
-0.583906667
0.481116667
0.619738
-0.537803333
-0.58622
0.43827
-0.548896667
0.592458667
0.73681
0.649577333
0.448793333
-0.682222333
-0.5231
0.652269333
0.540746667
-0.504806667
-0.700136667
0.917984667
0.528133333
-0.579408667
0.604823333
-0.44426
-0.668291667
0.632873333
0.736006667
-0.469274
-0.496701667
-0.52996
0.529216667
-0.613952
0.771922333
-0.51399
0.912392
0.015475
0.015475
0.015483
0.015484
0.015506
0.015507
0.015559
0.015575
0.015575
0.015575
0.015575
0.015586
0.015667
0.015678
0.015686
0.015753
0.015753
0.015764
0.015764
0.015769
0.015778
0.015778
0.015792
0.015792
0.015889
0.015897
0.015897
0.015898
0.01597
0.015991
0.016055
0.016098
0.016104
0.016134
0.016146
0.016199
0.016199
0.016199
0.016199
0.016199
0.016199
0.016205
0.016217
0.016217
0.016225
97
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 97 of 158
PRR5
VN1R83P
SEPT8
DDAH1
GUCY1B3
ENPP5
MGAT4A
SLC18B1
TOR3A
MIR200B
TXNRD1
DDX17
ITGB3BP
ATG2B
POLD4
SMAGP
MIR1299
EIF6
PSMD4
SRRT
TMEM129
ZNF645
HELZ
TARDBP
DCAF7
LAP3
PPP4C
SRRD
ATF7IP
IQUB
SERPINF1
VTI1A
ZNF404
MIR548Z
GLRX5
RETSAT
ALAS1
CDK2
FANCA
ITGAE
ITGB1
CLK1
IGHV1OR21-1
SVIP
DIP2A
55615
100312828
23176
23576
2983
59084
11320
116843
64222
406984
7296
10521
23421
55102
57804
57228
100302167
3692
5710
51593
92305
158506
9931
23435
10238
51056
5531
402055
55729
154865
5176
143187
342908
100500856
51218
54884
211
1017
2175
3682
3688
1195
390530
258010
23181
-0.517930333
0.706532667
-0.65854
-0.438746667
-0.587773333
0.669236667
0.832918333
-0.510458333
-0.643319333
-0.752382333
0.42253
0.44196
-0.502933333
0.675301333
0.641857333
-0.600186667
0.85946
-0.562763333
-0.473813333
-0.562696667
-0.704744667
-0.785082667
0.46343
-0.468656667
-0.536236667
-0.519206667
-0.44858
-0.608663333
-0.473393333
0.848625333
0.735808333
0.718548667
0.812683667
0.777719667
-0.47826
0.6521
0.7003
-0.648306667
-0.722165333
-0.511743333
0.400423333
0.779206333
-0.888526
-0.510228667
0.640605
0.016234
0.016258
0.016282
0.016282
0.016282
0.016307
0.016307
0.016307
0.016307
0.016347
0.016347
0.016361
0.016412
0.016521
0.016521
0.016521
0.016563
0.016627
0.016627
0.016627
0.016635
0.016697
0.01678
0.016794
0.016798
0.016798
0.01683
0.016873
0.016881
0.0169
0.016928
0.016928
0.016928
0.017036
0.017041
0.017069
0.017119
0.017119
0.017119
0.017182
0.017182
0.017202
0.017202
0.017203
0.017241
98
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 98 of 158
ALB
POMGNT1
RNF126
R3HCC1
ORC6
UBA1
KIAA0232
PLEKHG3
PHF19
G6PC3
C20orf194
MIR4295
WDR82
SLED1
DYNC1H1
PUS1
CLIP1
DNAJC2
ARFIP1
KRTCAP3
TNFRSF9
ZNF66
TMEM160
COX7A2L
DSCC1
EXOSC1
BZW1
CHEK2
CKAP2
MIR4737
MKRN9P
TANC2
ITM2B
MYSM1
MBNL1
MRGPRX1
SHTN1
MRRF
HSPA14
SFXN4
PDHA1
ZNF587
MIR4289
LCAT
MIER1
213
55624
55658
203069
23594
7317
9778
26030
26147
92579
25943
100422909
80335
643036
1778
80324
6249
27000
27236
200634
3604
7617
54958
9167
79075
51013
9689
11200
26586
100616210
400058
26115
9445
114803
4154
259249
57698
92399
51182
119559
5160
84914
100423015
3931
57708
-0.750176
-0.554877667
-0.691897667
-1.158989333
-0.676180333
-0.541303333
0.785054
-0.627434333
0.562798333
-0.467093333
0.787737
0.949678333
-0.54018
0.814457
0.491836667
-0.552161
0.68387
-0.533613333
0.55669
-0.654251
0.675256
0.689916667
-0.463750333
0.532193333
-0.715947
-0.47261
0.448683333
-0.67375
-0.6316
0.641896667
0.589291
0.624129667
0.449463333
0.56308
-0.46716
0.581949333
0.50826
-0.389483333
-0.65648
-0.657826667
-0.536346667
0.540826333
-0.520187
0.754377333
0.604416333
0.017255
0.017267
0.017371
0.017377
0.017425
0.01744
0.017458
0.017468
0.017474
0.017517
0.01761
0.017628
0.017635
0.017662
0.017665
0.01771
0.017759
0.017806
0.017821
0.017821
0.017821
0.017852
0.017923
0.017933
0.017943
0.017943
0.018018
0.018018
0.018018
0.018018
0.018018
0.018151
0.018185
0.018196
0.018336
0.018336
0.018336
0.018424
0.018429
0.018486
0.018501
0.018501
0.018613
0.018702
0.018709
99
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 99 of 158
IFI27
TCF19
LINC01278
UBE2F-SCLY
DMXL2
TEAD4
TMEM9B
ZNF430
GSG2
EPRS
XPO7
RBPMS
FERMT2
HMGN4
HES1
USP1
HIST1H4I
RNASEH2C
AK3
OR9A2
DYNC1I2
KAT2B
OXSR1
MLX
RAB18
POGK
MBD6
IL6STP1
HLA-B
PSTK
TIMM8A
ZNF883
TTYH3
LARS2
NUDT16P1
IFI6
ANKEF1
PSMD6-AS2
PMS2P5
FAM149B1
TFAM
GLOD4
LMO4
CLCN6
USP46-AS1
3429
6941
92249
100533179
23312
7004
56674
80264
83903
2058
23039
11030
10979
10473
3280
7398
8294
84153
50808
135924
1781
8850
9943
6945
22931
57645
114785
3573
3106
118672
1678
169834
80727
23395
152195
2537
63926
100507062
5383
317662
7019
51031
8543
1185
643783
0.602720667
-0.494459667
0.453016667
-0.560675333
0.582146667
-0.823748333
0.504143333
0.524876667
-0.777556
0.46146
-0.480076667
0.499742333
0.61972
-0.446116
0.730776667
-0.721853333
-0.572739667
-0.693783
0.442013333
-0.700457333
0.46366
0.706657
0.433696667
-0.710486667
0.448423333
-0.662095
0.533239667
0.680153667
1.122261667
-0.677476
-0.668903
-0.610579333
0.706299667
-0.920862667
-0.591966667
0.698968333
-0.495079
0.859292333
0.486343333
0.701012667
-0.46037
-0.650914667
-0.602978
0.58445
-0.767312
0.018723
0.018766
0.018824
0.018824
0.018897
0.018897
0.018914
0.018961
0.018986
0.018987
0.01901
0.019021
0.01905
0.019094
0.019143
0.019146
0.019204
0.019223
0.019225
0.019285
0.019339
0.019341
0.019369
0.019382
0.019382
0.019421
0.019459
0.019527
0.019545
0.019556
0.019684
0.019697
0.0197
0.019748
0.019748
0.019787
0.019853
0.019853
0.019935
0.019979
0.019979
0.019995
0.020024
0.020104
0.020106
100
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 100 of 158
CDK2AP2
COL4A5
DGKA
PIP
CKAP4
SMG1
NLN
CEP128
LAMC1
NUDT15
XRCC6
STAG3L1
GOLGA6L9
GLE1
RAB11B-AS1
ELP5
PDIA6
GAR1
IFT122
BIN1
ACRV1
MED30
DMXL1
U2AF1
PRSS8
ATP5G1P6
STAU2
YIPF4
ZNF268
WASL
STXBP5L
TMEM141
TBC1D3G
CCDC63
FAM213B
FSIP1
MINA
ZP3
LRRC37B
PPIL1P1
TNC
LINC01237
HIST1H2BPS2
RFX7
DBF4B
10263
1287
1606
5304
10970
23049
57486
145508
3915
55270
2547
54441
440295
2733
100507567
23587
10130
54433
55764
274
56
90390
1657
7307
5652
100505704
27067
84272
10795
8976
9515
85014
101060321
160762
127281
161835
84864
7784
114659
150947
3371
101927289
10340
64864
80174
-0.579977
0.758964333
0.880303
0.863841667
-0.576766667
0.551806667
-0.534986667
-0.656374667
0.72114
-0.622379
-0.419553333
0.637713333
0.925896333
-0.67276
0.879290667
-0.529595333
-0.41408
-0.465723333
-0.522934333
-0.512109667
0.676868
-0.54956
0.572793333
-0.550236667
0.494793333
-0.530128
0.447023333
0.50288
0.636128667
0.481373333
0.54126
-0.7757
0.878658
0.528022333
-0.568430667
0.842211333
-0.46418
-0.608924333
0.562629
-0.511573333
0.762797
0.552002333
-0.734393667
0.49862
-0.635664
0.020153
0.020348
0.020393
0.020393
0.020409
0.020462
0.020481
0.020485
0.020485
0.020485
0.020485
0.020547
0.020549
0.020624
0.020669
0.020744
0.020744
0.020796
0.020796
0.020835
0.020848
0.020988
0.020989
0.021048
0.021101
0.021143
0.021155
0.021155
0.021155
0.021165
0.021173
0.021231
0.021268
0.021355
0.021355
0.021364
0.021364
0.021364
0.021441
0.021441
0.021441
0.021544
0.021569
0.021569
0.021638
101
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 101 of 158
ANAPC16
EMBP1
DIP2A-IT1
GINS3
MIR1255A
PAG1
ADAM15
C20orf166-AS1
NRP1
BCAR3
PGLYRP2
TAF5L
TUG1
CHCHD2
SMARCAD1
SNX16
LOC399815
CALML3-AS1
CEBPA
AFF3
HMGN1
LOC100130744
MIRLET7C
MEAT6
PSMD2
SNORD6
MOSPD2
HIST1H2BE
C1orf27
CCNL1
NUDT18
TMEM154
MT1X
KDM4B
RTN4RL1
PGD
RDM1
SLCO4A1
MRPL14
PDE3B
APPL2
TMED8
PADI3
ZNF280D
NAT10
119504
647121
100862692
64785
100302193
55824
8751
253868
8829
8412
114770
27097
55000
51142
56916
64089
399815
100132159
1050
3899
3150
100130744
406885
105378111
5708
692075
158747
8344
54953
57018
79873
201799
4501
23030
146760
5226
201299
28231
64928
5140
55198
283578
51702
54816
55226
0.5907
-0.51778
0.608254333
-0.617992
1.137091
-0.790733
-0.63397
0.533029333
0.593635333
0.545279667
-0.60295
-0.583285
0.405013333
-0.404656667
0.559280333
0.778222
-0.507834667
0.649781333
-0.670440333
0.703106667
-0.52826
0.671340333
0.975201667
0.983457
-0.527123333
-0.614895667
0.662155
-0.640563667
0.510361333
0.54194
0.479723
0.791678333
-0.518256667
0.858799333
-0.520792
-0.567750667
-0.647077667
-0.866381333
-0.753394667
-0.580937333
0.669376333
-0.52907
0.725884333
0.544313333
-0.600543333
0.02164
0.02164
0.021653
0.021675
0.021675
0.021675
0.021764
0.022061
0.022083
0.022117
0.022193
0.022193
0.022193
0.022258
0.022316
0.022344
0.022367
0.022458
0.022478
0.022491
0.022596
0.022657
0.022689
0.022734
0.022779
0.022801
0.022831
0.022855
0.022989
0.023019
0.023019
0.023034
0.023168
0.023211
0.023211
0.02323
0.023257
0.023295
0.023295
0.023316
0.02337
0.02337
0.023393
0.023402
0.023421
102
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 102 of 158
OSTF1
ISOC1
SETSIP
ZBTB37
TMEM132C
MIR5585
MESP2
ZNF292
CHORDC1
FOCAD-AS1
ATP5C1
WDR76
TFB2M
RAI1-AS1
POU3F4
GOLGA6L17P
DFFA
NEMP1
PRPF4
THOC3
VDAC2
PCCA
SEPT7P1
MIR1207
VEPH1
SERHL
CASD1
TIPIN
ATAD3A
LPAL2
ZNF28
NFKB1
OR7E125P
ORC4
CYR61
IGF1R
AGAP5
LOC374443
RANGAP1
SNRPGP4
ARMC4
KDM7A
RNF38
INAFM1
AIF1L
26578
51015
646817
84614
92293
100847018
145873
23036
26973
101929548
509
79968
64216
100861516
5456
642402
1676
23306
9128
84321
7417
5095
317774
100302175
79674
94009
64921
54962
55210
80350
7576
4790
389616
5000
3491
3480
729092
374443
5905
100130368
55130
80853
152006
255783
83543
0.49042
-0.491673333
-0.735844667
0.588177
-0.534961667
0.902793333
-0.741221
0.582140667
-0.44176
-0.472214667
-0.489223333
-0.77273
-0.48078
-0.493705333
-0.618581333
0.715822
-0.525736667
-0.450516667
-0.571653333
-0.426926667
-0.3816
0.632435333
-0.569370333
0.756425333
-0.658005333
-0.727840333
0.441006667
-0.595475333
-0.555467667
-0.539721333
0.447973333
-0.57744
0.604591
0.483453333
0.573550667
0.755936667
0.52727
0.830351667
-0.886553667
-0.819572
-0.757282
0.766612333
0.4674
-0.564153
-0.507355667
0.023443
0.023494
0.023494
0.023494
0.023548
0.023586
0.023591
0.023628
0.023677
0.023695
0.023763
0.023763
0.023778
0.023809
0.023835
0.02386
0.02391
0.02391
0.02391
0.02391
0.023953
0.024002
0.024023
0.024023
0.024023
0.024087
0.024087
0.024094
0.024145
0.024148
0.024148
0.024157
0.024157
0.02416
0.024212
0.024251
0.024329
0.024428
0.024492
0.024551
0.024598
0.024598
0.024656
0.024687
0.024768
103
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 103 of 158
ALG8
EIF5
MED14
ARHGAP5
KRTAP9-7
PEX10
ASAP1-IT1
DUSP8
TMEM136
ANOS1
LMNA
MARCH6
DDX3Y
PCYOX1
POLI
SMAP1
KCCAT198
UBQLN2
STAT3
CIAPIN1
GPR75
BRE
CTTNBP2NL
BACH1
KLF6
RPS29P26
LOC100506071
STOM
TUBB8
AFG3L2
ELMO3
MIR1-1
NARS
DCTN3
TMSB4XP4
AMN1
PPT1
BOD1L1
DHX9
MIR1255B2
SNRNP70
UBL4A
RFC1
POLR2LP
IRF6
79053
1983
9282
394
100505724
5192
29065
1850
219902
3730
4000
10299
8653
51449
11201
60682
105369954
29978
6774
57019
10936
9577
55917
571
1316
100271591
100506071
2040
347688
10939
79767
406904
4677
11258
7118
196394
5538
259282
1660
100313835
6625
8266
5981
493825
3664
-0.54695
-0.369273333
-0.428993333
0.596653333
-0.594312667
-0.583683333
0.809370667
0.663750667
0.480933333
-0.533164667
0.782398333
0.415746667
0.699995667
0.48163
0.638813333
0.568194
0.680792667
-0.445616667
0.56788
-0.508590667
0.673613
0.43667
0.539217667
0.465618667
0.566756333
-0.487611333
0.643517667
0.521752
-0.655308333
-0.453363333
-0.532701667
-0.668383333
0.583103333
-0.501956667
0.962083667
0.796102333
-0.493756667
0.554915667
-0.572973333
0.490595333
-0.49786
-0.625045333
-0.524033333
-0.554214
0.894354333
0.024768
0.024842
0.024842
0.024885
0.024885
0.024885
0.024885
0.024885
0.024885
0.024908
0.024912
0.024973
0.024973
0.024983
0.02502
0.025036
0.025061
0.025083
0.025083
0.025148
0.025281
0.025302
0.02535
0.025401
0.025401
0.02544
0.025459
0.025459
0.025459
0.025477
0.025477
0.025477
0.025477
0.025528
0.025539
0.025562
0.025595
0.025634
0.025664
0.025664
0.025751
0.025755
0.025794
0.025937
0.026025
104
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 104 of 158
ENOSF1
HILPDA
ZFR
CENPL
TAGLN2P1
MRPL35
GLRX2
LOC729080
CCT4
CCDC126
UBXN2A
NPHP3-ACAD11
SLC26A3
CCDC53
AMZ2P1
SPATA5L1
MYO9A
SOS1
AZIN1
STK38
ANAPC11
TBC1D14
ZNF254
ABHD17C
TM2D1
PHLPP2
SSPO
BACE2
NT5DC2
DZIP3
FAM26D
ARID3A
IL25
LINC00430
OIP5
CACYBP
MAPK9
DDX49
PNPLA8
VPS25
KAT6B
REEP4
NUP153
OSGEPL1
SCLY
55556
29923
51663
91687
100418887
51318
51022
729080
10575
90693
165324
100532724
1811
51019
201283
79029
4649
6654
51582
11329
51529
57533
9534
58489
83941
23035
23145
25825
64943
9666
221301
1820
64806
106144533
11339
27101
5601
54555
50640
84313
23522
80346
9972
64172
51540
0.538478333
0.831444333
-0.467453333
-0.65602
-0.769092667
-0.59757
-0.665503333
-0.471860333
-0.45049
0.568583
-0.644253333
0.869154333
0.799733
0.57087
0.645282333
-0.611111333
0.646841667
0.519266667
0.47721
0.436506667
-0.49256
-0.49873
0.406113333
-0.692494
0.461083333
-0.484558333
0.513755
0.769390667
-0.805463333
0.694082667
0.512911667
0.474867
-0.47749
-0.653764
-0.697953667
-0.462143333
-0.52639
-0.452759333
0.791736667
-0.39908
0.48705
-0.539916667
-0.514913333
-0.583015667
-0.621792
0.026054
0.026054
0.026144
0.026179
0.026197
0.026206
0.026265
0.026265
0.026327
0.026539
0.026544
0.026555
0.026555
0.0266
0.02661
0.02661
0.026631
0.026637
0.026702
0.026712
0.026758
0.026868
0.026915
0.026918
0.026918
0.02697
0.02697
0.026978
0.027049
0.027052
0.027052
0.027064
0.027067
0.027084
0.027084
0.027123
0.027134
0.027147
0.027147
0.02718
0.027208
0.02728
0.027346
0.027346
0.027346
105
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 105 of 158
CDCA7
SNORD70
RNMTL1
TMEM31
FAM136A
HSD17B10
ST3GAL5
CFAP70
ANKRD46
LAS1L
ARHGDIB
HIST1H2BI
CYP4F11
E2F4
HSDL2
MIR558
EHMT1
CLPP
LINC00698
TDO2
COA6
SNX17
BRWD1
STK38L
RAN
BTN3A2
CRLS1
NDUFS2
LOC100129550
LOC101927424
ESCO2
PIR
BID
NOMO2
SPG20
MIR4644
BBIP1
DIAPH3
RNF111
DIMT1
KMT2C
C3orf14
DUSP9
ADCY3
FNBP4
83879
692110
55178
203562
84908
3028
8869
118491
157567
81887
397
8346
57834
1874
84263
693143
79813
8192
285401
6999
388753
9784
54014
23012
5901
11118
54675
4720
100129550
101927424
157570
8544
637
283820
23111
100616430
92482
81624
54778
27292
58508
57415
1852
109
23360
-0.846019667
-0.752141667
-0.792093
-0.569897667
-0.507753333
-0.594313333
0.659723667
0.727992667
-0.505902
-0.601344667
-0.593799
-0.589311333
0.778558
-0.61822
0.459133333
0.785104
-0.415332667
-0.474856667
0.559193667
-0.690876
-0.554386667
-0.465713333
0.476336667
0.475929
-0.4145
-0.460979667
-0.461150667
-0.384166667
0.720976333
0.815190333
-0.670786667
-0.44497
-0.574365667
-0.42475
-0.677973333
0.521322667
0.473706667
-0.560226667
0.577730333
-0.569153333
0.550796667
-0.577254667
-0.491948
-0.490652333
0.6528
0.02738
0.027415
0.027465
0.027465
0.027472
0.027472
0.027472
0.027483
0.027492
0.027492
0.027493
0.027493
0.027538
0.027546
0.027608
0.027608
0.027629
0.027657
0.027657
0.027657
0.027668
0.027691
0.027965
0.027965
0.028025
0.028057
0.028072
0.028072
0.02809
0.02809
0.028137
0.028164
0.028263
0.028263
0.028272
0.028329
0.028342
0.028342
0.028349
0.028368
0.028396
0.028419
0.028436
0.028477
0.028477
106
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 106 of 158
ALDH9A1
LIMA1
LGMN
GPR1
ZNF521
CCDC58
MOAP1
MORC2
GTF3C1
EPHX4
DHRS12
AGAP1
FAM127C
FGF21
FGF7P2
GGA2
C16orf59
RNFT2
IGSF9B
TGFBRAP1
TONSL
B4GALT5
ZNF880
NLGN4X
FAM110C
RPS19BP1
DNAJC28
RSL1D1
WBSCR16
UBXN4
C11orf70
RCN1
SGF29
FOXO3
PHF21A
NEDD9
PCNX
EMC6
GRN
L3MBTL2
SMC1A
OR52N1
SERTAD2
ACAD11
EFCC1
223
51474
5641
2825
25925
131076
64112
22880
2975
253152
79758
116987
441518
26291
394217
23062
80178
84900
22997
9392
4796
9334
400713
57502
642273
91582
54943
26156
81554
23190
85016
5954
112869
2309
51317
4739
22990
83460
2896
83746
8243
79473
9792
84129
79825
-0.47631
0.473453333
0.507813333
0.575411
-0.555384333
-0.591326667
0.592360333
-0.507209333
-0.504156667
-0.679019
0.783996667
0.522707333
0.772793333
0.600593333
-0.505627333
-0.670188667
-0.530039
-0.532386333
-0.561678667
-0.640295667
-0.571769
-0.608816
0.517396667
0.629566667
0.760603333
-0.519964333
0.794610333
-0.446496667
-0.561582
0.468313333
0.813353333
0.466606667
-0.7144
0.435134
0.679243333
0.541953667
0.529356667
-0.604853333
0.499083333
-0.757061667
-0.41665
0.824147
0.679354333
0.53051
0.464218
0.028572
0.02858
0.028607
0.028616
0.028616
0.028629
0.02867
0.02867
0.028755
0.028787
0.028876
0.029062
0.029062
0.029062
0.029062
0.029062
0.02912
0.029121
0.029204
0.029204
0.029204
0.029222
0.029257
0.029341
0.029368
0.029381
0.029419
0.029516
0.029549
0.029581
0.029653
0.029653
0.02972
0.02974
0.029834
0.029834
0.029899
0.029937
0.029964
0.030056
0.030099
0.03011
0.030329
0.030338
0.030338
107
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 107 of 158
DHX36
MIR548C
OR10AE3P
RTKN2
RTCA-AS1
TMEM138
C8orf34-AS1
TIMELESS
CHAF1B
TRIM27
TUBG2
RPS20P33
LAGE3
USP9X
ARSA
C9orf114
VPS37C
SVBP
MMP15
ATP6V1E1
TSEN15P1
IGHVIII-38-1
HMGB1
LMF1
SLC27A4
PPIH
CD320
SF3A3
LOC90246
TRNP1
ZNF266
CD5L
HNF4A-AS1
POLK
SPIRE1
LMBR1L
SSX9
HOXC12
MEGF9
SETBP1
YPEL1
GPR137B
ZFP36L2
TACR2
LOC100506869
170506
693129
403223
219790
100506007
51524
286189
8914
8208
5987
27175
100271564
8270
8239
410
51490
55048
374969
4324
529
100288179
28346
3146
64788
10999
10465
51293
10946
90246
388610
10781
922
101927219
51426
56907
55716
280660
3228
1955
26040
29799
7107
678
6865
100506869
-0.43017
0.844516667
-0.445122
-0.570623333
0.600508
-0.473846667
-0.775426
-0.798913667
-0.831323333
-0.42634
-0.41324
0.625003333
-0.559180333
0.403146667
0.683415333
-0.864815667
-0.530556667
0.595391667
-0.642646667
0.453933333
-0.613849333
-0.554894
-0.447476667
0.794781667
-0.474944
-0.750244667
-0.978682667
-0.448266667
0.596344333
-0.641915
0.47685
-0.57865
-0.506003333
0.40268
0.553206667
0.844322
-0.667134333
-0.579032667
0.614591
0.472746667
0.700513333
0.618537667
-0.618692
0.502163333
-1.026613
0.030414
0.030491
0.030531
0.030549
0.03058
0.030593
0.03061
0.030612
0.030749
0.030749
0.030749
0.0308
0.030837
0.030931
0.03098
0.03098
0.030999
0.031013
0.031051
0.03113
0.031136
0.031167
0.031198
0.031234
0.031241
0.031244
0.031338
0.031363
0.031375
0.031434
0.031434
0.031492
0.031492
0.031492
0.031492
0.031556
0.031603
0.031629
0.031638
0.031642
0.031642
0.031668
0.031683
0.03173
0.031743
108
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 108 of 158
RPAP2
PPP1R15B
TP53I11
LOC729609
LDHAP7
RUFY2
STOX2
AADAT
APOBEC3G
CFAP74
SAT2
TTC3
ZNF780A
OGFRP1
CARS2
UBR2
BRAF
ACADSB
PHKA1
SLC44A1
FAM120A
MTMR4
CXCR4
PLA2G6
PLCG2
RBM28
WDR62
SLC9A3R2
COPA
PVR
VANGL1
TARM1
TGDS
NAMPT
LINC00320
SERINC3
ZNF526
FOXRED1
PSMD3
MTG2
ADAMTS1
THRA1/BTR
MAP6
TMSB4Y
RNA5S10
79871
84919
9537
729609
100190800
55680
56977
51166
60489
85452
112483
7267
284323
388906
79587
23304
673
36
5255
23446
23196
9110
7852
8398
5336
55131
284403
9351
1314
5817
81839
441864
23483
10135
387486
10955
116115
55572
5709
26164
9510
105371807
4135
9087
100169761
0.520281333
0.43546
0.52506
0.733223
0.57513
0.400963333
0.592661333
-0.452376667
-0.686005667
0.485692
0.69083
0.431656667
0.650233333
-0.942541333
-0.813353333
0.42193
0.45438
0.542113333
0.481458333
-0.615393333
-0.394306667
-0.47267
0.751815667
0.765242
0.636833333
-0.444031667
-0.670271
-0.667103333
0.42542
-0.483156667
-0.684042667
0.77864
-0.392993333
0.62788
0.570784333
0.412393333
-0.563645667
-0.566571333
-0.537913333
-0.569383667
0.441646667
-0.533858
-0.503073667
0.809714667
-0.604896667
0.031797
0.031833
0.03187
0.031935
0.032004
0.032008
0.032008
0.032129
0.032242
0.032242
0.032242
0.032242
0.032278
0.03234
0.032349
0.032411
0.032508
0.03274
0.032773
0.032773
0.032828
0.032828
0.032899
0.03292
0.032936
0.032936
0.032936
0.03299
0.033064
0.033064
0.033064
0.033067
0.033067
0.033261
0.033281
0.033282
0.033282
0.033332
0.033332
0.033377
0.033464
0.033597
0.033637
0.033737
0.033747
109
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 109 of 158
RNA5S17
RNA5S7
CCNG2
TMEM170A
NDUFB11
CHD4
PFDN2
YWHAH
LOC102467226
MAK16
SNORA47
CDCP1
LINC01088
FAM71F1
TNIP1
OR52B5P
UCHL1-AS1
LINC00858
ZNF606
MAF
ATP9B
DCST2
TRABD
TUBAP
USP2-AS1
NAIP
AP3M2
ZADH2
FBXO45
MIR1257
OR13C4
HIST1H2BC
TUBBP5
UQCRFS1
FADS2
ZFP36
TBC1D31
C4orf46
BTAF1
TMEM67
TRUB2
BORCS7
RAB35
SLC44A2
TM7SF3
100169768
100169758
901
124491
54539
1108
5202
7533
102467226
84549
677828
64866
100505875
84691
10318
81270
101410542
170425
80095
4094
374868
127579
80305
54016
100499227
4671
10947
284273
200933
100302168
138804
8347
643224
7386
9415
7538
93594
201725
9044
91147
26995
119032
11021
57153
51768
-0.604896667
-0.604896667
0.444143333
0.580057667
-0.41744
-0.634809
-0.513749
-0.438963333
0.552116333
-0.525343333
0.611443333
-0.418986667
0.700344333
0.641783333
0.553745
-0.529421
0.707644667
-0.611152
0.531629667
0.456146667
0.646725
0.848699333
-0.531025
-0.552918
-0.700557667
0.579970333
-0.563966667
-0.511496
-0.469181
-0.530035667
-0.512145333
-0.428334333
-0.668731667
-0.49677
-0.373673333
0.842955
-0.548983333
-0.50721
0.589863333
0.533932
-0.514753333
0.680778
-0.645581333
-0.483843333
0.873907
0.033747
0.033747
0.033837
0.033842
0.033994
0.033995
0.033995
0.034011
0.034042
0.034042
0.034114
0.034223
0.034304
0.034348
0.034375
0.034498
0.034498
0.034689
0.03475
0.034808
0.034826
0.034965
0.034989
0.034989
0.035014
0.035093
0.035105
0.035105
0.035121
0.035121
0.035121
0.035227
0.035295
0.035295
0.035313
0.035331
0.035406
0.035408
0.035506
0.035534
0.035534
0.035544
0.035574
0.035574
0.035635
110
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 110 of 158
NAA10
SREBF1
ZNF596
GPR180
LINC00662
GXYLT1
RSBN1L
LOC100652768
C1orf21
CENPQ
TMEM33
NSMCE4A
ZNF626
GNA11
DYNLL1
PWP2
FER
POLR3KP2
YIPF3
C8orf44
VAT1
VPS13C
NOVA1
BAX
IDH3B
NOL11
PPP1R12A
GBA
HSPB1
LCMT2
SKA1
NGFRAP1
BASP1P1
RRN3P2
FMO4
DDX46
C9orf129
NUTM2G
ACTR10
NHSL2
RYR2
ZNF347
KIAA0586
OR52E3P
HIPK1-AS1
8260
6720
169270
160897
148189
283464
222194
100652768
81563
55166
55161
54780
199777
2767
8655
5822
2241
390811
25844
56260
10493
54832
4857
581
3420
25926
4659
2629
3315
9836
220134
27018
646201
653390
2329
9879
445577
441457
55860
340527
6262
84671
9786
79533
101928846
-0.781677333
-0.540673333
0.527790333
-0.582034
0.617690333
0.582472
-0.53289
0.528609667
0.540836667
-0.571223333
-0.427053333
-0.715046667
0.61744
-0.487666667
-0.37845
-0.804729667
0.555625667
-0.577526
0.46055
0.722419
0.640392333
0.685940667
-0.511103333
0.672358
-0.39522
-0.475316667
0.557045333
0.493686667
-0.36296
-0.386517333
-0.683303333
-0.40049
-0.634508
-0.413443333
0.824061333
-0.406863333
-0.384779667
-0.413309667
0.462596667
0.667623333
0.626919667
0.619034
-0.579803333
-0.561179
-0.901690333
0.035773
0.035773
0.035773
0.035791
0.035823
0.035835
0.035835
0.035879
0.03593
0.03593
0.03593
0.035952
0.035977
0.035978
0.036011
0.036011
0.036045
0.036113
0.036125
0.036164
0.036165
0.036349
0.036378
0.036426
0.036426
0.036426
0.036507
0.036561
0.036561
0.036615
0.036616
0.036629
0.036669
0.036669
0.036877
0.036959
0.037079
0.037098
0.037162
0.037162
0.037162
0.037162
0.037172
0.037183
0.037258
111
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 111 of 158
ZNF554
LIF
RUVBL2
LINC01587
CAD
PDXK
LOC100652911
HIRIP3
ATP6V1H
FAM111B
PRMT7
SMG1P5
ZNF823
MIR548AA2
DRG1
RB1
CALM1
C6orf120
TMEM87A
NUDT14
GTF3C2
TCOF1
CAPN9
LOC440910
HDAC2
LRRC37A3
LINC00433
NAE1
LRRC29
LINC00967
SLC2A14
CSTA
GPR155
PDCD10
SLC6A8
OTUD1
NBPF10
PRADC1
OFD1
GABARAPL2
STX17-AS1
VBP1
CBX2
KCNK9
CLCNKA
115196
3976
10856
10141
790
8566
100652911
8479
51606
374393
54496
595101
55552
100500895
4733
5925
801
387263
25963
256281
2976
6949
10753
440910
3066
374819
100874168
8883
26231
100505659
144195
1475
151556
11235
6535
220213
100132406
84279
8481
11345
441461
7411
84733
51305
1187
0.614643667
0.641489333
-0.612043333
0.614242333
-0.730228
-0.413183333
-0.552393
-0.886255333
0.491949333
-0.552843333
-0.555596667
0.630836667
0.469623
0.866116667
-0.393546667
0.495853333
-0.40087
-0.562898
0.458116667
0.619153333
-0.574073333
-0.7884
-0.575321
0.469651333
-0.380483333
0.694535667
-0.556055
-0.43843
0.538912667
0.561657333
0.615718333
0.781253333
0.744991667
0.460066667
0.80157
0.580889333
0.561886667
-0.506171333
0.673717
0.520313333
0.728029
-0.49003
-0.495517667
-0.571345333
0.553757667
0.037286
0.037288
0.037288
0.037354
0.03738
0.037424
0.037444
0.037557
0.037617
0.037617
0.037617
0.037617
0.037617
0.037658
0.037667
0.037669
0.037707
0.037742
0.037742
0.037803
0.037827
0.037872
0.038089
0.038089
0.038179
0.038214
0.038329
0.038329
0.038344
0.038347
0.038347
0.038348
0.03837
0.03837
0.03837
0.03839
0.038677
0.038677
0.038693
0.038704
0.038729
0.038767
0.038774
0.038774
0.03883
112
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 112 of 158
TMEM52
CHD9
YDJC
ANAPC7
ZNRF2P1
H2AFV
CD82
FAM63B
PAFAH1B1
CYB561
CCDC90B
SLC22A15
BTLA
CRIPT
LOC101927204
RNA5S9
GOLGA5
COPE
CNP
TLCD1
IL6ST
GFPT1
ATP7B
MTHFD2L
HAUS8
PCNA-AS1
TTC25
SPTLC2
CYB561A3
CNNM2
SIX6
NUP205
GANAB
MMS22L
ZMYND19
NR2F2
HNRNPA2B1
MIEF1
LOC101927911
RASSF2
CALM3
PTGDR2
TAC1
TTLL4
ARL6IP4
339456
80205
150223
51434
441208
94239
3732
54629
5048
1534
60492
55356
151888
9419
101927204
100169760
9950
11316
1267
116238
3572
2673
540
441024
93323
100302739
83538
9517
220002
54805
4990
23165
23193
253714
116225
7026
3181
54471
101927911
9770
808
11251
6863
9654
51329
-0.488111
0.48168
-0.823957
-0.412226667
-0.514906333
-0.490876667
0.610432333
0.525431
0.49406
-0.736139
0.493903333
0.54962
0.725723333
0.627306667
0.949357667
-0.55001
0.458573333
-0.36059
-0.68017
-0.51399
0.477766667
0.414173333
0.615818
-0.583401667
-0.744417
-0.644373
0.850101333
-0.503383333
-0.53613
0.599839667
-0.483309
-0.711915
-0.380536667
-0.425943333
-0.519093333
-0.4518
-0.4963
-0.68964
0.644528333
0.653778667
-0.399316667
-0.49625
-0.610812333
-0.524479333
-0.641740667
0.038959
0.038977
0.038977
0.038997
0.039011
0.039052
0.039097
0.03922
0.039245
0.039381
0.039423
0.039423
0.039448
0.039522
0.03953
0.039596
0.03968
0.039685
0.039766
0.039775
0.039824
0.039841
0.039871
0.039871
0.039895
0.039895
0.039895
0.039903
0.039999
0.039999
0.039999
0.040081
0.040099
0.040099
0.040111
0.0403
0.040301
0.040301
0.040379
0.04042
0.040474
0.040588
0.040588
0.040616
0.040616
113
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 113 of 158
DNAJA3
RTTN
MRPL48
LSM6
CNTFR
TNNT3
GTF3C6
SARM1
ALG5
FLJ16779
LOC101448202
TMEM144
XPO4
NPRL2
DDX26B
FLJ43315
TTC17
CUX1
GAS2
SLAIN1
PBX4
UBL7
PCSK5
NDUFS6
CLCA2
MYL6
PDCD5
MYEF2
TOMM40
WHSC1
VPS37B
COQ7
SLU7
NFIC
LRRC37A
MFSD1
MIR548U
TMEM205
HNRNPH3
NSMAF
FAM174A
MIR3913-2
RRN3P1
AIG1
SPRED1
9093
25914
51642
11157
1271
7140
112495
23098
29880
100192386
101448202
55314
64328
10641
203522
644316
55761
1523
2620
122060
80714
84993
5125
4726
9635
4637
9141
50804
10452
7468
79720
10229
10569
4782
9884
64747
100422884
374882
3189
8439
345757
100500868
730092
51390
161742
-0.515016333
0.689440333
-0.48529
-0.58748
0.544126333
-0.538046667
-0.437283333
-0.576042667
-0.511991667
0.543887
0.503294333
0.518038333
-0.606276667
-0.570734667
0.620498667
0.709064667
0.44624
0.491313333
0.582732333
-0.469245667
-0.462866
-0.4865
0.402558333
-0.419013333
0.938844667
0.504906667
-0.596263333
0.482684667
-0.883143667
-0.542842
0.647041
-0.52921
0.457494
-0.444993333
0.55775
0.460406667
1.112868333
-0.585516667
-0.40307
-0.440846667
0.616119
-0.819015667
-0.382356667
0.462533333
-0.630716333
0.040628
0.040658
0.040833
0.040957
0.040987
0.040987
0.041134
0.041137
0.041238
0.041238
0.041238
0.041262
0.041317
0.041454
0.041459
0.041459
0.041459
0.041575
0.041575
0.041575
0.041616
0.041636
0.041654
0.041677
0.041703
0.041712
0.041758
0.041764
0.041784
0.041794
0.041809
0.041818
0.041823
0.04186
0.041984
0.041984
0.041984
0.042022
0.042031
0.042076
0.042257
0.042257
0.042287
0.042296
0.042296
114
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 114 of 158
CCDC174
HMGB2P1
IER5
QRSL1
SDCCAG3
ANP32E
MARK4
PRKRIR
RPL19
SLC38A2
UBE4A
LINC00852
FANCC
LIX1
TAP2
FUT4
STK25
EMC8
NAPRT
OXCT1
SLC2A11
MIR199B
ZNF844
KLKP1
E2F1
NCOA7
OXLD1
PTGES3
WDR54
KIAA1109
C17orf51
FBXL6
TTI1
FAM86DP
MIR7641-2
IL10RB
MAGED1
MGME1
FAUP1
KCNH2
ODF4
POP7
CHPF
GYLTL1B
LOC101927056
51244
729119
51278
55278
10807
81611
57787
5612
6143
54407
9354
84657
2176
167410
6891
2526
10494
10328
93100
5019
66035
406978
284391
606293
1869
135112
339229
10728
84058
84162
339263
26233
9675
692099
102465753
3588
9500
92667
140623
3757
146852
10248
79586
120071
101927056
0.497610667
-0.481101
0.631256
-0.472975
-0.539662667
-0.458836333
0.743236667
-0.4683
-0.375573333
0.481453333
0.40694
0.789886333
-0.702199333
-0.467607667
-0.610248333
-0.471696333
-0.518443333
-0.819989667
-0.710913333
-0.360866667
0.580991667
0.587189
0.480277667
-0.555541333
-0.998759667
0.600505
-0.474197333
-0.406383333
-0.575325333
0.468461667
-0.706652
-0.531399333
-0.685023333
-0.53532
-0.776925333
0.831248
0.503366667
-0.617901667
-0.689594333
0.485995
0.693160333
-0.545186
0.979604333
-0.447673333
0.627218667
0.042337
0.042337
0.042337
0.042337
0.042337
0.042372
0.042392
0.042429
0.042591
0.042614
0.042704
0.042797
0.042887
0.042964
0.042964
0.043025
0.043084
0.043213
0.043213
0.043213
0.043213
0.043312
0.043312
0.043324
0.043428
0.043465
0.043465
0.043516
0.04362
0.043823
0.043825
0.044003
0.044003
0.04408
0.044134
0.044158
0.044208
0.044208
0.044234
0.044347
0.04435
0.044359
0.044502
0.044698
0.044899
115
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 115 of 158
DENND4C
DSEL
VCP
CCDC121
BTRC
FLJ40288
ISG20
NUDCD3
CLCN2
NUAK2
THBS3
SNORD101
GNRHR2
CHIC1
LOC642131
ABCA9
NIPBL
FAM222A
CYP4Z2P
LSM10
ATRAID
PROSER2-AS1
LPL
SUGT1
ZNF836
KATNB1
KSR1
ADRM1
LOC101929718
RBM12B
PFKM
CBX3
DUSP3
HSBP1
PRIM2
MBD4
METTL2A
MPP3
DNM1P34
OR7E154P
ANKRD36B
RAB5C
CUL1
OR51E1
GNL3L
55667
92126
7415
79635
8945
286023
3669
23386
1181
81788
7059
594837
114814
53344
642131
10350
25836
84915
163720
84967
51374
219731
4023
10910
162962
10300
8844
11047
101929718
389677
5213
11335
1845
3281
5558
8930
339175
4356
729809
403296
57730
5878
8454
143503
54552
0.432433333
-0.393167667
-0.398746667
-0.819773667
0.442551667
-0.664122333
0.554821667
-0.680361
-0.607637
-0.686414
0.665480333
-0.578554
-0.694516667
0.541769667
-0.638084
-0.676896
0.458366
0.537861333
-0.662317333
-0.634382
-0.457803333
0.58641
-0.611439
-0.589524
0.537722
-0.567665333
0.652424
-0.528624333
-0.527746333
0.374943333
-0.365796667
-0.36655
0.510533333
-0.51551
-0.482123333
-0.472143333
-0.488896667
0.444000333
-0.462213
0.495250333
0.515371333
-0.380033333
-0.39755
-0.611675
-0.52462
0.044949
0.045021
0.045021
0.045035
0.045061
0.045075
0.045136
0.045179
0.045291
0.045325
0.045357
0.045384
0.045426
0.045474
0.045515
0.045516
0.045576
0.045694
0.045697
0.045809
0.045818
0.045844
0.04592
0.045948
0.045985
0.046056
0.046142
0.046202
0.046202
0.046247
0.046304
0.04644
0.04644
0.046445
0.046445
0.046784
0.046918
0.046962
0.046973
0.047056
0.047063
0.047107
0.047159
0.04742
0.047432
116
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 116 of 158
PSMA7
ALG9
SMC6
MLLT11
ZNF461
DARS2
MIR548AX
ZNF451
NR2F6
WDR60
CSRP1
C1orf123
JPH1
CEBPZOS
FBXW8
PLXNB3
AASS
COX6B1
TEKT3
PEX5
LOC100508046
RAD51
EID3
LOC728323
DLL1
LOC100132111
PIFO
HNRNPUL2
NDUFB9
RP9
MIR4324
PIK3R4
MRPS11
EPAS1
MXRA8
DENND2C
PLEKHM3
FUT10
UBE2J1
SLC38A6
SAMD13
C12orf43
MSRB3
DOT1L
GLUD1
5688
79796
79677
10962
92283
55157
100847063
26036
2063
55112
1465
54987
56704
100505876
26259
5365
10157
1340
64518
5830
100508046
5888
493861
728323
28514
100132111
128344
221092
4715
6100
100422979
30849
64963
2034
54587
163259
389072
84750
51465
145389
148418
64897
253827
84444
2746
-0.3822
0.607023667
-0.506186667
0.509882667
0.466838333
-0.532896667
0.558551667
0.41673
-0.529423333
0.701016667
-0.38335
0.402153333
-0.586383333
0.4945
-0.484801
0.713836667
0.730780667
-0.36449
0.781670667
-0.516356667
0.692893
-0.71507
0.814834667
0.43668
-0.447958
0.645570667
0.591003333
-0.403793333
-0.389253333
-0.432816667
0.918177
-0.413466667
-0.695456667
0.781419667
-0.881445
0.654328
0.529043667
-0.541618667
-0.47477
0.437003333
-0.495796667
-0.499318333
0.664999
-0.452892667
0.383456667
0.047436
0.047576
0.047576
0.047582
0.047753
0.047809
0.047809
0.047809
0.048205
0.048208
0.048245
0.048383
0.048383
0.048433
0.048569
0.048603
0.048614
0.048644
0.048803
0.048821
0.048826
0.048826
0.048859
0.048859
0.049022
0.049042
0.04905
0.049057
0.049057
0.049057
0.049293
0.049414
0.049495
0.049543
0.049543
0.049568
0.049608
0.04961
0.04961
0.049675
0.049783
0.049794
0.049829
0.049852
0.049977
117
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 117 of 158
IGF2
RPL36AP33
SCGB1D2
SLC40A1
ADM
MXI1
SCNN1G
ALDOC
INSIG2
LOX
CCNG2
DUSP1
IGFBP3
SLAMF9
TMEM45A
STC1
MUC13
SDC2
ACKR3
ARG2
HERC3
LINC01133
HBEGF
KCNC3
NDRG1
FAM46A
TCAF2P1
PCAT5
CPA4
ITGA5
GPR160
RNF24
HEPHL1
C10orf10
SPAG4
CLDN11
LIPH
TCAF2
ALDH3A1
SRD5A3
CDKN1A
DDIT4
FAM177B
P4HA2
ARID3A
3481
100191039
10647
30061
133
4601
6340
230
51141
4015
901
1843
3486
89886
55076
6781
56667
6383
57007
384
8916
100505633
1839
3748
10397
55603
653691
102578074
51200
3678
26996
11237
341208
11067
6676
5010
200879
285966
218
79644
1026
54541
400823
8974
1820
0.496934667
0.596400667
0.531952
4.958043
2.596138667
1.912037
2.684493667
1.825422333
1.955593333
4.114972333
1.574559667
2.189930667
1.721946667
2.824415667
2.141233333
2.399073333
2.608991333
1.719113333
1.789199667
1.570682
1.416654667
1.924569667
1.697866667
1.510446
2.340643333
1.541085667
1.633520667
1.520511
1.62281
1.71766
1.526807333
1.10023
1.210686
1.632302333
1.481921
-1.134546667
1.551967667
1.452793667
-1.440600667
1.064733333
1.903707333
1.316905333
1.528167667
1.283866667
1.083697667
0.049977
0.049994
0.049994
1.57E-12
7.40E-09
7.40E-09
7.40E-09
9.94E-09
9.94E-09
2.29E-08
5.93E-08
5.93E-08
5.93E-08
5.93E-08
5.93E-08
6.12E-08
9.97E-08
1.59E-07
2.72E-07
3.10E-07
6.05E-07
8.70E-07
1.06E-06
1.42E-06
1.61E-06
2.05E-06
2.08E-06
3.22E-06
3.36E-06
3.36E-06
5.70E-06
6.02E-06
8.06E-06
1.05E-05
1.21E-05
1.64E-05
1.64E-05
2.09E-05
2.33E-05
2.33E-05
2.74E-05
3.04E-05
3.04E-05
3.32E-05
3.60E-05
118
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 118 of 158
BNIP3L
P4HA1
PNRC1
BNIP3
HIST1H1D
CHAC1
GBE1
TCP11L2
SEC61G
C3orf58
CA9
TMEM47
HIST1H3F
RASSF2
RELL1
EGLN1
EFEMP2
IPMK
SH3D21
KLF7
SAMD9L
FAM162A
HIF1A-AS2
SAMD9
BIRC3
DPYSL2
LGALS3
KCNK1
RORA
FAM117B
S1PR1
P3H2
SIRPB1
TMEM241
ESR2
MLLT3
RGS4
USP53
IFIT2
SLC2A14
FLRT3
PAM
CTH
C1orf21
MARCH4
665
5033
10957
664
3007
79094
2632
255394
23480
205428
768
83604
8968
9770
768211
54583
30008
253430
79729
8609
219285
26355
100750247
54809
330
1808
3958
3775
6095
150864
1901
55214
10326
85019
2100
4300
5999
54532
3433
144195
23767
5066
1491
81563
57574
0.9164
1.09045
1.222246667
0.99761
-1.091236667
1.099800667
1.06171
1.209779667
0.848636667
1.395943667
1.181714
1.049263333
-0.990928333
1.422600667
1.034806667
1.060176667
1.501802667
1.03772
1.127387
1.184933333
1.528689333
1.01346
1.505467667
1.602545333
1.430718
1.02884
0.93485
1.025188333
1.369707333
0.777033333
1.362185333
1.064296667
1.252566667
-0.884453
0.995337333
1.085552333
1.672899667
1.151701
1.073776
1.248740333
1.192151333
1.192893333
0.904114
1.064205667
0.966198667
4.13E-05
6.21E-05
6.26E-05
6.67E-05
6.91E-05
7.96E-05
9.14E-05
9.58E-05
0.00012
0.000125
0.000138
0.000139
0.00017
0.000189
0.000201
0.000221
0.000228
0.000236
0.000238
0.000247
0.000247
0.000248
0.000248
0.000248
0.00025
0.000258
0.000258
0.000276
0.000276
0.00028
0.000283
0.000284
0.000284
0.000284
0.00029
0.000294
0.000314
0.000314
0.000342
0.000342
0.000357
0.000362
0.000363
0.000433
0.00046
119
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 119 of 158
SAT1
SLC2A1
CHRNA1
SLC25A36
ERO1A
IL2RG
FEM1C
KIAA1715
LINC01111
ITPR1
ZNF608
RIOK3
STC2
TBXAS1
HLA-V
RAPH1
SERINC1
DAAM1
THSD4
ARRDC3
SLC25A4
GYS1
HIST1H4B
HIST2H3A
SPRY4
TNFAIP3
ATF3
GAB1
PAG1
GJA5
ATP2B4
CXCL8
CD9
ST6GALNAC2
NUPR1
OPTN
HIST1H2BG
LOC154761
LINC01269
MEST
TBC1D8B
CLDN12
IFIT3
CCRL2
SLC6A10P
6303
6513
1134
55186
30001
3561
56929
80856
101926978
3708
57507
8780
8614
6916
352962
65059
57515
23002
79875
57561
291
2997
8366
333932
81848
7128
467
2549
55824
2702
493
3576
928
10610
26471
10133
8339
154761
103695436
4232
54885
9069
3437
9034
386757
1.191193667
1.262893333
1.249809
0.861896667
0.836676667
1.102845
0.832516667
0.90398
1.168574667
1.468157333
0.952192333
1.067126667
0.87827
-1.15648
0.821450333
0.856458
0.735883333
0.966638
-0.867579
1.01734
0.771786667
0.84141
-0.815204333
-1.001076667
-0.892646667
1.219428
0.943403667
0.88936
1.297397333
-0.855519667
0.899893333
1.225013333
0.757163333
0.949474667
0.786146667
0.973102667
-0.92601
1.408936
1.067570333
-0.802136333
0.938531667
0.70811
0.838541333
0.727482333
0.8103
0.00046
0.00046
0.000551
0.000551
0.000626
0.000674
0.000683
0.000686
0.000739
0.000794
0.000854
0.000922
0.00095
0.00095
0.000995
0.00105
0.00105
0.001172
0.001181
0.001269
0.001285
0.00136
0.001364
0.001364
0.001364
0.001364
0.001393
0.001415
0.001415
0.001457
0.001464
0.001798
0.001823
0.001907
0.001957
0.002025
0.002059
0.002079
0.002085
0.002098
0.002098
0.002114
0.002116
0.002173
0.002227
120
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 120 of 158
TMEM65
C4orf3
CNOT8
STX11
ZNF618
WWP2
AK4
TSPAN1
SERTAD1
ZNF841
WFDC3
OASL
KCTD11
DHRS13
TSPAN13
LOC101927229
CD68
GALNT18
RTN3
CCL28
HIST1H3H
MXD1
SMARCD1
GABARAPL1
SLPI
YEATS2
HIST1H3A
KRTAP2-3
CD99
VKORC1
RASL11A
GEMIN5
LUCAT1
BOC
PDK1
KDM3A
IVD
APAF1
IFI44
GPR1
IL1RAP
ZNF584
LOC101927391
MARCH3
RIMKLA
157378
401152
9337
8676
114991
11060
205
10103
29950
284371
140686
8638
147040
147015
27075
101927229
968
374378
10313
56477
8357
4084
6602
23710
6590
55689
8350
730755
4267
79001
387496
25929
100505994
91653
5163
55818
3712
317
10561
2825
3556
201514
101927391
115123
284716
0.758526667
1.007005667
0.700813333
0.939413667
-0.739698667
-0.680052333
0.83012
0.748473333
1.005185
0.781798333
1.194064
0.909166333
1.310935
1.077609333
0.7108
1.277667667
0.854988667
0.879183667
0.686606667
0.907081667
-0.972419
0.899416667
-0.742956667
1.241541333
0.9161
0.84076
-1.368612667
1.082924667
0.818436667
0.561823333
-0.970543667
-0.786646667
1.485454667
0.92313
0.65947
1.009954333
-0.866308667
1.163583
0.960275333
0.886181333
0.986132
-0.71841
0.965717667
1.011080667
0.700162667
0.002227
0.002258
0.002299
0.002304
0.002439
0.002565
0.002724
0.002724
0.002729
0.002733
0.002764
0.002911
0.002925
0.002963
0.002967
0.00306
0.003066
0.003185
0.003185
0.00321
0.00321
0.00321
0.003386
0.003436
0.003436
0.003544
0.003679
0.003774
0.003884
0.003884
0.003891
0.003895
0.003895
0.003967
0.003967
0.004071
0.004101
0.004113
0.004142
0.004152
0.004188
0.004188
0.004257
0.004541
0.004541
121
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 121 of 158
UAP1
ITGB4
BACH1
VLDLR
SYTL2
FAM13A
HAS3
RIC1
TOB1
DUSP6
NUP93
MCAT
ERRFI1
ARID5B
C1orf116
SLC6A6
ATP6V1B1-AS1
TUFT1
DCTPP1
F2RL2
KPNA7
GPR176
PPP2R2A
SDCBP
ANO6
B4GALT3
OSBP2
C16orf62
ZXDC
B4GALT4
ANKRD13A
GRAMD1C
HMBS
SCFD2
CABLES1
PPP1R3B
LRP1
LINC01125
MRRF
PKP2
CD58
ANKZF1
PTPRF
GLS
RND3
6675
3691
571
7436
54843
10144
3038
57589
10140
1848
9688
27349
54206
84159
79098
6533
101927750
7286
79077
2151
402569
11245
5520
6386
196527
8703
23762
57020
79364
8702
88455
54762
3145
152579
91768
79660
4035
728537
92399
5318
965
55139
5792
2744
390
0.59838
0.903884667
0.69319
1.212292
0.99235
1.041323667
-0.782126667
0.712511
0.63722
0.636686667
-0.672573333
-0.685263333
0.61954
0.9108
0.739598667
0.690033333
-0.919199333
0.870517333
-0.754253333
0.822163
1.199428
0.898603333
0.617266667
0.597323333
0.789263333
-0.649283333
0.856493333
-0.623467
0.753407333
0.717736
0.74674
0.716117
-0.683615
-0.68214
-0.834193333
1.091034
1.016406667
1.009157667
-0.523556667
0.78476
0.815153333
0.6634
0.808204333
0.733823333
0.614526667
0.004563
0.004575
0.004744
0.004749
0.004814
0.004832
0.004832
0.004832
0.004976
0.005002
0.005022
0.005142
0.005757
0.005823
0.005823
0.005823
0.006009
0.006212
0.006216
0.006518
0.006621
0.006647
0.006859
0.006887
0.007056
0.007056
0.007063
0.007069
0.007069
0.007078
0.007138
0.007168
0.007251
0.007296
0.007516
0.007516
0.007637
0.007752
0.007808
0.007877
0.008141
0.008485
0.008589
0.00899
0.009029
122
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 122 of 158
CIART
ABI1
EHF
HIST1H2AB
HIST2H2BF
MTA1
CREB5
HIST1H1E
KIAA0040
POP5
LOC284930
PTPRH
MARC1
TIMM10
EFNA3
SHISA3
TENM4
XRCC6BP1
ADGRF4
SLC39A10
HIST1H2AG
POLE4
WDR4
PFKFB3
SPRY4-IT1
KRI1
PYGO2
TK1
BYSL
HIST1H2AI
PHF19
TSPYL5
UTP20
FADD
CLK1
HIST1H4E
PDGFA
PDK3
SLC39A6
MAP2K1
VGLL3
MRPL4
NR2C2AP
SLC31A1
CITED2
148523
10006
26298
8335
440689
9112
9586
3008
9674
51367
284930
5794
64757
26519
1944
152573
26011
91419
221393
57181
8969
56655
10785
5209
100642175
65095
90780
7083
705
8329
26147
85453
27340
8772
1195
8367
5154
5165
25800
5604
389136
51073
126382
1317
10370
0.720366667
0.615823333
-0.577843667
-0.988476667
-0.563673333
-0.705502333
0.976486667
-0.629933333
0.802503333
-0.958071333
0.748176667
0.638204
-0.612286667
-0.62263
0.834564667
-0.69375
-0.780841
-0.859903333
0.776950333
0.58611
-0.709873333
-0.582943333
-0.751724
1.055893
-0.820016
-0.563089667
-0.966636
0.590486667
-0.631236667
-0.585563333
-0.714772333
-0.8458
-0.697783333
-0.662167
0.984700667
-0.70001
1.186879667
0.830333333
1.007026667
0.658743333
0.806859667
-0.796526667
-0.642017667
0.50362
0.704176667
0.009321
0.009324
0.009324
0.009324
0.009324
0.009324
0.009818
0.010039
0.010657
0.010731
0.010751
0.010985
0.010993
0.010993
0.01107
0.011091
0.011091
0.011091
0.011268
0.011268
0.011412
0.011412
0.011412
0.011575
0.011575
0.011692
0.011721
0.011907
0.012003
0.012003
0.012003
0.012003
0.012003
0.012082
0.012219
0.012246
0.012393
0.012393
0.012579
0.012628
0.012651
0.012902
0.012947
0.012947
0.013179
123
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 123 of 158
HIST1H2BH
LOC221946
CXCR4
WDR45B
SLCO1B3
CASP4
GLIPR1
C5
CSRP2
MCM7
PLK1
ZBTB1
TGFBI
CLDND1
PINLYP
FAH
TPBG
WDR3
PIM2
RUVBL1
ZNF654
HIST1H2BM
EPHA4
HIST1H2AK
APLN
PIAS2
GPR155
ARL5B
SMPDL3B
ENO2
DHX16
HIST1H2APS4
DTWD1
SOGA1
TNIP1
RIT1
SLC27A4
PUF60
LRRN4
TSPYL2
CLIC4
SLC25A21-AS1
PMAIP1
STOML2
ANGPTL4
8345
221946
7852
56270
28234
837
11010
727
1466
4176
5347
22890
7045
56650
390940
2184
7162
10885
11040
8607
55279
8342
2043
8330
8862
9063
151556
221079
27293
2026
8449
8333
56986
140710
10318
6016
10999
22827
164312
64061
25932
100129794
5366
30968
51129
-0.801643333
-0.693859333
1.038312333
0.564046667
1.00027
0.70205
0.99288
-0.771757
0.978723333
-0.55331
-0.54997
0.622213333
0.999505333
0.508783333
0.743254333
-0.733684333
1.141633333
-0.741016667
0.71601
-0.750961333
0.831288333
-0.629403333
0.873955
-0.804624333
0.734393333
0.56686
1.037682667
0.589093333
0.710814667
0.935504667
-0.709206667
-1.143586667
-0.649361
-0.866708667
0.750568667
0.719896667
-0.631212
-0.714056667
0.830954667
0.949283333
0.57537
-0.806163
1.01349
-0.578743333
0.822247333
0.013255
0.013261
0.013272
0.013272
0.013376
0.013443
0.013638
0.013734
0.013734
0.013734
0.013734
0.013794
0.013909
0.014124
0.014124
0.014401
0.014401
0.014401
0.014529
0.014588
0.014588
0.0146
0.014898
0.014898
0.015042
0.015042
0.015052
0.015199
0.015199
0.015445
0.015657
0.01572
0.015885
0.015896
0.016023
0.016366
0.016612
0.016621
0.016974
0.016974
0.017146
0.01746
0.017546
0.017609
0.017919
124
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 124 of 158
ATF7IP
PORCN
TGFBR1
HIST1H1C
STARD4
BLCAP
PLOD2
HIST1H2BD
CAD
FOXRED2
FZD1
RAB8B
NFE2L1
RRM2
LMBRD2
MCCC2
CTSB
SNTB1
ACP6
LINC00261
TIMM13
UPRT
MCM9
CNDP2
GNAI1
SLC6A8
SPATA5
RASSF4
HOXB13
SLC4A4
SNORD63
SNRNP35
HIST1H2BJ
HIST1H3B
KMO
LRRC66
PAIP2B
PIM1
RBM45
TACC3
MAP1LC3B
CDK19
E2F4
ZNF432
TNFSF10
55729
64840
7046
3006
134429
10904
5352
3017
790
80020
8321
51762
4779
6241
92255
64087
1508
6641
51205
140828
26517
139596
254394
55748
2770
6535
166378
83937
10481
8671
26785
11066
8970
8358
8564
339977
400961
5292
129831
10460
81631
23097
1874
9668
8743
-0.5658
0.822933333
0.753236667
-1.125121333
0.722241
0.642053333
0.857056667
-0.555746667
-0.977210667
-0.656358333
0.694707
0.534543333
0.614756667
0.561676667
0.6027
-0.61722
0.670396667
0.754244333
-0.605126667
-0.832299333
-0.735734667
0.663303333
-0.769202667
-0.493126667
0.533986667
1.064123333
-0.685306667
0.794532333
-0.70176
0.538018333
-0.85072
-0.803481667
-0.853276667
-0.74309
0.787727
0.782728
0.73898
1.073476333
-0.683166
-0.63606
0.852443333
0.62151
-0.765166667
0.726530667
1.058038667
0.018319
0.018422
0.018422
0.018745
0.019387
0.019571
0.019571
0.020166
0.020222
0.020222
0.020222
0.020222
0.020819
0.020819
0.020991
0.020991
0.021465
0.021672
0.021848
0.022159
0.022159
0.022172
0.02227
0.022385
0.022385
0.022385
0.022385
0.022658
0.022771
0.022827
0.023003
0.023265
0.023332
0.023741
0.023741
0.023999
0.023999
0.023999
0.023999
0.023999
0.024346
0.024748
0.024748
0.02477
0.024934
125
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 125 of 158
GLCCI1
ST8SIA4
HIST1H4K
ITGAV
NFIL3
GBX2
USP19
KRT34
ATXN1
IL16
VPRBP
BAG3
HIST1H3C
FAT4
METTL7B
OSTF1
PCCB
ZNF823
C17orf89
UBA6-AS1
FARS2
FZD7
TP53INP1
SNHG19
KRTAP2-1
EEF2KMT
ERP44
GRWD1
EIF2B3
MTA2
KRT18
RBM19
COA7
PROSER2
SIDT1
PTPRG-AS1
IFIT1
TMEM165
SPPL2A
TULP3
CA5B
TTC5
AP2A2
HIST1H4A
IL32
113263
7903
8362
3685
4783
2637
10869
3885
6310
3603
9730
9531
8352
79633
196410
26578
5096
55552
284184
550112
10667
8324
94241
100507303
81872
196483
23071
83743
8891
9219
3875
9904
65260
254427
54847
100506994
3434
55858
84888
7289
11238
91875
161
8359
9235
1.054029667
0.914392333
-0.573649
0.636023333
0.891897667
-0.590475667
-0.780082333
0.872365667
0.806883333
-0.744979667
-0.594287
-0.587843333
-0.649737667
0.921996
0.600083333
0.578946667
-0.533553333
0.599266667
-0.537346667
0.620932333
-0.773185
0.856427667
0.563728667
-0.865107
0.713899
-0.614122
0.506336667
-0.6663
-0.575996667
-0.552863333
-0.512963333
-0.57891
-0.533993333
0.763338667
-0.712348667
0.629363667
0.977465333
0.699476667
0.60997
0.550093333
0.589686667
-0.657280333
-0.57743
-0.969803
0.642403333
0.025636
0.025636
0.025972
0.025995
0.026066
0.026648
0.026691
0.027453
0.027644
0.02787
0.028189
0.028559
0.0288
0.028978
0.029234
0.029243
0.029375
0.029375
0.029399
0.029399
0.029837
0.029856
0.029856
0.030699
0.030716
0.030884
0.030884
0.030884
0.031129
0.031238
0.03176
0.03176
0.031924
0.032541
0.032541
0.032715
0.032943
0.032943
0.033322
0.033322
0.033367
0.033367
0.033444
0.033813
0.033813
126
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 126 of 158
LRP1B
MAP3K13
ZNF593
DUSP14
CHMP1B
PPP1R15A
FLJ25758
CENPC
OLR1
DNAJC11
CDA
HEG1
TIMM9
GPATCH4
PVRL1
ABL2
PPRC1
ATP6AP1L
FAM46C
RSAD1
ADAM12
HMGA1P3
FUT11
CDC20
NFATC3
SDC4
FOXO3
LINC01291
ZSCAN21
TMEM135
HIST1H2BL
DNAJA3
AGA
ZSCAN23
C3orf52
TBL1X
SIRPG
NDUFA9
NOLC1
LINC01049
FAF1
SCAP
SNAPC1
HYOU1
OPN3
53353
9175
51042
11072
57132
23645
497049
1060
4973
55735
978
57493
26520
54865
5818
27
23082
92270
54855
55316
8038
144712
170384
991
4775
6385
2309
102724515
7589
65084
8340
9093
175
222696
79669
6907
55423
4704
9221
101927224
11124
22937
6617
10525
23596
0.721422
0.792592333
-0.698544
0.831474
0.595853333
0.628917
0.665307
0.610952667
0.909475667
-0.644606667
0.683563333
0.830946667
-0.638013333
-0.61344
-0.797876
0.644913333
-0.655669667
0.636786333
0.682366333
-0.671911333
0.697133333
-0.621598333
0.93841
-0.702276667
-0.545726667
0.712316667
0.511788
0.743123333
-0.762703667
-0.633412667
-1.070231333
-0.636969667
0.597156667
-0.534019
0.557942
-0.51909
0.781771
-0.48616
-0.55675
-0.617693
-0.479213333
-0.521846667
0.461826667
-0.498956667
0.747457667
0.033813
0.034175
0.034272
0.034896
0.035431
0.036288
0.036589
0.03667
0.03667
0.036781
0.036816
0.036816
0.036897
0.036929
0.036929
0.037129
0.037129
0.037425
0.037425
0.037425
0.037489
0.037838
0.038554
0.038614
0.038614
0.038614
0.039164
0.039164
0.039164
0.03934
0.03984
0.03999
0.040097
0.040255
0.040297
0.040297
0.040297
0.040326
0.040558
0.040804
0.041356
0.041409
0.041521
0.041741
0.041858
127
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 127 of 158
TMEM2
OR6N1
NOL10
PDCD11
PGRMC2
SIAH2
HIST2H3D
H2BFS
SPATA2
OXR1
SLC43A3
MACC1
RPS6KB2
STAP2
PGK1
REG4
CASP3
CCNDBP1
GLI3
CD24
PROX1-AS1
C4orf47
COL5A2
MORN1
TMEM30A
CYP4A11
FAM66E
NUP62CL
DUSP16
TSC22D2
LOC101929331
RAB6A
OXCT1
EIF2B5
BCL6
PHF10
HLA-L
KCTD9
MAPK7
23670
128372
79954
22984
10424
6478
653604
54145
9825
55074
29015
346389
6199
55620
5230
83998
836
23582
2737
100133941
100505832
441054
1290
79906
55754
1579
100132103
54830
80824
9819
101929331
5870
5019
8893
604
55274
3139
54793
5598
0.737682333
0.506052333
-0.547896667
-0.533026667
0.484113333
0.487963333
-0.557172
-0.450076667
-0.534406667
0.61497
0.594516667
0.787368667
-0.572683333
-0.838137333
0.488623333
-0.745922333
0.510246667
0.642256333
-0.759989667
0.751507333
-0.625519
0.691701667
-0.584638667
-0.5668
0.564236667
0.623487
0.849966333
0.627109333
0.661541333
0.557066667
0.707077
0.471616667
0.438533333
-0.769850333
0.49345
0.520549333
0.657399667
0.585745
0.503721667
0.042365
0.042714
0.042785
0.042785
0.042785
0.043261
0.04327
0.043454
0.043498
0.04352
0.04352
0.044354
0.044354
0.044361
0.044757
0.045055
0.04557
0.04557
0.045711
0.045786
0.045786
0.046378
0.046378
0.046378
0.046378
0.046433
0.046657
0.047045
0.047179
0.047407
0.047603
0.047687
0.047821
0.048291
0.048664
0.048664
0.0488
0.0488
0.0488
128
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 128 of 158
Table 2
List of perturbed Reactome pathways following FPN overexpression in C4-2 (Tet-FPN) cells
Reactome ID Description
FDR
R-HSA-69278 Cell Cycle, Mitotic
1.24E-51
R-HSA-68886 M Phase
6.52E-28
R-HSA-73886 Chromosome Maintenance
1.03E-19
R-HSATelomere Maintenance
2.61E-17
157579
R-HSADNA Double-Strand Break Repair
4.30E-17
5693532
R-HSA-69620 Cell Cycle Checkpoints
7.22E-17
R-HSA-68875 Mitotic Prophase
9.06E-16
R-HSACondensation of Prophase Chromosomes
9.76E-16
2299718
R-HSA-73894 DNA Repair
9.76E-16
R-HSA-68877 Mitotic Prometaphase
9.76E-16
R-HSARHO GTPase Effectors
1.19E-15
195258
R-HSA-69190 DNA strand elongation
1.94E-15
R-HSAHomology Directed Repair
2.12E-15
5693538
R-HSA-69242 S Phase
3.79E-15
R-HSATranscriptional regulation by small RNAs
1.62E-14
5578749
R-HSADeposition of new CENPA-containing nucleosomes at the
2.12E-14
606279
centromere
R-HSANucleosome assembly
2.12E-14
774815
R-HSA-69306 DNA Replication
2.42E-14
R-HSA-69481 G2/M Checkpoints
3.58E-14
R-HSACellular Senescence
3.78E-14
2559583
R-HSACellular responses to stress
4.41E-14
2262752
R-HSAResolution of Sister Chromatid Cohesion
5.44E-14
2500257
R-HSADNA methylation
1.36E-13
5334118
R-HSAHDR through Homologous Recombination (HR) or Single
1.91E-13
5693567
Strand Annealing (SSA)
R-HSAERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA
2.14E-13
427389
expression
R-HSA-73728 RNA Polymerase I Promoter Opening
2.14E-13
R-HSA-69239 Synthesis of DNA
2.21E-13
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 129 of 158
R-HSA5625886
R-HSA453279
R-HSA212300
R-HSA-69206
R-HSA-68962
R-HSA2559582
R-HSA912446
R-HSA5250913
R-HSA194315
R-HSA2555396
R-HSA3247509
R-HSA4839726
R-HSA5250924
R-HSA176187
R-HSA427359
R-HSA-68882
R-HSA2559586
R-HSA3214815
R-HSA2559580
R-HSA2467813
R-HSA504046
R-HSA-73777
R-HSA211000
R-HSA3214858
R-HSA5625740
129
2.57E-13
Activated PKN1 stimulates transcription of AR (androgen
receptor) regulated genes KLK2 and KLK3
Mitotic G1-G1/S phases
2.82E-13
PRC2 methylates histones and DNA
3.38E-13
G1/S Transition
Activation of the pre-replicative complex
Senescence-Associated Secretory Phenotype (SASP)
3.45E-13
3.58E-13
5.79E-13
Meiotic recombination
6.95E-13
Positive epigenetic regulation of rRNA expression
8.19E-13
Signaling by Rho GTPases
9.25E-13
Mitotic Metaphase and Anaphase
1.63E-12
Chromatin modifying enzymes
1.90E-12
Chromatin organization
1.90E-12
B-WICH complex positively regulates rRNA expression
1.98E-12
Activation of ATR in response to replication stress
2.03E-12
SIRT1 negatively regulates rRNA Expression
3.20E-12
Mitotic Anaphase
DNA Damage/Telomere Stress Induced Senescence
3.52E-12
3.62E-12
HDACs deacetylate histones
5.06E-12
Oxidative Stress Induced Senescence
5.92E-12
Separation of Sister Chromatids
4.67E-11
RNA Polymerase I, RNA Polymerase III, and Mitochondrial
Transcription
RNA Polymerase I Chain Elongation
Gene Silencing by RNA
9.32E-11
9.61E-11
1.18E-10
RMTs methylate histone arginines
1.28E-10
RHO GTPases activate PKNs
1.31E-10
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 130 of 158
R-HSA-73864
R-HSA5663220
R-HSA-73854
R-HSA3214847
R-HSA212165
R-HSA5693607
R-HSA171306
R-HSA5617472
R-HSA5619507
R-HSA113510
R-HSA174417
R-HSA-69473
R-HSA180786
R-HSA176974
R-HSA1500620
R-HSA174411
R-HSA-69091
R-HSA-69109
R-HSA201722
R-HSA5250941
R-HSA3108232
R-HSA427413
R-HSA977225
R-HSA2990846
R-HSA5693571
R-HSA-
RNA Polymerase I Transcription
RHO GTPases Activate Formins
130
2.47E-10
3.36E-10
RNA Polymerase I Promoter Clearance
HATs acetylate histones
4.53E-10
5.11E-10
Epigenetic regulation of gene expression
5.44E-10
Processing of DNA double-strand break ends
8.17E-10
Packaging Of Telomere Ends
1.55E-09
Activation of anterior HOX genes in hindbrain development
during early embryogenesis
Activation of HOX genes during differentiation
1.70E-09
1.70E-09
E2F mediated regulation of DNA replication
3.48E-09
Telomere C-strand (Lagging Strand) Synthesis
3.68E-09
G2/M DNA damage checkpoint
Extension of Telomeres
4.02E-09
4.02E-09
Unwinding of DNA
4.48E-09
Meiosis
4.88E-09
Polymerase switching on the C-strand of the telomere
7.97E-09
Polymerase switching
Leading Strand Synthesis
Formation of the beta-catenin:TCF transactivating complex
7.97E-09
7.97E-09
1.33E-08
Negative epigenetic regulation of rRNA expression
1.40E-08
SUMO E3 ligases SUMOylate target proteins
1.75E-08
NoRC negatively regulates rRNA expression
1.75E-08
Amyloid fiber formation
2.79E-08
SUMOylation
2.79E-08
Nonhomologous End-Joining (NHEJ)
8.10E-08
Transcriptional Regulation by TP53
1.03E-07
131
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 131 of 158
3700989
R-HSA-69186
R-HSA5368286
R-HSA5419276
R-HSA-68874
R-HSA-69002
R-HSA5368287
R-HSA453274
R-HSA5389840
R-HSA110373
R-HSA-69275
R-HSA5693606
R-HSA-73884
R-HSA-73933
R-HSA5693565
R-HSA-69205
R-HSA4615885
R-HSA1221632
R-HSA5651801
R-HSA110313
R-HSA-72203
R-HSA5685942
R-HSA5696397
R-HSA1852241
R-HSA174143
R-HSA453276
R-HSA2980766
R-HSA-
Lagging Strand Synthesis
Mitochondrial translation initiation
1.03E-07
1.34E-07
Mitochondrial translation termination
1.34E-07
M/G1 Transition
DNA Replication Pre-Initiation
Mitochondrial translation
1.91E-07
1.91E-07
2.10E-07
Mitotic G2-G2/M phases
3.24E-07
Mitochondrial translation elongation
3.44E-07
Resolution of AP sites via the multiple-nucleotide patch
replacement pathway
G2/M Transition
DNA Double Strand Break Response
4.30E-07
5.26E-07
7.05E-07
Base Excision Repair
Resolution of Abasic Sites (AP sites)
Recruitment and ATM-mediated phosphorylation of repair
and signaling proteins at DNA double strand breaks
G1/S-Specific Transcription
SUMOylation of DNA replication proteins
1.26E-06
1.26E-06
1.86E-06
Meiotic synapsis
2.32E-06
PCNA-Dependent Long Patch Base Excision Repair
2.93E-06
Translesion synthesis by Y family DNA polymerases bypasses
lesions on DNA template
Processing of Capped Intron-Containing Pre-mRNA
HDR through Homologous Recombination (HRR)
4.08E-06
4.89E-06
6.88E-06
Gap-filling DNA repair synthesis and ligation in GG-NER
7.71E-06
Organelle biogenesis and maintenance
8.84E-06
APC/C-mediated degradation of cell cycle proteins
1.02E-05
Regulation of mitotic cell cycle
1.02E-05
Nuclear Envelope Breakdown
1.08E-05
Mitochondrial protein import
1.22E-05
1.95E-06
1.98E-06
132
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 132 of 158
1268020
R-HSA-73893
R-HSA5656169
R-HSA3214841
R-HSA3214842
R-HSA3108214
R-HSA1538133
R-HSA-69304
R-HSA6791312
R-HSA-69166
R-HSA191859
R-HSA194441
R-HSA-69300
R-HSA1428517
R-HSA-68949
R-HSA-69052
R-HSA4570464
R-HSA2514853
R-HSA-69183
R-HSA110314
R-HSA165054
R-HSA-72163
R-HSA2565942
R-HSA-72172
R-HSA163200
R-HSA177243
R-HSA3301854
R-HSA-70153
R-HSA-
DNA Damage Bypass
Termination of translesion DNA synthesis
1.29E-05
1.45E-05
PKMTs methylate histone lysines
1.91E-05
HDMs demethylate histones
1.97E-05
SUMOylation of DNA damage response and repair proteins
3.93E-05
G0 and Early G1
5.17E-05
Regulation of DNA replication
TP53 Regulates Transcription of Cell Cycle Genes
5.40E-05
5.57E-05
Removal of the Flap Intermediate
snRNP Assembly
5.60E-05
6.42E-05
Metabolism of non-coding RNA
6.42E-05
Removal of licensing factors from origins
The citric acid (TCA) cycle and respiratory electron transport
6.89E-05
6.94E-05
Orc1 removal from chromatin
Switching of origins to a post-replicative state
SUMOylation of RNA binding proteins
0.000121115
0.000121115
0.000124225
Condensation of Prometaphase Chromosomes
0.000129138
Processive synthesis on the lagging strand
Recognition of DNA damage by PCNA-containing replication
complex
Rev-mediated nuclear export of HIV RNA
0.000132527
0.000132527
mRNA Splicing - Major Pathway
Regulation of PLK1 Activity at G2/M Transition
0.000176478
0.00025464
0.000132527
mRNA Splicing
0.000259924
Respiratory electron transport, ATP synthesis by chemiosmotic 0.000317637
coupling, and heat production by uncoupling proteins.
Interactions of Rev with host cellular proteins
0.000336232
Nuclear Pore Complex (NPC) Disassembly
0.000336232
Glucose transport
Interactions of Vpr with host cellular proteins
0.00037875
0.000518525
133
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 133 of 158
176033
R-HSA5689880
R-HSA5655862
R-HSA5656121
R-HSA6804114
R-HSA6790901
R-HSA5696400
R-HSA8852135
R-HSA983189
R-HSA159230
R-HSA176408
R-HSA611105
R-HSA168274
R-HSA168333
R-HSA5693579
R-HSA113507
R-HSA-69273
R-HSA180746
R-HSA113501
R-HSA110312
R-HSA8856688
R-HSA159234
R-HSA189200
R-HSA159227
Ub-specific processing proteases
0.000560434
Translesion synthesis by POLK
0.000570928
Translesion synthesis by POLI
0.000570928
TP53 Regulates Transcription of Genes Involved in G2 Cell
Cycle Arrest
rRNA modification in the nucleus and cytosol
0.000570928
0.000590749
Dual Incision in GG-NER
0.000676927
Protein ubiquitination
0.000799299
Kinesins
0.000799299
Transport of the SLBP Dependant Mature mRNA
0.000935076
Regulation of APC/C activators between G1/S and early
anaphase
Respiratory electron transport
0.001097918
0.001097918
Export of Viral Ribonucleoproteins from Nucleus
0.001130053
NEP/NS2 Interacts with the Cellular Export Machinery
0.001130053
Homologous DNA Pairing and Strand Exchange
0.001202875
E2F-enabled inhibition of pre-replication complex formation
0.001554171
Cyclin A/B1 associated events during G2/M transition
Nuclear import of Rev protein
0.001604785
0.001705621
Inhibition of replication initiation of damaged DNA by
RB1/E2F1
Translesion synthesis by REV1
0.001899604
0.001937854
Golgi-to-ER retrograde transport
0.002025058
Transport of Mature mRNAs Derived from Intronless
Transcripts
Hexose transport
0.002154009
0.002361141
Transport of the SLBP independent Mature mRNA
0.002460776
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 134 of 158
R-HSA180910
R-HSA8854518
R-HSA176814
R-HSA5633008
R-HSA-68867
R-HSA5688426
R-HSA380270
R-HSA380287
R-HSA3371556
R-HSA168325
R-HSA168271
R-HSA170822
R-HSA-69656
R-HSA159231
R-HSA5693616
R-HSA176409
R-HSA389957
R-HSA5696399
R-HSA6782210
R-HSA5696398
R-HSA156711
R-HSA389958
R-HSA6811442
R-HSA168276
Vpr-mediated nuclear import of PICs
134
0.002460776
AURKA Activation by TPX2
0.002619612
Activation of APC/C and APC/C:Cdc20 mediated degradation
of mitotic proteins
TP53 Regulates Transcription of Cell Death Genes
0.002856561
0.003040265
Assembly of the pre-replicative complex
Deubiquitination
0.003262311
0.003363739
Recruitment of mitotic centrosome proteins and complexes
0.003557474
Centrosome maturation
0.003557474
Cellular response to heat stress
0.003878643
Viral Messenger RNA Synthesis
0.003919551
Transport of Ribonucleoproteins into the Host Nucleus
0.004402772
Regulation of Glucokinase by Glucokinase Regulatory Protein
0.004402772
Cyclin A:Cdk2-associated events at S phase entry
Transport of Mature mRNA Derived from an Intronless
Transcript
Presynaptic phase of homologous DNA pairing and strand
exchange
APC/C:Cdc20 mediated degradation of mitotic proteins
0.004900999
0.005084008
0.005478434
Prefoldin mediated transfer of substrate to CCT/TriC
0.005478434
Global Genome Nucleotide Excision Repair (GG-NER)
0.005478434
Gap-filling DNA repair synthesis and ligation in TC-NER
0.005478434
Nucleotide Excision Repair
0.005478434
Polo-like kinase mediated events
0.006006769
Cooperation of Prefoldin and TriC/CCT in actin and tubulin
folding
Intra-Golgi and retrograde Golgi-to-ER traffic
0.006074087
NS1 Mediated Effects on Host Pathways
0.006580875
0.005084008
0.00642775
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 135 of 158
R-HSA8854214
R-HSA499943
R-HSA8862803
R-HSA8863678
R-HSA5633007
R-HSA5357801
R-HSA110320
R-HSA109581
R-HSA389960
R-HSA380320
R-HSA6811436
R-HSA140342
R-HSA211227
R-HSA6804116
R-HSA168253
R-HSA-69231
R-HSA-69236
R-HSA174437
R-HSA141405
R-HSA141430
R-HSA-69202
R-HSA-72312
R-HSA6781827
R-HSA-70614
R-HSA3371453
R-HSA-
TBC/RABGAPs
135
0.006580875
Synthesis and interconversion of nucleotide di- and
triphosphates
Deregulated CDK5 triggers multiple neurodegenerative
pathways in Alzheimer's disease models
Neurodegenerative Diseases
0.006580875
Regulation of TP53 Activity
0.006858826
Programmed Cell Death
0.006983782
Translesion Synthesis by POLH
0.008081474
Apoptosis
0.008884397
Formation of tubulin folding intermediates by CCT/TriC
0.009736152
Recruitment of NuMA to mitotic centrosomes
0.006580875
0.006580875
0.0107913
COPI-independent Golgi-to-ER retrograde traffic
0.010895125
Apoptosis induced DNA fragmentation
0.010895125
Activation of DNA fragmentation factor
0.010895125
TP53 Regulates Transcription of Genes Involved in G1 Cell
Cycle Arrest
Host Interactions with Influenza Factors
0.010895125
Cyclin D associated events in G1
G1 Phase
Removal of the Flap Intermediate from the C-strand
0.01099017
0.01099017
0.011222629
Inhibition of the proteolytic activity of APC/C required for the
onset of anaphase by mitotic spindle checkpoint components
Inactivation of APC/C via direct inhibition of the APC/C
complex
Cyclin E associated events during G1/S transition
rRNA processing
Transcription-Coupled Nucleotide Excision Repair (TC-NER)
0.011818522
0.012766038
0.013560789
0.013764606
Amino acid synthesis and interconversion (transamination)
Regulation of HSF1-mediated heat shock response
0.014208014
0.015192522
Dual incision in TC-NER
0.015192522
0.01099017
0.011818522
136
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 136 of 158
6782135
R-HSA6804756
R-HSA2132295
R-HSA162909
R-HSA-69618
R-HSA4419969
R-HSA8866654
R-HSA179419
R-HSA380259
R-HSA380284
R-HSA179409
R-HSA390471
R-HSA187577
R-HSA174414
R-HSA-68689
R-HSA-75153
R-HSA-15869
R-HSA-69615
R-HSA8852276
R-HSA176412
R-HSA174178
R-HSA174184
R-HSA-72202
R-HSA5689901
R-HSA6811434
R-HSA983231
R-HSA-
Regulation of TP53 Activity through Phosphorylation
0.015388625
MHC class II antigen presentation
0.016145155
Host Interactions of HIV factors
0.016565644
Mitotic Spindle Checkpoint
Depolymerisation of the Nuclear Lamina
0.016950507
0.017304042
E3 ubiquitin ligases ubiquitinate target proteins
0.017490314
APC:Cdc20 mediated degradation of cell cycle proteins prior to 0.017588425
satisfation of the cell cycle checkpoint
Loss of Nlp from mitotic centrosomes
0.017801167
Loss of proteins required for interphase microtubule
organization from the centrosome
APC-Cdc20 mediated degradation of Nek2A
0.017801167
0.017893107
Association of TriC/CCT with target proteins during
biosynthesis
SCF(Skp2)-mediated degradation of p27/p21
0.017893107
Processive synthesis on the C-strand of the telomere
0.019244738
CDC6 association with the ORC:origin complex
Apoptotic execution phase
Metabolism of nucleotides
G1/S DNA Damage Checkpoints
The role of GTSE1 in G2/M progression after G2 checkpoint
0.019244738
0.023132216
0.023438203
0.025170696
0.028324793
Phosphorylation of the APC/C
0.030640567
APC/C:Cdh1 mediated degradation of Cdc20 and other
APC/C:Cdh1 targeted proteins in late mitosis/early G1
Cdc20:Phospho-APC/C mediated degradation of Cyclin A
0.031323509
Transport of Mature Transcript to Cytoplasm
Metalloprotease DUBs
0.031323509
0.031604499
COPI-dependent Golgi-to-ER retrograde traffic
0.035615475
Factors involved in megakaryocyte development and platelet
production
Cholesterol biosynthesis
0.042429379
0.019244738
0.031323509
0.043585924
137
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 137 of 158
191273
R-HSA5689603
R-HSA201681
R-HSA2995383
R-HSA2995410
R-HSA5358565
R-HSA-68884
R-HSA3214815
R-HSA427389
R-HSA-73728
R-HSA212300
R-HSA5334118
R-HSA5625886
R-HSA2299718
R-HSA427359
R-HSA201722
R-HSA3214847
R-HSA977225
R-HSA2559582
R-HSA5250913
R-HSA-73854
R-HSA912446
R-HSA-73864
R-HSA5250924
R-HSA-73777
R-HSA5578749
UCH proteinases
0.046680862
TCF dependent signaling in response to WNT
0.047663992
Initiation of Nuclear Envelope Reformation
0.04964476
Nuclear Envelope Reassembly
0.04964476
Mismatch repair (MMR) directed by MSH2:MSH6 (MutSalpha)
0.04964476
Mitotic Telophase/Cytokinesis
HDACs deacetylate histones
0.04964476
1.66E-16
ERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA
expression
RNA Polymerase I Promoter Opening
PRC2 methylates histones and DNA
1.84E-13
6.03E-13
7.50E-13
DNA methylation
7.95E-13
Activated PKN1 stimulates transcription of AR (androgen
receptor) regulated genes KLK2 and KLK3
Condensation of Prophase Chromosomes
8.50E-13
8.50E-13
SIRT1 negatively regulates rRNA Expression
1.05E-12
Formation of the beta-catenin:TCF transactivating complex
4.36E-12
HATs acetylate histones
1.88E-11
Amyloid fiber formation
3.48E-11
Senescence-Associated Secretory Phenotype (SASP)
4.60E-11
Positive epigenetic regulation of rRNA expression
5.89E-11
RNA Polymerase I Promoter Clearance
Meiotic recombination
1.32E-10
1.32E-10
RNA Polymerase I Transcription
B-WICH complex positively regulates rRNA expression
1.76E-10
1.91E-10
RNA Polymerase I Chain Elongation
Transcriptional regulation by small RNAs
2.30E-10
4.94E-10
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 138 of 158
R-HSA5625740
R-HSA3247509
R-HSA4839726
R-HSA3214858
R-HSA5617472
R-HSA5619507
R-HSA427413
R-HSA212165
R-HSA504046
R-HSA5250941
R-HSA2559583
R-HSA3214842
R-HSA-68875
R-HSA1500620
R-HSA2559586
R-HSA211000
R-HSA2559580
R-HSA606279
R-HSA774815
R-HSA171306
R-HSA157579
R-HSA2262752
R-HSA1266695
R-HSA-
RHO GTPases activate PKNs
138
5.28E-10
Chromatin modifying enzymes
5.63E-10
Chromatin organization
5.63E-10
RMTs methylate histone arginines
2.46E-09
Activation of anterior HOX genes in hindbrain development
during early embryogenesis
Activation of HOX genes during differentiation
2.65E-09
2.65E-09
NoRC negatively regulates rRNA expression
4.86E-09
Epigenetic regulation of gene expression
5.96E-09
RNA Polymerase I, RNA Polymerase III, and Mitochondrial
Transcription
Negative epigenetic regulation of rRNA expression
7.60E-09
Cellular Senescence
8.89E-09
HDMs demethylate histones
1.17E-08
Mitotic Prophase
Meiosis
1.64E-08
2.66E-08
DNA Damage/Telomere Stress Induced Senescence
3.39E-08
Gene Silencing by RNA
3.63E-08
Oxidative Stress Induced Senescence
4.63E-08
Deposition of new CENPA-containing nucleosomes at the
centromere
Nucleosome assembly
7.62E-07
7.62E-07
Packaging Of Telomere Ends
8.58E-07
Telomere Maintenance
3.73E-06
Cellular responses to stress
4.31E-06
Interleukin-7 signaling
5.01E-06
PKMTs methylate histone lysines
5.75E-06
7.60E-09
139
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 139 of 158
3214841
R-HSA-73886 Chromosome Maintenance
R-HSATCF dependent signaling in response to WNT
201681
R-HSASignaling by Wnt
195721
R-HSAMeiotic synapsis
1221632
R-HSARHO GTPase Effectors
195258
R-HSANonhomologous End-Joining (NHEJ)
5693571
R-HSA-68886 M Phase
R-HSARecruitment and ATM-mediated phosphorylation of repair
5693565
and signaling proteins at DNA double strand breaks
R-HSADNA Double Strand Break Response
5693606
R-HSAUb-specific processing proteases
5689880
R-HSATP53 Regulates Transcription of Cell Death Genes
5633008
R-HSA-69473 G2/M DNA damage checkpoint
R-HSA-69278 Cell Cycle, Mitotic
R-HSAProcessing of DNA double-strand break ends
5693607
R-HSAApoptosis induced DNA fragmentation
140342
R-HSAActivation of DNA fragmentation factor
211227
R-HSADeubiquitination
5688426
R-HSASyndecan interactions
3000170
R-HSAHDR through Homologous Recombination (HR) or Single
5693567
Strand Annealing (SSA)
R-HSASignaling by Rho GTPases
194315
R-HSAE3 ubiquitin ligases ubiquitinate target proteins
8866654
R-HSAHomology Directed Repair
5693538
R-HSACollagen formation
1474290
R-HSARAF-independent MAPK1/3 activation
112409
Overlapping Pathways in all 3 Tet-FPN cell lines
2.17E-05
2.24E-05
2.62E-05
8.72E-05
0.000192328
0.000270089
0.000380779
0.000744218
0.000823816
0.001322678
0.003030286
0.003816622
0.004330856
0.004847356
0.005773181
0.005773181
0.0057772
0.011173809
0.012552314
0.014788738
0.014831844
0.017737031
0.04013391
0.049764563
140
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 140 of 158
Reactome
ID
R-HSA69278
R-HSA5693567
R-HSA5693538
R-HSA68886
R-HSA2559582
Description
Cell Cycle, Mitotic
HDR through Homologous Recombination (HR) or Single Strand
Annealing (SSA)
Homology Directed Repair
M Phase
Senescence-Associated Secretory Phenotype (SASP)
LNCaP Tet-FPN and C4-2 Tet-FPN overlapping Pathways
Reactome
ID
Description
R-HSAG0 and Early G1
1538133
R-HSACell Cycle, Mitotic
69278
R-HSATP53 Regulates Transcription of Genes Involved in G2 Cell Cycle Arrest
6804114
R-HSAAPC/C-mediated degradation of cell cycle proteins
174143
R-HSARegulation of mitotic cell cycle
453276
R-HSATP53 Regulates Transcription of Cell Cycle Genes
6791312
R-HSACyclin A/B1 associated events during G2/M transition
69273
R-HSAHDR through Homologous Recombination (HR) or Single Strand
5693567
Annealing (SSA)
R-HSACell Cycle Checkpoints
69620
R-HSAHomology Directed Repair
5693538
R-HSAAPC/C:Cdc20 mediated degradation of mitotic proteins
176409
R-HSAActivation of APC/C and APC/C:Cdc20 mediated degradation of mitotic
176814
proteins
R-HSAMitotic G1-G1/S phases
453279
R-HSAM Phase
68886
141
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 141 of 158
R-HSA2514853
R-HSA3108232
R-HSA5693532
R-HSA2990846
R-HSA2559582
R-HSA3700989
Condensation of Prometaphase Chromosomes
SUMO E3 ligases SUMOylate target proteins
DNA Double-Strand Break Repair
SUMOylation
Senescence-Associated Secretory Phenotype (SASP)
Transcriptional Regulation by TP53
LNCaP Tet-FPN and PC3 Tet-FPN overlapping Pathways
Reactome
Description
ID
R-HSACell Cycle, Mitotic
69278
R-HSAHDR through Homologous Recombination (HR) or Single Strand
5693567
Annealing (SSA)
R-HSAHomology Directed Repair
5693538
R-HSAM Phase
68886
R-HSASenescence-Associated Secretory Phenotype (SASP)
2559582
C4-2 Tet-FPN and PC3 Tet-FPN overlapping Pathways
Reactome
Description
ID
R-HSAHDACs deacetylate histones
3214815
R-HSAERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA expression
427389
R-HSARNA Polymerase I Promoter Opening
73728
R-HSAPRC2 methylates histones and DNA
212300
R-HSADNA methylation
5334118
R-HSAActivated PKN1 stimulates transcription of AR (androgen receptor)
5625886
regulated genes KLK2 and KLK3
R-HSACondensation of Prophase Chromosomes
2299718
142
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 142 of 158
R-HSA427359
R-HSA201722
R-HSA3214847
R-HSA977225
R-HSA2559582
R-HSA5250913
R-HSA73854
R-HSA912446
R-HSA73864
R-HSA5250924
R-HSA73777
R-HSA5578749
R-HSA5625740
R-HSA3247509
R-HSA4839726
R-HSA3214858
R-HSA5617472
R-HSA5619507
R-HSA427413
R-HSA212165
R-HSA504046
R-HSA5250941
R-HSA2559583
SIRT1 negatively regulates rRNA Expression
Formation of the beta-catenin:TCF transactivating complex
HATs acetylate histones
Amyloid fiber formation
Senescence-Associated Secretory Phenotype (SASP)
Positive epigenetic regulation of rRNA expression
RNA Polymerase I Promoter Clearance
Meiotic recombination
RNA Polymerase I Transcription
B-WICH complex positively regulates rRNA expression
RNA Polymerase I Chain Elongation
Transcriptional regulation by small RNAs
RHO GTPases activate PKNs
Chromatin modifying enzymes
Chromatin organization
RMTs methylate histone arginines
Activation of anterior HOX genes in hindbrain development during
early embryogenesis
Activation of HOX genes during differentiation
NoRC negatively regulates rRNA expression
Epigenetic regulation of gene expression
RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Negative epigenetic regulation of rRNA expression
Cellular Senescence
143
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 143 of 158
R-HSA3214842
R-HSA68875
R-HSA1500620
R-HSA2559586
R-HSA211000
R-HSA2559580
R-HSA606279
R-HSA774815
R-HSA171306
R-HSA157579
R-HSA2262752
R-HSA3214841
R-HSA73886
R-HSA201681
R-HSA1221632
R-HSA195258
R-HSA5693571
R-HSA68886
R-HSA5693565
R-HSA5693606
R-HSA5689880
R-HSA5633008
R-HSA69473
HDMs demethylate histones
Mitotic Prophase
Meiosis
DNA Damage/Telomere Stress Induced Senescence
Gene Silencing by RNA
Oxidative Stress Induced Senescence
Deposition of new CENPA-containing nucleosomes at the centromere
Nucleosome assembly
Packaging Of Telomere Ends
Telomere Maintenance
Cellular responses to stress
PKMTs methylate histone lysines
Chromosome Maintenance
TCF dependent signaling in response to WNT
Meiotic synapsis
RHO GTPase Effectors
Nonhomologous End-Joining (NHEJ)
M Phase
Recruitment and ATM-mediated phosphorylation of repair and
signaling proteins at DNA double strand breaks
DNA Double Strand Break Response
Ub-specific processing proteases
TP53 Regulates Transcription of Cell Death Genes
G2/M DNA damage checkpoint
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 144 of 158
R-HSA69278
R-HSA5693607
R-HSA140342
R-HSA211227
R-HSA5688426
R-HSA5693567
R-HSA194315
R-HSA8866654
R-HSA5693538
Cell Cycle, Mitotic
144
Processing of DNA double-strand break ends
Apoptosis induced DNA fragmentation
Activation of DNA fragmentation factor
Deubiquitination
HDR through Homologous Recombination (HR) or Single Strand
Annealing (SSA)
Signaling by Rho GTPases
E3 ubiquitin ligases ubiquitinate target proteins
Homology Directed Repair
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 145 of 158
Table 3: Sequences of primers used for RT-qPCR
145
Genes
Forward (5’-3’)
Reverse (5’-3’)
p21
cgctctacatcttctgccttagtc
gaacctctcattcaaccgcctag
Cyclin A1
ctggttagttgaagtaggagaag
ttggtgtaggtatcatctgtaatg
Cyclin B1
ttggttgatactgcctctcc
tctgactgcttgctcttcc
Cyclin D1
tgaactacctggaccgcttc
agcttgttcaccaggagcag
Cyclin E
aactgtgtcaagtggatgg
ctgcttcttaccgctctg
GAPDH
gaaggtgaaggtcggagtc
gaagatggtgatgggatttc
GADD34
gaggaagaggaagctgctga
tttctggcctttaggggagt
GADD45a
gcgagaacgacatcaacatc
tcccggcaaaaacaaataag
GADD45B
cagaagatgcagacggtgac
ggactggatgagcgtgaagt
GADD45G
tacgctgatccaggctttct
aacaggctgagcttctccaa
GADD153
aggaggaagaccaagggaga
accattcggtcaatcagagc
KFL6
tcgggagaaaaaggaggaat
ctgaccaaaacttcgccaat
ATF4
ttcaccttcttacaacctcttc
gctcatacagatgccactatc
sXBP1
ctgagtccgaatcaggtgcag
atccatggggagatgttctgg
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 146 of 158
146
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 147 of 158
147
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 148 of 158
148
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 149 of 158
149
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 150 of 158
150
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 151 of 158
151
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 152 of 158
152
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 153 of 158
153
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 154 of 158
154
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 155 of 158
155
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 156 of 158
156
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 157 of 158
157
Antioxidants and Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (DOI: 10.1089/ars.2017.7023)
This paper has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Antioxidants & Redox Signaling
Effects of ferroportin-mediated iron depletion in cells representative of different histological subtypes of prostate cancer (doi: 10.1089/ars.2017.7023)
This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.
Downloaded by Kings College London-journal Section from online.liebertpub.com at 10/25/17. For personal use only.
Page 158 of 158
158
Документ
Категория
Без категории
Просмотров
7
Размер файла
4 411 Кб
Теги
ars, 2017, 7023
1/--страниц
Пожаловаться на содержимое документа