close

Вход

Забыли?

вход по аккаунту

?

iet-nbt.2016.0213

код для вставкиСкачать
IET Nanobiotechnology
Research Article
Biosynthesis of nanosilver using Chaetomium
globosum and its application to control
Fusarium wilt of tomato in the greenhouse
ISSN 1751-8741
Received on 27th October 2016
Revised 16th February 2017
Accepted on 19th February 2017
E-First on 26th July 2017
doi: 10.1049/iet-nbt.2016.0213
www.ietdl.org
Adel K. Madbouly1 , Mohamed S. Abdel-Aziz2, Mosaad A. Abdel-Wahhab3
1Microbiology
Department, Faculty of Science, University of Ain Shams, Cairo, Egypt
Chemistry Department, National Research Center, Giza, Egypt
3Food Toxicology and Contaminants Department, National Research Center, Dokki, Giza, Egypt
E-mail: adelkamelmadbouly@yahoo.com
2Microbial
Abstract: Fusarium wilt of tomato (Lycopersicon esculentum) caused by Fusarium oxysporum f. sp. lycopersici is one of the
most important diseases that affect this crop worldwide. This study aimed to biosynthesise nanosilver (AgNPs) using
Chaetomium globosum, to evaluate its in vitro antifungal activity against pathogenic F. oxysporum and in vivo control of tomato
seedlings wilt in the greenhouse. AgNPs was tested for its in vitro antifungal potential against F. oxysporum using poisoned food
technique on three different growth media, agar well diffusion assay, inhibition of colony formation (CFU), and tested for its
potency to control seedlings wilt upon its use at different concentrations (50, 100 and 500 mg/l) and for different incubation
periods (0, 1, 2 and 4 h). Results indicated that C. globosum succeeded to biosynthesise AgNPs with maximum UV/vis
absorbance around 420–450 nm, spherical in shape with particle size of 11–14 nm according to Transmittance electron
microscope and displayed high purity recorded through X-ray diffraction (XRD). In vitro studies revealed high antifungal activity
of AgNPs against F. oxysporum noticed especially at a concentration of 500 mg/l and after incubation period for 4 h. The CFU of
F. oxysporum on potato dextrose agar (PDA) medium decreased significantly on increasing the concentration and time of
incubation with AgNPs. In the greenhouse, AgNPs caused appreciable enhancement in the growth parameters of tomato
seedlings such as; root, shoot fresh weight, and height of seedlings in soil infested with F. oxysporum compared with the control.
In addition, AgNPs reduced the severity of wilt disease by 90% observed through decreasing the number of wilted seedlings
especially after placing their roots in 500 mg/l of AgNPs suspension for 4 h prior to soil infestation with the pathogen. This study
recorded for the first time that C. globosum has the ability to synthesise AgNPs which showed significant in vivo antifungal
potential observed through control of Fusarium wilt of tomato seedlings, in addition to enhancing their growth parameters in the
greenhouse.
1 Introduction
Tomato plant is a worldwide economic crop which is prone to
infection by various phytopathogenic fungi. These fungi cause
deleterious diseases leading to spoilage and subsequent losses in
yield of this crop in the field. Wilt caused by Fusarium oxysporum
is a deadly vascular disease mostly in plants belonging to
solanaceae family [1]. This is a destructive disease of tomato and
lettuce in several countries and gained significant concern to
growers as it causes severe losses in production, prolonged survival
of this pathogen in soil and generation of new resistant races [2].
However, Ahmed et al. [3] pointed that this serious disease could
be reduced by using resistant tomato cultivars and synthetic
fungicides
Control of infectious plant diseases is the most important
concern of crop production. Recently, resistance to chemical
fungicides by phytopathogenic fungi has become an important
problem [4]. According to [5], manipulation of new mechanisms
for disease control is urgently required and the development of
nanopesticides can help to control different plant diseases. The
authors [6, 7] stated that the use of nanomaterials has been
considered as an alternative method to control phytopathogens. In
previous study, Jo et al. [8] explained that multiple modes of action
of these nanoparticles focusing mainly on wide range of biological
pathways in microorganisms provide an important solution for
avoiding the development of pathogen resistance as observed upon
using chemical control of plant diseases.
One of the most important nanoparticles used in the control of
plant diseases is nanosilver (AgNPs) which penetrate efficiently
into the microbial cells and low concentrations of these AgNPs
would be sufficient for their control [9]. In addition, AgNPs has
lower toxicity to humans and animals compared with synthetic
IET Nanobiotechnol., 2017, Vol. 11 Iss. 6, pp. 702-708
© The Institution of Engineering and Technology 2017
fungicides [10]. Previously, Ingle et al. [11] declared that AgNPs
have more advantages than ionic silver as they have lower toxicity
and greater antimicrobial activities as a result of their large surface
area and lower volume hence better contact with the surface of
microorganisms.
Ultraviolet irradiation and photochemical reduction methods
have been used successfully to synthesise nanoparticles but they
were expensive and involve the use of deleterious chemicals [12].
However, Roy et al. [13] confirmed that microbially synthesised
nanoparticles were ecofriendly, reliable, biocompatible and more
economic than chemical techniques.
According to [14], different types of microorganisms such as
bacteria, yeast, mould fungi, and algae have shown capabilities for
synthesising various nanoparticles such as silver, gold, and
palladium. The ability of mould fungi to grow on readily available
and non-expensive substrates, in addition to their abilities to
produce wide range of interesting metabolites caused significant
concern for their use in biotechnological applications [15]. Mould
fungi such as F. oxysporum [16], Aspergillus niger [17], and
Epicoccum nigrum [18] showed potent potential for producing
AgNPs. In similar studies on tomato plant in the greenhouse, Ni
nanoparticles reduced severity of wilt by 58.4% [3], whereas NP of
CuO, MnO, or ZnO sprayed on tomato grown in soilless medium
infested with Fusarium wilt fungus reduced severity by 31, 28, or
28%, respectively [19]. Results of these recent previous works
confirm the novelty and more improvement of our current results
compared with them, as AgNPs reduced wilt severity by 90% when
applied into the tomato seedlings root for 4 h before pathogen
infestation of soil, in addition to enhancement of tomato seedlings
growth parameters.
The current work is the first to (i) use C. globosum for
biosynthesis of AgNPs, (ii) apply novel methodology for testing
702
the in vivo antifungal potential of AgNPs through placing the
seedlings root in different concentrations of AgNPs for different
periods prior to soil infestation with the pathogen, (iii) demonstrate
the significant reduction of tomato wilt severity by 90%, and (iv)
enhance growth parameters of the seedlings in the greenhouse.
Thus in the future, we could displace using the deleterious
chemical fungicides in the fields of tomato by using these safe,
simple and ecofriendly AgNPs as nanofungicides.
2 Materials and methods
2.1 Fungal cultures
Virulent isolate of F. oxysporum causing wilt disease of tomato
plant was provided by plant pathology laboratory, Faculty of
Agriculture, Cairo University, Cairo, Egypt. Non-pathogenic
isolate of C. globosum was isolated from samples of healthy corn
grains collected from cereal stores at Egypt on January 2015 and
was used for biosynthesis of AgNPs.
2.2 Molecular identification of the fungal isolates
Identification of F. oxysporum and C. globosum was confirmed by
DNA isolation, amplification using polymerase chain reaction
(PCR) and sequencing of the internal transcribed spacer (ITS)
region. The primers ITS2 (GCTGCGTTCTTCATCGATGC) and
ITS3 (GCATCGATGAAGAACGCAGC) were used for PCR
amplification while ITS1 (TCCGTAGGTGAACCTGCGG) and
ITS4 (TCCTCCGCTTATTGATATGC) was taken for sequencing
[20, 21].
2.3 Biomass preparation
To prepare fungal biomass for biosynthesis of AgNPs, two fungal
discs 4 mm each cut from C. globosum culture were inoculated into
Malt extract- Glucose- Yeast extract and Peptone broth medium
(MGYP) [22] and incubated at 28°C on a rotary shaker (120 rpm)
for 96 h. The biomass was harvested by filtration through filter
paper (Whatman no. 1) then washed with sterile distilled water to
remove any remains of the medium. A 25 g fungal biomass (wet
weight) was placed in individual flasks containing 100 ml sterile
distilled water. The flasks were incubated under the conditions
described above for 24 h. Finally, the biomass was filtered and the
crude cell filtrate was obtained.
2.4 Biosynthesis of AgNPs
AgNPs were synthesised using 50 ml cell filtrate mixed with 10 ml
AgNO3 solution (10 mmol/l) in a 250 ml Erlenmeyer flask,
incubated at 28°C on a rotary shaker (120 rpm) in darkness for 24 h. A flask without addition of silver ion was used as control. After
incubation, AgNPs were concentrated by centrifugation of the
reaction mixture at 10,000 rpm for 10 min twice and then collected
[23].
2.5 Characterisation of AgNPs
2.5.1 UV–vis absorbance spectroscopic analysis: The
bioreduction of silver nitrate (AgNO3) to AgNPs was monitored
periodically by UV–vis spectroscopy (Shimazu 2401PC) after the
dilution of the samples with deionised water [24]. A UV–vis
spectrograph of the silver and nanoparticles was recorded by using
a quartz cuvette with water as reference. The UV–vis spectrometric
readings were recorded at a scanning speed of 200–800 nm [25].
2.5.2 Transmittance electron microscope (TEM) analysis of
AgNPs: In [26], the suspension containing AgNPs was sampled
for TEM analysis using JEOL model 1200 EX electron
microscope. TEM samples were prepared by placing a drop of the
suspension of AgNPs solutions on carbon-coated copper grids and
allowed to dry for 4 min. The shape and size of AgNPs were
determined from TEM micrographs.
IET Nanobiotechnol., 2017, Vol. 11 Iss. 6, pp. 702-708
© The Institution of Engineering and Technology 2017
2.5.3 X-ray diffraction (XRD): Measurements of XRD of the
reduced AgNPs were carried out on drop-coated films of the
respective solutions onto glass substrates by a Phillips PW 1830
instrument operating at a voltage of 40 kV with Cu Kα radiation
[27].
2.6 In vitro antifungal potential of AgNPs
2.6.1 Poisoned food technique: In vitro assay of antifungal
potential of AgNPs against pathogenic F. oxysporum was
performed on three different types of growth media: PDA, corn
meal agar (CMA), and malt extract agar (MEA) according to [28].
These media were incubated at room temperature with different
concentrations of AgNPs (i.e. 50, 100, and 500 mg/l) for 0, 1, 2,
and 4 h before placing the fungal disc and then re-incubated at 28–
30°C for 7 days. Nystatin antifungal drug was used as positive
control.
2.6.2 Agar well diffusion assay: Antifungal potency of different
concentrations of the synthesised AgNPs (50, 100, and 500 mg/l)
on inhibiting growth of F. oxysporum was tested in vitro on PDA
medium using the agar well diffusion assay according to [29].
2.6.3 Inhibition of colony formation (CFU) of F. oxysporum by
AgNPs: The antifungal activity of AgNPs was examined on the
basis of in vitro inhibition of CFU of F. oxysporum according to
[8]. The pathogen was cultured on growth media which induces
conidia production such as PDA (Becton, Dickson and Company,
Sparks, MD, USA). Conidia were collected after incubation at
25°C for 10 days and its concentration was adjusted to 106 CFU/ml. Prepared conidial suspension was mixed with serial
concentrations of AgNPs (50, 100, and 500 mg/l), Nystatin
antifungal drug used as positive control and sterile distilled water
used as negative control to a final volume of 1 ml. A 10 µl
subsample of the conidia and silver mixture stocks were taken at 0,
1, 2, and 4 h after AgNPs treatment and then diluted 100-fold with
sterile distilled water. Ten microliters aliquot of the diluted spore
suspension were spread on PDA media and three replicates were
tested for each treatment. Number of CFUs of F. oxysporum were
counted after 2–4 days of incubation at 25°C and the experiment
was repeated twice.
2.7 In vivo potency of AgNPs on growth parameters of
tomato plant infested with F. oxysporum in the greenhouse
The in vivo effects of AgNPs on growth parameters of tomato
seedlings and severity of wilt symptoms were evaluated under
greenhouse conditions. AgNPs were diluted to three different
concentrations with sterile, deionised water (50, 100, and 500 mg/l)
and mixed with 0.2% surfactant (Spreader Sticker, Gardens Alive
Inc., Lawrenceburg, IN, USA). Plastic pots were filled with steam
pasteurised soil, three seeds of tomato were seeded in each pot and
watered every other day until seedling emergence. After 7 days of
seedling emergence, they were removed gently from the wetted soil
and then placed into each concentration of the AgNPs separately
(50, 100, and 500 mg/l). Seedlings were left in each concentration
of AgNPs for four different periods: 0, 1, 2, and 4 h, separately.
Thirty seedlings were used for each period of the three different
concentrations of AgNPs. After incubation, the treated seedlings
were re-placed again gently in the soil (three seedlings per each
pot).
Conidial suspension of F. oxysporum was prepared in potato
dextrose broth and adjusted to final concentration of 106 CFU/ml
using sterile distilled water. Thirty millilitres inocula of F.
oxysporum suspension were poured into each pot and all pots were
placed in the greenhouse at 30°C and watered daily. Positive
control pots involved placing of seedlings in Carboxin–Thiram
fungicide for 4 h before pathogen inoculation, whereas negative
control involved inoculation of the pathogen only without
incubation neither with the AgNPs nor with the fungicide. A 50 ml
of each concentration of AgNPs was added separately to each
corresponding set of pots after 7 and 14 days. After 21 days, the
number of plants showing wilt symptoms and growth parameters of
703
tomato seedlings (root fresh water, shoot fresh water, and seedlings
height) were recorded.
stabilised the nanoparticles by coating them and prevented their
aggregation into a larger mass of silver [31].
2.8 Statistical analysis
3.2 Molecular identification of the fungal isolates
All treatments were replicated three times (unless otherwise
specified), data were reported as mean ± SD (standard deviation)
and subjected to analysis of variance (ANOVA) using Statistical
Software (version 6.0; Stat Soft Inc., Tulsa, OK, USA). The
significance level was set at P ≤ 0.05.
By applying the produced sequences from DNA of the two fungal
isolates into BLAST search, they showed similarity of ∼99% with
the previously identified fungi C. golobosum and F. oxysporum,
respectively. The phylogenic trees of both isolates were also
constructed (Figs. 1 and 2). Based on the above identification
technique, our fungal isolates were identified as C. golobosum
KSA-EGY-19 and F. oxysporum KSA-EGY-16 with the GenBank
accession numbers of KX058139 and KX015960, respectively.
This conventional identification protocol had been commonly
applied for several new species [32]. Targeting specific regions
within the ribosomal RNA gene clusters using global primers
through PCR amplification are an alternative strategy for the fungal
identification to the species level and also for analysing fungal
diversity [33].
3 Results and discussions
3.1 C. globosum culture and synthesis of AgNPs
C. globosum was isolated from healthy corn grains together with
six other fungal isolates. The abilities of these isolates to synthesise
AgNPs were tested and three of them only showed positive results.
However, C globosum was selected specifically because it has not
been used previously for the synthesis of AgNPs, thus it becomes
our first record. A reddish-brown colour appeared upon addition of
AgNO3 solution to the cell-free extract of C. globosum indicating
the formation of AgNPs. This colour change is due to the surface
plasma resonance of the synthesised AgNPs as pointed previously
by Abdel-Aziz et al. [30]. This observed AgNPs mycosynthesis
activity could be attributed to the presence of reductases in the
fungal extract of C. globosum responsible for reduction of Ag
cations and subsequent AgNPs production as reported previously
by Durán et al. [16] or due to the presence of Humic acid which
3.3 Characterisation of AgNPs
3.3.1
UV–vis
absorbance
spectroscopic
analysis: Spectrophotometric study revealed that the maximum
UV–vis absorbance of the biosynthesised AgNPs was ∼420–450 nm as measured by Shimadzu UV/VIS 2401PC (Fig. 3a). Previous
reports indicated that the UV/vis absorbance of AgNPs may be
different with the microorganism used and the recorded values
were in the range of 410–460 nm [34]. Moreover, Ganachari et al
[35] reported that maximum absorbance for AgNPs synthesized by
Fig. 1 Phylogenetic trees showing relationship of C. globosum with other related fungal species retrieved from GenBank based on their sequence homologies
of 18srDNA
Fig. 2 Phylogenetic trees showing relationship of F. oxysporum with other related fungal species retrieved from GenBank based on their sequence
homologies of 18srDNA
704
IET Nanobiotechnol., 2017, Vol. 11 Iss. 6, pp. 702-708
© The Institution of Engineering and Technology 2017
3.4 In vitro antifungal potential of AgNPs
3.4.1 Poisoned food technique: The results presented in
Figs. 4a–c indicated that the diameter of radial growth of F.
oxysporum on the three culture media (PDA, CMA, and MEA)
were decreased with increasing the corresponding concentration
and time of incubation with AgNPs from 0–4 h, compared with the
Nystatin-treated media and with the non-treated control. On PDA
medium, the diameter of radial growth recorded its least value at
500 mg/l AgNPs on incubation for 4 h, in addition, the diameter
was similar to that observed for the antifungal Nystatin. Similar
results were obtained using CMA and MEA growth media;
however, the radial growth of the fungus at 500 mg/l of AgNPs and
incubation for 4 h on both of these media were lower than that
using Nystatin at the same tested concentration, means of the three
replicates were not significant, P ≤ 0.05. In accordance with Kim et
al. [28], better inhibitory activity of AgNPs was detected using
PDA medium than with the CMA and MEA media at the same
tested concentrations and incubation periods.
3.4.2 Agar well diffusion method: The diameter of inhibition of
growth of F. oxysporum on PDA medium was increased with
increasing the corresponding concentration of AgNPs 50, 100, and
500 mg/l and recorded 1.8, 2.6, and 4.6 cm, respectively, compared
with Nystatin (5.1 cm) at 500 mg/l. Similar results of in vitro
inhibition of Bipolaris sorokiniana by AgNPs were obtained by
Mishra et al. [38]. This observed in vitro antifungal potential of
AgNPs against F. oxysporum recorded in previous techniques could
be attributed to the high surface area and low volume of these
particles which were enough to penetrate into the fungal cell
membrane and affect the cytosol [39]. In addition, AgNPs may
disrupt the transport systems including ion efflux which interrupt
with cellular processes such as metabolism and respiration [40],
produce reactive oxygen species which cause damage to proteins,
lipids and nucleic acids within the cell [41].
Fig. 3 (a) The UV/vis spectrum of the AgNPs synthesized by C. globosum
biomass extract, (b) TEM analysis of AgNPs revealed that its shape is
spherical and its size ranged between 11 and 14 nm, (c) XRD spectrums of
the synthesized AgNPs displayed four peaks corresponding to the four
diffraction planes 111, 200, 220, and 311
Aspergillus flavus and Penicillium diversum were 425 and 413 nm,
respectively.
3.3.2 TEM analysis of AgNPs: TEM analysis revealed the
production of spherical AgNPs with a particle size of 11–14 nm
(Fig. 3b). AgNPs were not adherent to each other's indicating their
stability by protein capping coming from the microbial growth in
accordance with [36].
3.3.3 X-ray diffraction (XRD): Fig. 3c shows the XRD patterns of
the crystal phase structure of metallic silver which displayed four
peaks at 38°, 44°, 64°, and 77°, corresponding to the four
diffraction planes 111, 200, 220, and 311, respectively. These four
characteristic peaks indicated the high purity of AgNPs formed.
Similar results were obtained for the synthesis of AgNPs using
Rhodopsedomonas palustris [37].
IET Nanobiotechnol., 2017, Vol. 11 Iss. 6, pp. 702-708
© The Institution of Engineering and Technology 2017
3.4.3 Inhibition of CFU of F. oxysporum: The CFU of F.
oxysporum was decreased significantly on increasing the
concentration and time of incubation with AgNPs. At 50 mg/l of
AgNPs, the CFU decreased into 9 × 105 on incubation for 0 h,
compared with the CFU of non-treated control (106). Further,
increase of the incubation time for 1, 2 and 4 h was accompanied
by decrease in CFU into 2 × 105, 3 × 104, and 2 × 103, respectively.
More decrease in CFU were observed on using 100 mg/l of
AgNPs, where CFU reached 1 × 102 on incubation for 4 h. At 500 mg/l significant decrease in CFU was noticeable, however,
complete arrest of CFU formation was detected on incubation for
4 h. Treatment with Nystatin at 500 mg/l inhibited CFU formation
compared with the control (Table 1), means of the 3 replicates were
not significant, P ≤ 0.05. These results are in accordance with
previous study of [3] using Nickel nanoparticles to inhibit conidial
germination of F. oxysporum f. sp. lactucae and F. oxysporum f.
sp. lycopersici fungal pathogens of lettuce and tomato,
respectively, and to the study of [8] on inhibition of CFU from
conidia of B. sorokiniana and Magnaporthe grisea by AgNPs.
3.5 In vivo efficacy of AgNPs on growth parameters and
severity of wilt of tomato seedlings in the greenhouse
Treatment with AgNPs caused significant enhancement in the
growth parameters of tomato seedlings infested with F. oxysporum
in the greenhouse. In addition, it caused decrease in the number of
seedlings showing wilt symptoms compared with the control. This
effect was increased with increasing the concentration and
incubation periods of AgNPs in accordance with previous study of
[42] on pumpkin. At 50 mg/l and incubation for 0 h, the fresh
weight of root, shoot, height and number of wilted seedlings were
comparable with those of the control plants recording: 4.8 g, 8.6 g,
7.3 cm, 28 wilted seedlings and 4.7 g, 8.6 g, 7.2 cm, 28 wilted
seedlings, respectively. However, on incubation for 4 h at the same
tested concentration, the growth parameters of treated seedlings
were more than the control ones recording 9.7 g, 14.9 g, and 13.1 cm with lower number of wilted seedlings (19)(number 19
705
Fig. 4 In vitro antifungal activity of AgNPs on inhibiting radial growth of F. oxysporum on:
(a) PDA medium, (b) on CMA medium, (c) on MEA medium using Poisoned food technique. Values are the mean of three replicates, ± standard deviation. Means are not
significantly different at P ≤ 0.05 when subjected to (ANOVA)
Table 1 In vitro effect of AgNPs on inhibiting CFU of F. oxysporum on PDA medium
Concentration and duration of applied AgNPs
50 mg/l
100 mg/l
500 mg/l
0 h
1 h
2 h
4 h
0 h
1 h
2 h
4 h
0 h
1 h
2 h
9 × 105a
2 × 105b
3 × 104c
2 × 103d
8 × 104b
3 × 104c
1 × 103
1 × 102e
7 × 102d
2 × 102e
3 × 101c
500 mg/l
Nystatin
Control
0
106a
4 h
0
Results are averages of three replicates for each treatment. The values followed by different superscript letters (a, b, c, d, and e) indicate that means are not significantly different at P ≤ 0.05 when subjected to ANOVA.
indicates the number of wilted tomato seedlings upon treatment
with 50 mg/l of AgNPs after incubation for 4 h). Further increase
in the concentration of AgNPs to 100 mg/l was accompanied by
considerable improvement of seedlings growth parameters and
decrease in wilted ones, especially on increasing the incubation
periods. At 500 mg/l of AgNPs and incubation for 2 h, the growth
parameters of seedlings were 10.4 g, 15.3 g, 13.8 cm, and three
wilted seedlings. However, on increasing incubation periods with
AgNPs to 4 h, results of seedlings growth parameters were very
close to those treated with Carboxin–Thiram fungicide, in addition,
no wilted seedlings were observed (15.6 g, 16.7 g, and 19.5 cm)
706
and (15.9 g, 16.9 g, and 19.8 cm), respectively (Fig. 5), means of
the 30 seedlings were not significant, P ≤ 0.05). In accordance with
our preventive application of AgNPs, Jo et al. [8] stated that the
efficacy of AgNPs works better when applied before the pathogen
to prevent entrance and colonisation of the conidia.
According to the current results, application of AgNPs at 500 mg/l and incubation with the seedlings root for 4 h gave maximum
results of growth parameters and caused complete inhibition of
seedlings wilt. These obtained results were the same observed on
application of the synthetic fungicide under the same conditions.
Similarly, Kim et al. [28] reported that the inhibition of fungal
IET Nanobiotechnol., 2017, Vol. 11 Iss. 6, pp. 702-708
© The Institution of Engineering and Technology 2017
Fig. 5 In vivo antifungal potential of AgNPs on growth parameters of tomato seedlings and the number of wilted seedlings after placing their roots in AgNPs
suspension at different concentrations and for different periods prior to soil infestation with F. oxysporum in the greenhouse. Values are the mean of 30 plants,
±standard deviation. Means are not significantly different at P ≤ 0.05 when subjected to ANOVA
pathogens was increased with increasing the concentration of
AgNPs and this might be due to the high density of the AgNPs
solution that was able to saturate, cohere to the fungal hyphae and
to deactivate these pathogens. Similar to the current observations,
Abdelmalek and Salaheldin [43] stated that application of AgNPs
in soil and as seed/seedling coatings may control the
phytopathogens and stimulate plant growth as well. The recorded
in vivo antifungal potency of the AgNPs could be attributed to the
formation of shielding effects of AgNPs around the seedlings root
which acted as a barrier that prevented entrance of F. oxysporum
into the root then colonisation and subsequent development of wilt
symptoms. In addition, this effect was increased with increasing
the incubation with AgNPs because longer incubation allowed
complete saturation of the seedlings root with the AgNPs leading
to better shielding effect and hence complete control of wilt
disease. In a recent study, Mishra et al. [38] hypothesised that
treatment with AgNPs and the fungal pathogen enhanced
lignification of wheat which worked as a hindrance against
pathogen attack, while least lignin deposition was observed in
plants treated with pathogen only, thus favoured pathogen attack.
4 Conclusions
It is concluded that C. globosum could be used successfully to
biosynthesise AgNPs which demonstrated appreciable in vitro
antifungal potential against the tomato wilt pathogen (F.
oxysporum). In the greenhouse, these AgNPs showed the same
antifungal potency as the synthetic fungicides as they reduced the
severity of wilt by 90% thus enhanced growth parameters of
tomato seedlings when their roots were placed in AgNPs
suspension at of 500 mg/l for 4 h prior to soil infestation with F.
oxysporum. Our future prospectus are to biosynthesise AgNPs on a
large scale and then formulate it to be applied as safe, effective,
and ecofriendly nanofungicides in the fields of tomato hence
control Fusarium wilt. Accordingly, we could displace using the
health hazards chemical fungicides.
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
5 References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
Shishido, M., Chika, M., Toshiyuki, U., et al.: ‘Biological control efficiency
of Fusarium wilt of tomato by nonpathogenic Fusarium oxysporum Fo-B2 in
different environments’, Phytopathology, 2005, 95, (9), pp. 1072–1080
Jarvis, W.R.: ‘Fusarium crown and root rot of tomatoes’, Phytoprotection,
1988, 69, pp. 49–64
Ahmed, A.I.S., Yadav, D.R., Lee, Y.S.: ‘Applications of nickel nanoparticles
for control of Fusarium wilt on lettuce and tomato’, Int. J. Innov. Res. Sci.
Eng. Technol., 2016, 5, (5), pp. 7378–7385
Goffeau, A.: ‘Drug resistance: the fight against fungi’, Nature, 2008, 452, pp.
541–542
Bouwmeester, H., Dekkers, S., Noordam, M.Y., et al.: ‘Review of health
safety aspects of nanotechnologies in food production’, Regular Toxicol.
Pharmacol., 2009, 53, pp. 52–62
Sekhon, B.S.: ‘Nanotechnology in agri-food production: an overview’,
Nanotechnol. Sci. Appl., 2014, 7, pp. 31–53
Ahmed, I.S.A., Lee, Y.S.: ‘Nanoparticles as alternative pesticides: Concept,
manufacturing and activities’, Korean J. Mycol., 2015, 43, (4), pp. 207–215
Jo, Y.-K., Kim, B.H., Jung, G.: ‘Antifungal activity of silver ions and
nanoparticles on phytopathogenic fungi’, Plant Dis., 2009, 93, pp. 1037–1043
IET Nanobiotechnol., 2017, Vol. 11 Iss. 6, pp. 702-708
© The Institution of Engineering and Technology 2017
[25]
[26]
[27]
[28]
[29]
[30]
Samuel, U., Guggenbichler, J.P.: ‘Prevention of catheter related infections: the
potential of a new nano-silver impregnated catheter’, Int. J. Antimicrob.
Agents, 2004, 23, pp. 75–78
Elamawi, R.M.A., El-Shafey, R.A.S.: ‘Inhibition effects of silver
nanoparticles against rice blast disease caused by Magnaporthe grisea.
Egypt’, J. Agric. Res., 2013, 91, (4), pp. 1271–1283
Ingle, A., Gade, A., Pierrat, S., et al.: ‘Mycosynthesis of silver nanoparticles
using the fungus Fusarium acuminatum and its activity against some human
pathogenic bacteria’, Curr. Nanosci., 2008, 4, pp. 141–144
Narayanan, K.B., Sakthivel, N.: ‘Biological synthesis of metal nanoparticles
by microbes’, Adv. Colloid Interface Sci., 2010, 156, pp. 1–13
Roy, S., Mukherjee, T., Chakraborty, S., et al.: ‘Biosynthesis, characterisation
and antifungal activity of silver nanoparticles synthesized by the fungus
Aspergillus foetidus mtcc8876’, Digest J. Nanomater. Biostruct., 2013, 8, (1),
pp. 197–205
Quester, K., Avalos-Borja, M., Castro-Longoria, E.: ‘Biosynthesis and
microscopic study of metallic nanoparticles’, Micron, 2013, 54-55, pp. 1–27
Dhillon, G.S., Brar, S.K., Kaur, S., et al.: ‘Green approach for nanoparticle
biosynthesis by fungi: current trends and applications’, Crit. Rev. Biotechnol.,
2012, 32, pp. 49–73
Durán, N., Marcato, P.D., Alves, O.L., et al.: ‘Mechanistic aspects of
biosynthesis of silver nanoparticles by several Fusarium oxysporum strains’,
J. Nanobiotechnol., 2005, 3, pp. 1–8
Gade, A.K., Bonde, P., Ingle, A.P., et al.: ‘Exploitation of Aspergillus niger
for synthesis of silver nanoparticles’, J. Biobased Mater. Bioenergy, 2008, 2,
pp. 243–247
Qian, Y., Yu, H., He, D., et al.: ‘Biosynthesis of silver nanoparticles by the
endophytic fungus Epicoccum nigrum and their activity against pathogenic
fungi’, Bioprocess Biosyst. Eng., 2013, 36, (11), pp. 1613–1619
Elmer, W.H., White, J.C.: ‘The use of metallic oxide nanoparticles to enhance
growth of tomatoes and eggplants in disease infested soil or soilless medium’,
Environ. Sci. Nano, 2016, 3, pp. 1072–1079
Schoch, C.L., Seifert, K.A., Huhndorf, S., et al.: ‘Nuclear ribosomal internal
transcribed spacer (ITS) region as a universal DNA barcode marker for
Fungi’, Proc. Natl. Acad. Sci., 2012, 109, pp. 6241–6246
Abd El-Hady, F.K., Abdou, A.M., Abdel-Aziz, M.S.: ‘Isolation, identification
and evaluation of antimicrobial and cytotoxic activities of the marine fungus
Aspergillus unguis RSPG_204’, Int. J. Pharmaceut. Sci. Rev. Res., 2014, 28,
(2), pp. 121–127
Hamedi, S., Ghaseminezhad, S.M., Shojaosadati, S.A., et al.: ‘Comparative
study on silver nanoparticles properties produced by green methods’, Iran. J.
Biotechnol., 2012, 10, (3), pp. 191–197
Li, G., He, D., Qian, Y., et al.: ‘Fungus-mediated green synthesis of silver
nanoparticles using Aspergillus terreus’, Int. J. Mol. Sci., 2012, 13, pp. 466–
476
Raut, R.W., Kolekar, N.S., Lakkakula, J.R., et al.: ‘Photosynthesis of silver
nanoparticles using Gliricidia sepium (Jecq)’, Curr. Nanosci., 2009, 5, pp.
117–122
Leela, A., Vivekanandan, M.: ‘Tapping the unexploited plant resources for the
synthesis of silver nanoparticles’, Afr. J. Biotechnol., 2008, 7, (17), pp. 3162–
3165
Elavazhagan, T., Arunachalam, K.D.: ‘Memecylon edule leaf extract
mediated green synthesis of silver and gold nanoparticles’, Int. J. Nanomed.,
2011, 6, pp. 1265–1278
Youssef, A.M., Abdel-Aziz, M.S., El-Sayed, S.M.: ‘Chitosan nanocomposite
films based on Ag-NP and Au-NP biosynthesis by Bacillus subtilis as
packaging materials’, Int. J. Biol. Macromol., 2014, 69, pp. 185–191
Kim, S.W., Jung, J.H., Lamsal, K., et al.: ‘Antifungal effects of silver
nanoparticles (AgNPs) against various plant pathogenic fungi’, Mycobiology,
2012, 40, (1), pp. 53–58
Devi, J.S., Bhimba, B.V.: ‘Antibacterial and antifungal activity of silver
nanoparticles synthesized using Hypnea muciformis’, Biosci. Biotechnol. Res.
Asia, 2014, 11, (1), pp. 235–238
Abdel-Aziz, M.S., Shaheen, M.S., El-Nekeety, A.A., et al.: ‘Antioxidant and
antibacterial activity of silver nanoparticles biosynthesized using
Chenopodium murale leaf extract’, J. Saudi Chem. Soc., 2014, 18, pp. 356–
363
707
[31]
[32]
[33]
[34]
[35]
[36]
[37]
708
Akaighe, N., MacCuspie, R.I., Navarro, D.A., et al.: ‘Humic acid-induced
silver nanoparticle formation under environmentally relevant conditions’,
Environ. Sci. Technol., 2011, 45, pp. 3895–3901
Zhao, G.Z., Liu, X.Z., Wu, W.P.: ‘Helicosporus hyphomycetes from China’,
Fungal Divers., 2007, 26, pp. 313–524
Chen, Y.C., Eisner, J.D., Kattar, M.M., et al.: ‘Identification of medically
important yeasts using PCR-based detection of DNA sequence
polymorphisms in the internal transcribed spacer 2 region of the rRNA
genes’, J. Clin. Microbiol., 2001, 38, (6), pp. 2302–2310
Moharrer, S., Mohammadi, B., Gharamohammadi, R.A., et al.: ‘Biological
synthesis of silver nanoparticles by Aspergillus flavus, isolated from soil of
Ahar copper mine’, Indian J. Sci. Technol., 2012, 5, (S3), pp. 2443–2444
Ganachari, S.V., Bhat, R., Deshpande, R., et al.: ‘Extracellular biosynthesis of
silver nanoparticles using fungi Penicillium diversum and their antimicrobial
activity studies’, BioNanoScience, 2012, 2, (4), pp. 316–321
Vahabi, K., Mansoori, G.A., Karimi, S.: ‘Biosynthesis of silver nanoparticles
by fungus Trichoderma reesei’, Insci. J., 2011, 1, pp. 65–79
Chun-Jing, C., Hong-Juan, B.: ‘Biosynthesis of silver nanoparticles using the
phototrophic bacteria Rhodopseudomonas palustris and its antimicrobial
activity against Escherichia coli and Staphylococcus aureus’, Microbiol.
China, 2010, 37, pp. 1798–1804
[38]
[39]
[40]
[41]
[42]
[43]
Mishra, S., Singh, B.R., Singh, A., et al.: ‘Biofabricated silver nanoparticles
act as a strong fungicide against Bipolaris sorokiniana causing spot blotch
disease in wheat’, PLoS ONE, 2014, 9, (5), p. e97881, doi: 10.1371/
journal.pone.0097881
Cho, J.S., Seo, Y.C., Yim, T.B., et al.: ‘Effect of nano-encapsulated vitamin
B1 derivative on inhibition of both mycelial growth and spore germination of
Fusarium oxysporum f. sp. raphani’, Int. J. Mol. Sci., 2013, 14, pp. 4283–
4297
Morones, J.R., Elechiguerra, J.L., Camacho, A., et al.: ‘The bactericidal effect
of silver nanoparticles’, Nanotechnology, 2005, 16, pp. 2346–2353
Hwang, E.T., Lee, J.H., Chae, Y.J., et al.: ‘Analysis of the toxic mode of
action of silver nanoparticles using stress-specific bioluminescent bacteria’,
Small, 2008, 4, pp. 746–750
Lamsal, K., Kim, S.-W., Jung, J.H., et al.: ‘Inhibition effects of silver
nanoparticles against powdery mildews on cucumber and pumpkin’,
Mycobiology, 2011, 39, (1), pp. 26–32
Abdelmalek, G.A.M., Salaheldin, T.A.: ‘Silver nanoparticles as a potent
fungicide for citrus phytopathogenic fungi’, J. Nanomed. Res., 2016, 3, (5), p.
00065, doi: 10.15406/jnmr.2016.03.00065
IET Nanobiotechnol., 2017, Vol. 11 Iss. 6, pp. 702-708
© The Institution of Engineering and Technology 2017
Документ
Категория
Без категории
Просмотров
2
Размер файла
3 940 Кб
Теги
nbt, 2016, iet, 0213
1/--страниц
Пожаловаться на содержимое документа