close

Вход

Забыли?

вход по аккаунту

?

j.jff.2017.10.020

код для вставкиСкачать
Journal of Functional Foods 39 (2017) 139–151
Contents lists available at ScienceDirect
Journal of Functional Foods
journal homepage: www.elsevier.com/locate/jff
Ethanol extract of Atractylodis macrocephalae Rhizoma ameliorates insulin
resistance and gut microbiota in type 2 diabetic db/db mice
Wen-You Zhang, Huan-Huan Zhang, Chen-Huan Yu, Jie Fang, Hua-Zhong Ying
MARK
⁎
Key Laboratory of Experimental Animal and Safety Evaluation, Zhejiang Academy of Medical Sciences, Hangzhou 310013, China
A R T I C L E I N F O
A B S T R A C T
Keywords:
Type 2 diabetes mellitus
Inflammation
Glucagon-like peptide-1 receptor
Forkhead box O1
Bacteroides thetaiotaomicron
Methanobrevibacter smithii
Atractylodis macrocephalae Rhizoma is widely used as a functional food in Asia. It can enhance glucose and lipid
metabolism in the obesity patients with adiposity. In this study, therapeutic effects and the underlying molecular
mechanisms of its ethanol extract (AMK) were investigated in db/db mice. Oral treatment with AMK at a dose of
100 mg/kg for three weeks significantly decreased the blood glucose, serum triacylglycerol, total cholesterol,
HOMA-IR, endotoxin and IL-1β. Besides, AMK increased the abundance of Bacteroides thetaiotaomicron and
Methanobrevibacter smithii in gut microbiota and improved the histological abnormalities of liver, adipocytes,
pancreas and small intestine in diabetic mice. Moreover, AMK upregulated the expressions of GLP-1R, PI3K and
PDX-1, but downregulated FOXO1 and NF-κB p65 in liver and pancreas tissues of diabetic mice. These results
suggested that AMK ameliorated glucose metabolism by regulating GLP-1R/PI3K/PDX-1 pathway and gut microbiota, and it could be developed as a medicinal herb for T2DM treatment.
1. Introduction
Type 2 diabetes mellitus (T2DM) is a systemic metabolic endocrine
disease driven by environmental and genetic factors. It is mainly caused
by disorders of lipid metabolism and hepatic glucose homeostasis that,
in turn, result from insulin resistance (IR) and insufficient insulin secretion (Tangvarasittichai, 2015). The International Diabetes Federation estimated that in 2015, 415 million people diagnosed with diabetes
worldwide. This number will increase to 642 million by 2040, and
people with T2DM will account for more than 90% of this number (da
Rocha Fernandes et al., 2016). GLP-1 (glucagon-like peptide-1) is an
important incretin hormone released by enteroendocrine L cells of the
distal intestine after food intake. This hormone binds to the GLP-1 receptor (GLP-1R) to promote glucose-dependent insulin secretion, induce pancreatic β-cells neogenesis, and potentiate insulin sensitivity,
thus controlling blood glucose excursion and energy balance (Holst
et al., 2011). Insulin binds to its receptor on the surface of the liver cell
membrane to activate the insulin/insulin growth factor-1 (IGF-1) signaling cascade in the pancreas and the liver (Dai et al., 2016). The
phosphatidylinositol-3-kinase (PI3K)/protein kinase B (AKT) signaling
pathway is a classic and crucial pathway in insulin signal transduction
and is involved in glucose and lipid homeostasis (Kohn, Summers,
Birnbaum, & Roth, 1996). Forkhead box protein O1 (FOXO1), a member
of the transcription factor family, is an important downstream molecule
in the PI3K/AKT signaling pathway (Skarra & Thackray, 2015). The
phosphorylation of FOXO1 by PI3K/AKT signals contributes its inactivation or nuclear exclusion, thus triggering the cellular localization
of pancreatic and duodenal homeobox 1 (PDX-1) in the pancreas. PDX-1
is a transcription factor essential for pancreatic development and insulin gene expression (Kaneto et al., 2008). T2DM is accompanied by a
chronic state of low-grade inflammation resulting from the moderate
induction of inflammatory cytokines, such as interleukin 1-beta (IL-1β),
interleukin 6 (IL-6), and tumor necrosis factor-alpha (TNF-α) (Cooke,
Connaughton, Lyons, McMorrow, & Roche, 2016). These destructive
pro-inflammatory cytokines, which are secreted by adipose tissues,
impair insulin action and islet β-cells via the nuclear factor-kappa B
(NF-κB) pathway (W. Li et al., 2017).
Approximately 100 trillion bacteria reside in the human gut and are
Abbreviations: T2DM, Type 2 diabetes mellitus; IR, insulin resistance; PI3K, phosphatidylinositol-3-kinase; AKT, protein kinase B; TNF-α, tumor necrosis factor-alpha; IL-1β, interleukin
1-beta; NF-κB, nuclear factor-kappa B; AMK, Atractylodes macrocephala Koidz; IL-6, interleukin 6; LPS, lipopolysaccharide; ERK, extracellular regulated protein kinases; HPLC, high
performance liquid chromatography; NC, normal control group; MC, model control group; MET, metformin-treated group; AMK1, AMK-treated for one week group; AMK2, AMK-treated
for two weeks group; AMK3, AMK-treated for three weeks group; TG, triacylglycerol; TC, total cholesterol; FBG, fasting blood glucose; HOMA-IR, homeostasis model assessment of insulin
resistance; B. thetaiotaomicron, bacteroides thetaiotaomicron; M. smithii, methanobrevibacter smithii; FOXO1, forkhead box protein O1; GLP-1R, glucagon-like peptide-1 receptor; PDX-1,
pancreatic and duodenal homeobox 1; NO, nitric oxide; GPCR, G protein-coupled receptor; cAMP, cyclic adenosine monophosphate; PKA, protein kinase A; DPP-IV, dipeptidyl peptidase
IV; IGF-1, insulin growth factor-1
⁎
Corresponding author.
E-mail address: HZYing0101@163.com (H.-Z. Ying).
http://dx.doi.org/10.1016/j.jff.2017.10.020
Received 14 June 2017; Received in revised form 3 October 2017; Accepted 12 October 2017
1756-4646/ © 2017 Elsevier Ltd. All rights reserved.
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
Atractylenolides I and III were used as representative standards for
AMK and were purchased from Shanghai U-SEA Biotech Co., Ltd. (purities > 98%). The atractylenolides I and III contents of AMK extracts
were determined through HPLC with Waters 1525-2998 HPLC system,
which comprised a vacuum degasser, 1525 binary HPLC pump, 2707
autosampler, 1500 column oven, 2489 UV Vis detector, and 2998
photodiode array detector, the system was controlled by Breeze station
(Waters, MA, USA). The HPLC column was Waters X-Bridge C18
column (250 mm × 4.6 mm, 5 μm). The mobile phase consisted of
100% methanol (A) and 0.05% phosphoric acid water solution (B). The
gradient program was as follows: 0–15 min, 60: 40 (A: B, v/v);
15–30 min, linear gradient 60:40 → 76:24 (A: B, v/v). All injection
volumes in this assay were 20 μL, and the flow rate was maintained at
1 mL/min. Column temperature was kept at 35 °C, and UV absorbance
was set at 220 nm to obtain the peak intensity and retention time.
collectively referred to as gut microbiota and it contains approximately
150-fold more genes than the human genome (Herrema,
IJzerman, & Nieuwdorp, 2016). Bacteroidetes and Firmicutes are two
bacterial phyla that dominate the gut microbiota. Other major bacterial
phyla in the gut include Euryarchaeota, Proteobacteria, Actinobacteria,
and Verrucomicrobia. The gut microbiota has been recently implicated
as an external factor that participates in adipose tissue differentiation,
glucose metabolism, and low-grade inflammation (Baothman,
Zamzami, Taher, Abubaker, & Abu-Farha, 2016). The gut microbiota
and microbial metabolites have important roles in the regulation of host
metabolism, maturation of the host immune system, and development
of many metabolic diseases (Li, Wang, Wang, Hu, & Chen, 2016). These
roles have received extensive attention over the last decade. Moreover,
the gut microbiota participates in the progression of T2DM, wherein the
decrease in Bacteroidetes/Firmicutes ratio is associated with elevated
plasma glucose concentration (Clemente, Ursell, Parfrey, & Knight,
2012). The dysbiosis of the gut microbiota has been gradually recognized as a potential diagnostic and therapeutic target for T2DM.
Atractylodes macrocephala Koidz, a member of the Compositae family, is mainly cultivated in China and other Asian countries. Due to its
sweet taste and distinctive flavor, the rhizome of A. macrocephala (i.e.
Atractylodis macrocephalae Rhizoma) is used to season tea drinks, desserts, and medicinal liquor. In addition, this medicinal herb has been
utilized for the treatment of splenic asthenia, gastrointestinal upset, and
loss of appetite for over 2000 years. The main components of this herb
include atractylenolide, polysaccharide, volatile oil, and amino acids;
these components have been already isolated and investigated.
Previous studies have focused on its anti-inflammatory (Li, He,
Dong, & Jin, 2007), anti-oxidant (Li et al., 2012), and gastroprotective
effects (Song, Li, Zhou, Cai, & Huang, 2015). Atractylenolide I decreases
TNF-α, IL-6, and IL-1β production associated with acute lipopolysaccharide (LPS)-induced lung injury in mice (Zhang, Huang, & Zeng,
2015). Atractylenolide II inhibits growth and induces apoptosis in B16
melanoma cells by inactivating the Ras/ERK pathway (Ye et al., 2011).
Atractylenolide III has been shown to protect the gastrointestinal
system of Wistar rats from ethanol-induced gastric ulcers (K.-T. Wang,
Chen, Wu, Chang, & Wang, 2010). A. macrocephala polysaccharide enhances the ability of gut bacteria to consume reducing sugar and restores gut microbiota dysbiosis in rats (R. Wang, Zhou, Wang,
Peng, & Li, 2014). In addition, it inhibits adipocyte differentiation in
3T3-L1 cells and decreases body weight gain in rats fed with a high-fat
diet (Kim et al., 2011). However, the biological activities of the herbal
extracts in T2DM have not been studied. In the present study, we aimed
to investigate the anti-diabetic effects of A. macrocephala ethanol extracts (AMK) in a T2DM mouse model. This model exhibits obesity,
spontaneous sustained hyperglycemia, hyperlipidemia, and hepatic
steatosis caused by mutations of the leptin receptor (More, Wen,
Thomas, Aleksunes, & Slitt, 2012). We then discussed the mechanisms
responsible for the anti-diabetic effects of AMK.
2.2. Animal experiment
Six-week-old male C57BL/BKS.Cg-Dock7m+/+Leprdb/Nju (db/db)
mice and non-diabetic male littermates (referred as wild type mice)
were obtained from Slac Laboratory Animal Co. Ltd. (Shanghai, China).
All animals were kept under specific pathogen-free conditions, the
temperature is set at 23 ± 1 °C, the light-dark cycle is controlled with
12:12 h and relative humidity is maintained at 50 ± 10%. They were
given free access to sterile water and food. The mice were acclimated in
pathogen-free environment for one week before the experiments. All
animal procedures were in compliance with institutional guidelines of
Zhejiang Academy of Medical Science and were approved by the ethics
committee for care and use of laboratory animal (No. 2016DZ0514).
Fifty db/db mice were randomly divided into five subgroups of ten
animals each on the basis of the received treatment as follows: model
control group (MC), metformin (MET, 150 mg/kg, p.o.), one week of
AMK treatment (AMK1, 100 mg/kg, p.o.), two weeks of AMK treatment
(AMK2, 100 mg/kg, p.o.), and three weeks of AMK treatment (AMK3,
100 mg/kg, p.o.). Ten non-diabetic littermates were used as the normal
control (NC) group. The corresponding drugs were administered to each
mouse through gavage once daily. Mice in the MC and NC groups were
given normal saline through gavage. After the last drug treatment, 8week-old AMK1 mice; 9-week-old AMK2 mice; and 10-week old AMK3,
NC, MC, and MET mice were starved for 12 h and sacrificed for blood
collection and tissue sampling under anesthesia. Portions of the liver,
colon, and pancreatic tissues and perirenal fat were fixed in 10% buffered formalin solution for histological analysis. The remaining tissues
and cecal contents were frozen in liquid nitrogen.
2.3. Plasma parameters
Blood samples were collected from retroorbital veins and centrifuged at 3500g for 20 min at 4 °C for serum collection. Blood triacylglycerol (TG), total cholesterol (TC), and fasting blood glucose (FBG)
concentrations were measured using commercial assay kits procured
from Jiancheng Bioengineering Institute (Nanjing, China). Serum insulin, endotoxin, and IL-1β levels were detected with ELISA kits purchased from Boster biological technology Ltd., (Wuhan, China). All
procedures were conducted in accordance with the manufacturer’s instructions.
The homeostasis model for the assessment of IR (HOMA-IR) was
calculated on the basis of fasting serum insulin and FBG using the following equation:
2. Materials and methods
2.1. Extraction and quality control of AMK
Dried rhizomes of A. macrocephala were obtained from Fengchun
Pharmaceutical Co., Ltd (Guangdong, China) and identified by
Professor Bing Yu (Zhejiang Chinese Medical University) according to
China Pharmacopoeia (2015 version). First, 100 grams of dried rhizomes were thrice refluxed with 70% ethanol at 90 °C for 60 min.
Extracts were filtered through a sieve, condensed using a rotary evaporator at 40 °C, and dried in a vacuum oven at 60 °C. Two grams of the
extract powders were dissolved in 100 ml sterilized water and then
stored at 4 °C prior to use.
The extracts were autoclaved, filtered through a 0.22 μm syringe
filter membrane under sterile conditions, and then subjected to highperformance liquid chromatography (HPLC). The major components
HOMA−IR = [fasting glucose(mM) × fasting insulin(mIU/mL)]/22.5
2.4. Histological examination
Liver, colon, and pancreatic tissues and perirenal fat were separated
from each sacrificed mouse and then washed with phosphate-buffered
140
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
saline (PBS). Tissues were fixed with 10% buffered formalin water solution, embedded in paraffin, cut into 5 μm thick sections, and stained
with hematoxylin & eosin (H & E) and Oil Red O in accordance with
standard procedures. Mounted slides were individually observed and
imaged using an optical microscope (Leica, Germany) under 100 × or
200 × objective lens. The degree of liver sections staining by Oil Red O,
inflammatory infiltration in perirenal fat and the number of islet β-cells
in pancreas sections staining by H & E were analyzed by Image Pro Plus,
Version 6.0 (Media Cybernetics, Inc.).
dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto
a PVDF membrane (Millipore, Bedford, MA). After blocking with 5%
skim milk at room temperature for 1 h, membranes were incubated
overnight with specific primary antibodies against GLP-1R (ab189397,
Abcam, Cambridge, UK), FOXO1 (18592-1-AP, Proteintech Groups,
Rosemont, USA), PDX-1 (#5679, Cell Signaling Technology, Boston,
MA, USA), PI3K (ab151549, Abcam, Cambridge, UK), NF-κB p65
(#8242, Cell Signaling Technology, Boston, MA, USA) and β-actin
(ab8227, Abcam, Cambridge, UK) at 4 °C. Each membrane was subsequently washed thrice with TBST for 15 min and incubated with
horseradish peroxidase-conjugated secondary antibodies for 1 h at
room temperature. Target protein bands were visualized and then washed with TBST. β-actin protein was used as the internal control and
protein band intensity was quantified using alphaEaseFC software
(Alpha Innotech, CA, USA). The density of bands was expressed as fold
changes relative to that of β-actin.
2.5. Fluorescence quantitative real-time PCR
Total DNA was extracted from cecal contents using a commercial
stool DNA kit (Omega Bio-tek, Norcross, GA, USA) in accordance with
kit protocols. Total RNA was extracted from mouse liver and pancreas
samples with Trizol reagent (Sangon Biotech, Shanghai, China). DNA
and RNA concentrations were quantified using Nanodrop 2000
(Thermo Scientific, MA, USA). cDNA was synthesized using a commercial kit (Takara Bio Inc.) in accordance with the kit protocols. The
target genes in this study were Bacteroides thetaiotaomicron 16S rRNA,
Methanobrevibacter smithii 16S rRNA, FOXO1, GLP-1R, PDX-1, and PI3K.
The specific designed primers pairs used for analysis are shown in
Table 1 and were synthesized by Shanghai Sangon Biotech (Shanghai,
China).
A BIO-RAD IQ5 instrument was used for real-time fluorescence
quantitative PCR (RFQ-PCR). Amplification was conducted with a final
reaction volume of 20 μL in 20 μL capillary glass tubes. The reaction
mixture consisted of 2 μL cDNA, 0.5 μL forward and reverse primers of
the target gene (final concentration 0.5 μM), 10.0 μL 2 SYBR Green
(Takara Bio Inc.), and nuclease-free water. The RFQ-PCR program was
set as follows: 95 °C for 1 min, followed by 40 cycles of denaturation at
95 °C for 10 s, annealing at 55 °C, and elongation at 64 °C for 25 s with
the acquisition of fluorescent data. Data were recorded by Bio-Rad CFX
Manager, version 3.0 (Bio-Rad Laboratories, Inc.). Universal bacterial
16S rRNA and GAPDH were used as housekeeping genes in this study.
Relative gene expression levels were calculated through the 2−△△Ct
method.
2.7. Statistical analysis
Data were analyzed with one-way ANOVA using SPSS software
(Version 16.0) and are expressed as mean ± standard deviation.
Significant treatment differences were identified using Dunnett’s multiple comparison tests. Values of p < .05 were considered to be statistically significant.
3. Results
3.1. HPLC analysis of AMK
Atractylenolide I and Atractylenolide III are major bioactive components in AMK, Fig. 1A and B illustrated the chemical structure of
Atractylenolide I and Atractylenolide III. As illustrated in Fig. 1D, the
contents of atractylenolide III and I in AMK extracts were determined
by HPLC analysis. The retention times and UV spectra of samples were
then compared with those of the standards in Fig. 1C. The peak retention times of atractylenolide III and I were 17.5 and 24.0 min, respectively. AMK extract contained 1.57 and 1.19 mg/g of atractylenolide III and atractylenolide I, respectively.
2.6. Western blot analysis
3.2. Effects of AMK on body weight, blood glucose, serum insulin, and lipid
profiles
Proteins were extracted from liver and pancreas tissues and then
quantified using commercial kits (Sangon Biotech, Shanghai, China).
Each 50 μg of protein sample was separated through 10% sodium
The initial and final body weights of db/db mice were remarkably
higher (1.93-fold and 1.98-fold) than that of NC mice, as shown in
Fig. 2A. The body weight of AMK3 mice significantly decreased
(p < .05) by approximately 2.78 g relative to that of non-treated mice.
By contrast, the body weight of MET mice did not significantly change.
The db/db mice in all treatment groups had higher FBG levels than
those in the NC group (p < .05) as shown in Table 2. Treatment with
AMK extract at a dose of 100 mg/kg per day did not significantly affect
FBG levels during the first week after administration. However, FBG
levels significantly decreased after two and three weeks of AMK treatment (p < .05) by approximately 27% and 36%, respectively. No significant difference (p < .05) was found between the AMK3 and metformin groups.
The fasting serum insulin levels of the AMK1, AMK2, AMK3, and
MET groups were higher than those of the MC group (p < .05). HOMAIR decreased (∼2.06) after three weeks of AMK treatment, suggesting
that the continuous administration of AMK for three weeks could improve impaired IR in diabetic mice. However, one and two weeks of
AMK treatment had no remarkable effects.
The TC and TG conditions of the diabetic groups were worse than
that of the NC group (p < .05). Results showed that TG levels did not
significantly decrease (p > .05) in AMK1 and AMK2 groups (decreased
by ∼0.06 mM and ∼0.20 mM, respectively) in contrast with nontreated groups. However, serum TG level was significantly decreased by
Table 1
Primer sequences for quantitative PCR.
Target gene
primer sequence (5′- 3′)
Length (bp)
B. thetaiotaomicron 16S
rRNA
M. smithii 16S rRNA
FW: TCGAAAGTGTGGGTATCAAACA
RW: CTGTATATCGCAAACAGCGAGT
FW: CCGGGTATCTAATCCGGTTC
RW: CTCCCAGGGTAGAGGTGAAA
FW: TCCTACGGGAGGCAGCAGTG
RW:
GGACTACCAGGGTATCTAATCCTGT
FW: CCCAGGCCGGAGTTTAACC
RW: GTTGCTCATAAAGTCGGTGCT
FW: ACGGTGTCCCTCTCAGAGAC
RW: ATCAAAGGTCCGGTTGCAGAA
FW: CCCCAGTTTACAAGCTCGCT
RW: CTCGGTTCCATTCGGGAAAGG
FW: ACACCACGGTTTGGACTATGG
RW: GGCTACAGTAGTGGGCTTGG
FW: AGGTCGGTGTGAACGGATTTG
RW: TGTAGACCATGTAGTTGAGGTCA
84
Universal bacteria 16S
rRNA
FOXO1
GLP-1R
PDX-1
PI3K
GAPDH
123
446
132
117
177
140
123
B. thetaiotaomicron: bacteroides thetaiotaomicron, M. smithii: methanobrevibacter smithii,
FOXO1: forkhead box protein O1, GLP-1R: glucagon-like peptide-1 receptor, PDX-1:
pancreatic and duodenal homeobox 1, PI3K: phosphatidylinositol-3-kinase.
141
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
(A)
(B)
Fig. 1. Chemical structure and HPLC chromatographs of representative bioactive ingredients in
AMK. (A) Chemical structure of Atractylenolide I.
(B) Chemical structure of Atractylenolide III. (C)
HPLC chromatograph of representative standards
for AMK. (D) HPLC chromatograph of AMK ethanol
extraction. The contents in extraction of AMK were
determined by comparing retention times of their
standards (a. Atractylenolide III; b. Atractylenolide
I). The chromatograms were obtained at a wavelength of 220 nm.
(D)
(C)
a
b
a
Time (min)
b
Time (min)
and pancreatic tissues were detected through FQ-PCR with GAPDH as
the internal control. The results, which are shown in Fig. 3A and B,
revealed that FOXO1 expression was significantly up-regulated
(p < .05) in MC group mice relative to that in NC group mice. By
contrast, the expression levels of GLP-1R, PDX-1, and PI3K mRNA were
significantly down-regulated (all p < .05). However, treatment with
AMK for one, two, and three weeks decreased the expression of FOXO1
mRNA and sharply increased the expression levels of GLP-1R, PDX-1,
and PI3K mRNA in hepatic and pancreatic tissues. These findings indicated that AMK significantly affects GLP-1R, PI3K, and their downstream genes FOXO1 and PDX-1.
23.6% (p < .05) in AMK3 group mice when compared with MC group
mice. Similarly, the serum level of TC decreased after the continuous
administration of AMK for two and three weeks. However, these
parameters were not completely restored when compared with the
parameters in NC mice.
3.3. Effects of AMK on gut microbiota and inflammation
As shown in Fig. 2B, serum IL-1β level, which was measured as an
indicator of inflammation, was significantly higher (∼2-fold) in the db/
db MC group than in the NC group (p < .05). However, serum IL-1β
levels of the mice treated with AMK for 1–3 weeks were decreased by
14.8% (p > .05), 32.6% (p < .05), and 42.7% (p < .05), respectively.
The IL-1β levels of AMK3 and NC groups (p > .05) were not significantly different. Besides, as shown in Fig. 4A and B, the protein
expression of NF-κB p65 in liver and pancreas tissues was significant
(p < .05) up-regulated in MC group in contrast with NC group. However, AMK treatment significantly (p < .05) down-regulated the protein expression in a time-dependent manner, implying that AMK
treatment could restore the levels of inflammation biomarkers associated with T2DM to near-normal levels.
Serum endotoxin levels in the db/db MC group increased by 2.7-fold
relative to those in the NC group (Fig. 2C). However, one week, two
weeks, and three weeks of AMK treatment significantly suppressed
(p < .05) LPS-induced endotoxin production in a time-dependent
manner by 28.1%, 36.5%, and 41.7%, respectively.
Previous studies have revealed that obesity is associated with the
down-regulated gene expression of the gram-negative bacterial species
B. thetaiotaomicron and M. smithii. Real-time PCR results obtained in the
present study were similar to those of previous studies. As illustrated in
Fig. 2D and E, the expression levels of 16S rRNA of B. thetaiotaomicron
and M. smithii in db/db model mice drastically decreased to 33.5% and
20.8% of those in NC mice, respectively (p < .05). 16S rRNA expression, however, was markedly restored by AMK treatment. In addition,
the regulatory effects of AMK proportionally increased in a time-dependent manner. Moreover, the levels of M. smithii and B. thetaiotaomicron after three weeks of AMK treatment approached normal levels
(p > .05), suggesting AMK has regulatory effects on gut microbiota.
3.5. Effects of AMK on the expression levels of GLP-1R and PI3K proteins
The expression levels of GLP-1R, FOXO1, PDX-1, and PI3K proteins
in hepatic and pancreatic tissues were analyzed through Western blot.
The results, which are shown in Fig. 4A and B, were consistent with the
mRNA expression profiles shown in Fig. 3. Especially, the expression of
FOXO1 was significantly higher (p < .05), whereas those of GLP-1R,
PDX-1, and PI3K were significantly lower (p < .05) in the model db/db
mice than those in NC mice. AMK treatment could markedly reverse
these variations in gene expression, suggesting that AMK had a marked
effect on the activation of GLP-1R, PI3K, and its downstream signaling
pathway.
3.6. Effects of AMK on liver histology
Liver morphology was analyzed through H & E staining and Oil Red
O staining. The results are shown in Fig. 5A and B. Fig. 5A shows that
NC mice exhibited normal liver tissue structure, which was compact
and clearly delineated with regularly arranged hepatic cells. By contrast, the liver tissue of db/db MC mice disintegrated and shrunk, and
hepatic cells were arranged irregularly without a clear boundary. In
addition, the livers of MC mice showed large areas of vacuolization and
inflammatory cell infiltration. Fig. 5B shows that numerous lipid droplets accumulated in the cytoplasm of hepatocytes in MC mice, whereas
no lipid droplets were observed in NC mice. These results indicated that
the MC mice had severe hepatic steatosis. However, these damages
were ameliorated in AMK-treated groups by different degrees. Fig. 5C
shows that the area of lipid droplets in AMK-treated group mice decreased (∼6.19%, 41.83%, and 45.05%, respectively) in a time-dependent manner relative to those in the MC mice, though considerable
3.4. Effects of AMK on the transcription of GLP-1R and PI3K
The mRNA levels of GLP-1R, FOXO1, PDX-1, and PI3K in hepatic
142
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
Fig. 2. Effects of AMK on body weight, inflammation and gut microbiota. (A) The initial and final body weight of mice. Serum IL-1β (B), serum endotoxin (C) were measured as markers
for inflammation. The 16S rRNA gene copy number of B. thetaiotaomicron (D) and M. smithii (E) were measured as representatives for gut microbiota using qRT-PCR, universal bacteria
16S rRNA was used as internal control. B. thetaiotaomicron, bacteroides thetaiotaomicron; M. smithii, methanobrevibacter smithii; NC, normal control group; MC, model control group; MET,
metformin-treated group; AMK1, AMK-treated for one week group; AMK2, AMK-treated for two weeks group; AMK3, AMK-treated for three weeks group. Data are expressed as the
mean ± SD (n =v10). abcde Different superscript letters indicated statistically significant differences (p < .05).
Table 2
Effects of AMK on serum parameters.
Serum Parameter
Triglyceride (mmol/L)
Total cholesterol (mmol/L)
Glucose (mmol/L)
Insulin (mIU/L)
HOMA-IR
NC
1.25
3.67
6.03
4.27
1.12
MC
±
±
±
±
±
c
0.07
0.43d
0.90d
1.21c
0.26d
MET
a
2.12 ± 0.09
5.81 ± 0.22a
21.92 ± 2.05a
7.65 ± 0.51b
7.44 ± 0.78a
AMK1
b
1.66 ± 0.19
4.73 ± 0.25c
11.66 ± 1.29c
9.04 ± 1.06a
4.70 ± 0.88c
AMK2
a
2.06 ± 0.21
5.48 ± 0.27a,b
20.61 ± 1.32a
8.64 ± 0.57a
7.89 ± 0.47a
AMK3
a
1.92 ± 0.14
5.14 ± 0.43b,c
15.96 ± 2.04b
8.88 ± 0.63a,
6.31 ± 1.03a,b
1.62 ± 0.07b
5.09 ± 0.38b,c
13.93 ± 1.46b,c
8.70 ± 0.71a
5.38 ± 0.70b,c
NC, normal control group; MC, model control group; MET, metformin-treated group; AMK1, AMK-treated for one week group; AMK2, AMK-treated for two weeks group; AMK3, AMKtreated for three weeks group.
Data are expressed as the mean ± SD (n = 10).
abcd Different superscript letters within the row indicated statistically significant differences by Dunnet's test (P < .05).
Homeostasis model assessment of insulin resistance (HOMA-IR) = [fasting glucose (mM) × fasting insulin (mIU/mL)]/22.5.
143
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
Fig. 3. Effect of AMK on transcription of gene mRNA level
in GLP-1R and PI3K signaling pathway. GLP-1R, FOXO1,
PI3K and PDX-1 mRNA expression were detected in liver
(A) and pancreas (B) with real-time PCR. GAPDH was used
as internal control. FOXO1, forkhead box protein O1; GLP1R, glucagon-like peptide-1 receptor; PDX-1, pancreatic
and duodenal homeobox 1; PI3K, phosphatidylinositol-3kinase. NC, normal control group; MC, model control
group; MET, metformin-treated group; AMK1, AMK-treated
for one week group; AMK2, AMK-treated for two weeks
group; AMK3, AMK-treated for three weeks group. Data are
expressed as the mean ± SD (n =v10). Different superscript letters indicated statistically significant differences
by Dunnett's test (P < .05).
These findings were consistent with those on serum endotoxin levels
presented in Fig. 2B and indicated that AMK can effectively regulate
intestinal microbiota.
amounts of lipid droplets remained. These results corresponded to the
serum lipid profiles shown in Table 2.
Images of the H & E staining of adipocytes in subcutaneous abdominal fat are shown in Fig. 5D. The lipid vacuoles of the NC group
mice were compact and well distributed, whereas those of the MC
group were disordered. In addition, the MC group exhibited excess lipid
vacuoles and inflammatory cell infiltration. In contrast to the MC
group, the AMK-treated groups had smaller adipocytes and attenuated
inflammatory cell infiltration (reduced by 27.2%, 55.0% and 57.0%,
respectively as shown in Fig. 5E) in perirenal fat. These results indicated that AMK has beneficial effects on adipocytes and obesity.
The H & E staining results of pancreatic islet cells are shown in
Fig. 5F. The islets of NC group mice were round or oval with welldefined boundaries and were filled with dense, well-distributed endocrine cells. By contrast, the islet cells of the MC group mice were irregularly shaped with unclear margins, a low number of endocrine cells,
nuclear pyknosis, vacuolar degeneration, and inflammatory cell infiltration. These features, however, recovered through the administration of AMK and metformin. As shown in Fig. 5F, the reduced number of
islet β-cells was observed in MC group and AMK treated-groups significantly increased the number of islet β-cells by 21.1%, 52.0% and
55.6%, respectively in contrast with MC group.
Fig. 5H shows that intestinal tissue from NC mice displayed intact
architecture with well-arranged villi and crypts. However, intestinal
tissue from MC mice presented abnormal structure with abnormal intestinal walls, disorganized and collapsed intestinal villi, and swollen
and degenerated villus epithelium. These features collectively indicated
the drastic histological disruption of the intestines of db/db MC mice.
However, AMK treatment significantly attenuated intestinal damage.
4. Discussion
Metformin (dimethyl biguanide) has been widely used since the
1950 and is the recommended first-line treatment for T2DM given its
high effectiveness in lowering blood glucose (Yang, Xu, Zhang,
Cai, & Zhang, 2016). However, its exact molecular target remains unknown. Previous studies have shown that metformin suppresses gluconeogenesis and increases glucose utilization by directly inhibiting
complex 1 activity of the mitochondrial respiratory chain (Owen,
Doran, & Halestrap, 2000). Others have documented that metformin
non-competitively inhibits mitochondrial glycerophosphate dehydrogenase to alter the hepatocellular redox state (Madiraju et al.,
2014). Metformin acts as an insulin sensitizer through the phosphorylation of AMP-activated protein kinase (AMPK) and inhibition of
acetyl-coA carboxylase (Fullerton et al., 2013). Despite its beneficial
effects on diabetes, metformin has adverse gastrointestinal side effects.
Other approved drugs, such as thiazolidinediones and sodium-glucose
co-transporter 2 inhibitors, have limitations and adverse effects, including the increased risk of hypoglycaemia and weight loss (Tahrani,
Barnett, & Bailey, 2016). Hence, the discovery of effective drugs and
individualized therapies for T2DM is urgently required.
Numerous foods and medicinal plants have recently attracted
worldwide attention for their potential applications as potent anti-inflammatory and anti-diabetic agents (Shi, Loftus, McAinch, & Su, 2017;
Yan & Zheng, 2017). AMK is a folk medicinal herb with several
144
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
(A)
Liver
(B)
Pancreas
Fig. 4. Effect of AMK on protein expression
level in NF-κB p65, GLP-1R and PI3K signaling
pathway. GLP-1R, FOXO1, PI3K and PDX-1
protein expression were detected in liver (A)
and pancreas (B). Quantification of protein
expression in liver (C) and pancreas (D) from
immunoblot. β-actin was used as internal
control. FOXO1, forkhead box protein O1;
GLP-1R, glucagon-like peptide-1 receptor;
PDX-1, pancreatic and duodenal homeobox 1;
PI3K, phosphatidylinositol-3-kinase. NF-κB,
nuclear factor-kappa B; NC, normal control
group; MC, model control group; MET, metformin-treated group; AMK1, AMK-treated for
one week group; AMK2, AMK-treated for two
weeks group; AMK3, AMK-treated for three
weeks group; Data are expressed as the
mean ± SD (n = 10). Different superscript
letters indicated statistically significant differences by Dunnett's test (P < .05).
GLP-1R
FOXO1
PDX-1
PI3K
NF-țB p65
ȕ-actin
NC
MC MET AMK1 AMK2 AMK3
(C)
NC
1
relative protein expression
ratio to ȕ-actin
NC MC MET AMK1 AMK2 AMK3
MC
MET
AMK1
AMK3
a
b
0.8
a
bc
b
c
a
a
0.6
a
0.4
0.2
AMK2
b
d
bc
cd
d
e
ab a
b
b
c bc
d
e
c c
d
e
c
d
e
0
GLP-1R
relative protein expression
ratio to ȕ-actin
(D)
FOXO1
PI3K
NC
1.20
MC
PDX-1
MET
AMK1
AMK2
AMK3
a
b
1.00
a
b
b
a
0.80
b
c
0.60
a
d
0.40
NF-țB p65
b
e
c
0.20
b
cc
d
a
c
c
bc
d d
c
b
d
c
cd
e
e
d
0.00
GLP-1R
FOXO1
PI3K
PDX-1
NF-țB p65
serum levels of inflammatory biomarkers, as well altered gut microbiota and regulated the PI3K/FOXO1/PDX-1 signaling pathway.
The db/db mouse was chosen as the T2DM animal model in the
present study given that it can maintain elevated levels of blood glucose
and insulin for extended durations. As illustrated in Table 1, the serum
levels of markers associated with T2DM in db/db model mice were
significantly higher than those in normal C57 mice. FBG and serum TG
and TC levels in T2DM db/db mice remarkably decreased by 36%,
23.6%, and 12.4%, respectively, after three weeks of treatment with
pharmacological activities. Its anti-inflammatory, anti-oxidant, gastroprotective, and anti-adipogenetic effects are supported by a growing
body of evidence. Nevertheless, studies on the anti-diabetic effect of
AMK in vivo remain scant. The present study is the first to investigate
the anti-diabetic effect of AMK on T2DM db/db mice. This study revealed that the oral administration of AMK at a dose of 100 mg/kg for
three weeks has beneficial effects and provided the first clear evidence
for the anti-diabetic effect of AMK on T2DM. Specifically, this study
found that AMK treatment decreased blood glucose, lipid profiles, and
145
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
(A) Liver
100ʅŵ
100ʅŵ
NC
100ʅŵ
MC
MET
100ʅŵ
100ʅŵ
AMK 1
100ʅŵ
AMK 2
Fig. 5. Effects of AMK on histopathological analysis. (A) Liver tissues stained with H & E (black
arrow: inflammatory cell infiltration). (B) Liver
tissues stained with Oil Red O (black arrow: lipid
droplets) and (C) the proportion of Oil Red O
stained lipid droplets area in entire picture (black
arrow: lipid droplets). (D) Adipose tissues stained
with H & E (black arrow: inflammatory cell infiltration) and (E) the proportion of infiltrating
area in entire picture. (F) Pancreas tissues stained
with H & E and (G) the number of islet β-cells. (H)
Small intestine tissue stained with H & E (black
arrow: the collapse, swelling and degeneration of
intestinal villi). Representative histology images
of small intestine tissue were captured at 100×
magnification objective lens and the rest tissues at
200×. NC, normal control group; MC, model
control group; MET, metformin-treated group;
AMK1, AMK-treated for one week group; AMK2,
AMK-treated for two weeks group; AMK3, AMKtreated for three weeks group. Data are expressed
as mean ± SD (n = 10). Different superscript
letters indicated statistically significant differences by Dunnett's test (P < .05).
AMK3
(B) Liver
100ʅŵ
100ʅŵ
NC
100ʅŵ
MC
MET
100ʅŵ
100ʅŵ
AMK 1
100ʅŵ
AMK 2
AMK 3
(C)
area of lipid droplets
(%)
30
a
25
b
20
cd
15
c
d
10
5
0
e
NC
MC
MET AMK1 AMK2 AMK3
T2DM. Obesity is associated with dysregulated glucose levels and lipid
metabolism and results from unhealthy lifestyle and high-fat diet. It is a
major risk factor of IR and T2DM. Obesity is another characteristic of
the db/db mouse, as shown in Fig. 2A. After three weeks of AMK
treatment through oral administration, the body weight of db/db mice
AMK. Given that fasting serum insulin levels notably increased after
AMK treatment, we posited that that AMK exerts anti-diabetic effects by
increasing insulin secretion and promoting pancreatic β-cell mass and
proliferation. Moreover, the decrease in HOMA-IR (∼2.06) indicated
that three weeks of AMK treatment ameliorated IR in db/db mice with
146
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
(D) Adipocytes
Fig. 5. (continued)
100ʅŵ
100ʅŵ
NC
100ʅŵ
MC
MET
100ʅŵ
100ʅŵ
AMK 1
100ʅŵ
AMK 2
AMK 3
(E)
1.40
a
infiltrating area
(%)
1.20
1.00
b
0.80
0.60
d
0.40
0.20
c
c
e
0.00
NC
MC
MET AMK1 AMK2 AMK3
(F) Pancreas
100ʅŵ
100ʅŵ
NC
MC
100ʅŵ
AMK 1
100ʅŵ
MET
100ʅŵ
100ʅŵ
AMK 2
AMK3
147
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
islet ȕ-cell number
(G)
300
250
Fig. 5. (continued)
a
a
200
b
150
d
b
c
100
50
0
NC
MC
MET AMK1 AMK2 AMK3
(H) Small intestine
NC
AMK 1
MC
MET
AMK 2
AMK 3
intestinal epithelial cells through the polyamine-mediated K+ channel
signaling pathway (Song et al., 2014).
Studies on gut microbiota and their relevance to T2DM have increased due to the development of high-throughput sequencing technology. The composition and function of gut microbiota change in ob/
ob obese mice and in T2DM patients. Generally, the abundance of
Firmicutes were increased, while Bacteroides were decreased (Turnbaugh
et al., 2009). This study investigated two characterized representatives
of Bacteroides and Euryarchaeota: B. thetaiotaomicron and M. smithii. B.
thetaiotamicron, M. smithii, and Eubacterium rectale have been selected as
representative species to identify interactions between bacteria in the
gut ecosystem through metabolic modeling (Shoaie et al., 2013). B.
thetaiotaomicron has been used as a model bacterium to identify the
potential effects of galactooligosaccharides on infant gut-related bacterial
species
(Lammerts
van
Bueren,
Mulder,
van
Leeuwen, & Dijkhuizen, 2017) and has been engineered as a platform to
sense and respond to stimuli in mouse gut microbiota (Mimee, Tucker,
Voigt, & Lu, 2015). M. smithii colonization has been used as a marker to
investigate the role of methanogens in human gut microbiota through
an in vitro model and to predict high-fat-diet-induced weight gain in
rats (Tottey et al., 2015). Thus, B. thetaiotaomicron and M. smithii were
selected as representatives for gut microbiota in the present study. B.
thetaiotaomicron is a prominent anaerobic bacterium that resides in the
human distal intestine. It efficiently breaks down dietary polysaccharide and its products into individual monosaccharides for energy
harvesting and host metabolic regulation (Martens, Koropatkin,
Smith, & Gordon, 2009). Kelly et al. found that B. thetaiotaomicron
ameliorates inflammation by targeting the active NF-κB subunit RelA
significantly decreased by approximately 2.78 g relative to that of nontreated mice. This result might be related to the reduced FBG and lipid
profiles of the treated mice. Moreover, previous reports have documented the anti-obesity effect of AMK on L6 and HepG2 cells (Wang,
Bose, Kim, Han, & Kim, 2015) and on rats fed with high-fat diets (Kim
et al., 2011).
The liver is a major metabolic tissue linked to IR and β-cell dysfunction resulting from dysregulated glucose and lipid metabolism.
Severe liver steatosis is a step in the pathogenesis of T2DM
(Hsieh & Hsieh, 2011). Histological studies on liver morphology confirmed that pathological changes in the livers of db/db mice include cell
vacuolization, inflammatory cell infiltration, and lipid droplet accumulation. However, three weeks of AMK treatment remarkably alleviated the progression of hepatic steatosis in db/db mice. Adipose tissue
is the central tissue for energy harvest and is responsible for lipid metabolism. Dyslipidemia increases the level of circulating free fatty acids
(FFAs) (Ebbert & Jensen, 2013). The release of FFAs by adipose tissues
interrupts insulin signal transduction, causes lipid accumulation in liver
and muscle tissues, and is the origin of IR and T2DM
(Johnson & Olefsky, 2013). H & E staining results showed that db/db
model mice exhibited intercellular inflammatory cell infiltration and
abnormally sized adipocytes. AMK treatment restored inflammatory
cell infiltration to a near-normal level. Moreover, consistent with increased insulin secretion, histological studies on the pancreas showed
that AMK treatment restored inflammatory cell infiltration and increased the number of decreased endocrine cells in pancreatic islet
cells. The histological disruption of the intestines was also attenuated
by AMK treatment. Song et al. found that AMK speeded the repair of
148
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
serum insulin levels. Thus, we hypothesized that AMK can stimulate
insulin secretion as a GLP-1R agonist.
PI3K is a secondary messenger that participates in several critical
steps in insulin signal transduction and in glucose and lipid metabolism.
It is composed of the catalytic subunit p85 and the regulatory subunit
p110. These subunits are both associated with G-protein-mediated activation (Hawkins & Stephens, 2015). GLP-1R is a GPCR family member
that can activate PI3K. FOXO1 is another important downstream target
of the PI3K/AKT signaling pathway. Previous report has confirmed that
FOXO1 is involved in the apoptosis and proliferation of pancreatic islet
β-cells and that GLP-1 can affect the expression of FOXO1 in β-cells and
liver cells (Bastien-Dionne, Valenti, Kon, Gu, & Buteau, 2011). FOXO1 is
a negative regulator of PDX-1. It can partly combine with the PDX-1
promoter to prevent the translocation of PDX-1 from the nuclei to cytoplasm in pancreatic β-cells, thus decreasing the DNA-binding activity
of PDX-1 and inhibiting β-cell proliferation (Kitamura et al., 2002).
PDX-1 knockout mice, as well as humans with targeted PDX-1 mutations, lack pancreatic tissue (Kaneto & Matsuoka, 2015). In this present
study, mRNA and protein levels of PI3K and PDX-1 were significantly
up-regulated, whereas that of FOXO1 was significantly down-regulated,
in the pancreatic and hepatic tissues of db/db mice after AMK treatment. These results indicated that AMK activates PI3K/AKT signaling to
decrease the cellular expression of FOXO1 and increase that of PDX-1.
Brunet et al. found that insulin represses liver gluconeogenesis through
PI3K/AKT phosphorylation and FOXO1 inactivation (Brunet et al.,
1999). We suggest that AMK could effectively activate GLP-1R, which
acts on GLP-1 to strengthen insulin/IGF-1 signal. This effect, in turn,
leads to the phosphorylation of downstream PI3K/AKT pathway and
inhibits the expression of downstream FOXO1 to promote the nuclear
localization of PDX-1 and pancreatic β-cell mass and function. To the
best of our knowledge, this is the first study to utilize the T2DM db/db
mouse model to investigate the anti-diabetic effect of AMK and its
potential in vivo mechanism.
and by promoting the nuclear export of RelA. It is regulated by peroxisome proliferator-activated receptor-γ (Kelly et al., 2004). M. smithii,
the most abundant methanogenic Archaea in the human small intestine
and colon, plays a pivotal role in host energy metabolism by removing
hydrogen gas and producing methane, thereby stimulating intestinal
microbiota to produce additional acetate and butyrate; these organic
compounds subsequently act as important carbon sources for colon
epithelial cells (Samuel et al., 2007). Million et al. reported that obesity
is associated with the depletion of M. smithii in gut microbiota (Million
et al., 2012). Our results showed that the relative abundance of B.
thetaiotaomicron and M. smithii in db/db mice significantly increased
(1.3- and 2.9-fold, respectively) after three weeks of AMK treatment.
These results seemingly correspond with the histological characteristics
of the small intestine, attenuated levels of inflammation markers, and
decreased body weight of AMK-treated mice. Our findings confirmed
that B. thetaiotaomicron and M. smithii in gut microbiota are correlated
with anti-inflammatory and anti-obesity effects in db/db mice. Thus, B.
thetaiotaomicron and M. smithii have potential applications as probiotic
treatments for T2DM.
Low-grade inflammation is a hallmark of T2DM. The production of
IL-1β, an important circulating pro-inflammatory cytokine that mediates the detrimental effects of high glucose on human islet β-cells, is
induced by high glucose levels. IL-1β has a critical role in insulin secretion and NF-κB activation, thereby initiating and enhancing immune
and inflammatory responses in T2DM (Burke et al., 2015). LPS, or endotoxin, is a major component of the Gram-negative bacterial cell wall
and the main inducer of innate immune system activation. Thus, LPS
has a critical role in the pathophysiology of T2DM (Ulevitch & Tobias,
1999). Excessive fat intake alters adipose tissue metabolism by increasing the levels of circulating free fatty acids and alters the composition of gut microbiota by increasing the numbers of Gram-negative
bacteria. These effects subsequently increase plasma LPS level. LPS is a
principal ligand for Toll-like receptor 4 (TLR4) that stimulates inflammatory cells to synthesize and release immunomodulatory proteins
and contributes to metabolic endotoxemia through a MyD88-dependent
or MyD88-independent manner (Zhao et al., 2016). Serum endotoxin
levels in db/db mice after three weeks of treatment with orally administered metformin and AMK decreased by 45.6% and 41.7%. Recent
studies have documented that metformin activates AMPK to interfere
with LPS-induced innate immune responses in the isolated rat heart by
inactivation of TLR-4 pathway, involving in inhibiting TLR4 ligation,
cytokine synthesis, and NF-κB activation (Vaez et al., 2016; Vaez et al.,
2016). Therefore, we suggest that AMK might attenuate metabolic endotoxemia by suppressing the TLR-4-related pathway. Serum IL-β and
NF-κB protein expression also decreased in AMK-treated mice. Wang
et al. demonstrated that AMK could ameliorate the LPS-induced nitric
oxide production of RAW 264.7 cells and decrease serum levels of endotoxin, TNF-α, and IL-6 in rats fed with a high-fat diet and LPS (Wang
et al., 2015). These findings indicated that AMK attenuates low-grade
inflammation in T2DM.
The gut microbiota is also involved in the regulation of T2DM
through altering the secretion of incretins, such as GLP-1 and GLP-2
(Everard & Cani, 2013). The beneficial biological functions of GLP-1 are
mediated by its interaction with its specific receptor, GLP-1R, a member
of the B-subclass of the G protein-coupled receptor (GPCR) family
(Leech et al., 2011). GLP-1 binds to GLP-1R in β-cells and increases
cAMP levels. In turn, cAMP molecules individually act on protein kinase A and exchange protein directly activated by cAMP to stimulate
insulin secretion and promote β-cell growth (Purves, Kamishima,
Davies, Quayle, & Dart, 2009). The cleavage of GLP-1 is modulated by
the ubiquitous endogenous enzyme dipeptidyl peptidase IV (DPP-IV).
Thus, GLP-1R agonists (e.g. exenatide and liraglutide) and DPP-IV inhibitors (e.g. sitagliptin and vildagliptin) have potential applications as
novel treatments for T2DM (Drucker & Nauck, 2006). GLP-1R expression significantly increased in the hepatic and pancreatic tissues of the
AMK-treated group; these results corresponded with the increase in
5. Conclusion
In conclusion, treatment with AMK for 3 weeks could remarkably
improve glucose and lipid metabolism and insulin resistance, regulate
gut microbiota and inhibit inflammation in db/db mice, at least in part,
through regulating GLP-1R/PI3K/PDX-1 signaling pathway. Our results
should be confirmed in T2DM subjects.
Conflict of interest
The authors have declared no conflict of interest.
Acknowledgments
This work is supported by Zhejiang Natural Science Foundation (No.
LZ17H280001), National Natural Science Foundation of China (No.
81573591), Zhejiang Science and Technology Foundation (No.
2014F10033), Zhejiang Innovation Discipline Project for “Laboratory
Animal Genetic Engineering” (No. 201604), and Zhejiang Training
Project for High-level Innovative Health Talents (No. 201206).
References
Baothman, O. A., Zamzami, M. A., Taher, I., Abubaker, J., & Abu-Farha, M. (2016). The
role of Gut Microbiota in the development of obesity and Diabetes. Lipids in Health
and Disease, 15, 108. http://dx.doi.org/10.1186/s12944-016-0278-4.
Bastien-Dionne, P. O., Valenti, L., Kon, N., Gu, W., & Buteau, J. (2011). Glucagon-like
peptide 1 inhibits the sirtuin deacetylase SirT1 to stimulate pancreatic β-cell mass
expansion. Diabetes, 60(12), 3217–3222. http://dx.doi.org/10.2337/db11-0101.
Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Hu, L. S., ... Greenberg, M. E.
(1999). Akt promotes cell survival by phosphorylating and inhibiting a Forkhead
transcription factor. Cell, 96(6), 857–868. http://dx.doi.org/10.1016/S00928674(00)80595-4.
Burke, S. J., Stadler, K., Lu, D., Gleason, E., Han, A., Donohoe, D. R., ... Collier, J. J.
149
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
endothelial palmitic acid transcytosis and promotes insulin resistance. Scientific
Reports, 7(October 2016), 44659. http://dx.doi.org/10.1038/srep44659.
Madiraju, A. K., Erion, D. M., Rahimi, Y., Zhang, X.-M., Braddock, D. T., Albright, R. A., ...
Shulman, G. I. (2014). Metformin suppresses gluconeogenesis by inhibiting mitochondrial glycerophosphate dehydrogenase. Nature, 510(7506), 542–546. http://
dx.doi.org/10.1038/nature13270.
Martens, E. C., Koropatkin, N. M., Smith, T. J., & Gordon, J. I. (2009). Complex glycan
catabolism by the human gut microbiota: The bacteroidetes sus-like paradigm.
Journal of Biological Chemistry. http://dx.doi.org/10.1074/jbc.R109.022848.
Million, M., Maraninchi, M., Henry, M., Armougom, F., Richet, H., Carrieri, P., ... Raoult,
D. (2012). Obesity-associated gut microbiota is enriched in Lactobacillus reuteri and
depleted in Bifidobacterium animalis and Methanobrevibacter smithii. International
Journal of Obesity (London), 36(6), 817–825. http://dx.doi.org/10.1038/ijo.2011.
153.
Mimee, M., Tucker, A. C., Voigt, C. A., & Lu, T. K. (2015). Programming a Human
Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to
Stimuli in the Murine Gut Microbiota. Cell Systems, 1(1), 62–71. http://dx.doi.org/10.
1016/j.cels.2015.06.001.
More, V. R., Wen, X., Thomas, P. E., Aleksunes, L. M., & Slitt, A. L. (2012). Severe diabetes
and leptin resistance cause differential hepatic and renal transporter expression in
mice. Comparative Hepatology, 11, 1. http://dx.doi.org/10.1186/1476-5926-11-1.
Owen, M. R., Doran, E., & Halestrap, A. P. (2000). Evidence that metformin exerts its antidiabetic effects through inhibition of complex 1 of the mitochondrial respiratory
chain. Biochemical Journal, 348(Pt 3), 607–614. http://dx.doi.org/10.1042/02646021:3480607.
Purves, G. I., Kamishima, T., Davies, L. M., Quayle, J. M., & Dart, C. (2009). Exchange
protein activated by cAMP (Epac) mediates cAMP-dependent but protein kinase Ainsensitive modulation of vascular ATP-sensitive potassium channels. The Journal of
Physiology, 587(14), 3639–3650. http://dx.doi.org/10.1113/jphysiol.2009.173534.
Samuel, B. S., Hansen, E. E., Manchester, J. K., Coutinho, P. M., Henrissat, B., Fulton, R.,
... Gordon, J. I. (2007). Genomic and metabolic adaptations of Methanobrevibacter
smithii to the human gut. Proceedings of the National Academy of Sciences of the United
States of America, 104(25), 10643–10648. http://dx.doi.org/10.1073/pnas.
0704189104.
Shi, M., Loftus, H., McAinch, A. J., & Su, X. Q. (2017). Blueberry as a source of bioactive
compounds for the treatment of obesity, type 2 diabetes and chronic inflammation.
Journal of Functional Foods, 30, 16–29. http://dx.doi.org/10.1016/j.jff.2016.12.036.
Shoaie, S., Karlsson, F., Mardinoglu, A., Nookaew, I., Bordel, S., & Nielsen, J. (2013).
Understanding the interactions between bacteria in the human gut through metabolic
modeling. Scientific Reports, 3, 2532. http://dx.doi.org/10.1038/srep02532.
Skarra, D. V., & Thackray, V. G. (2015). FOXO1 is regulated by insulin and IGF1 in pituitary gonadotropes. Molecular and Cellular Endocrinology, 405, 14–24. http://dx.doi.
org/10.1016/j.mce.2015.02.006.
Song, H. P., Li, R. L., Chen, X., Wang, Y. Y., Cai, J. Z., Liu, J., & Chen, W. W. (2014).
Atractylodes macrocephala Koidz promotes intestinal epithelial restitution via the
polyamine - Voltage-gated K+ channel pathway. Journal of Ethnopharmacology,
152(1), 163–172. http://dx.doi.org/10.1016/j.jep.2013.12.049.
Song, H. P., Li, R. L., Zhou, C., Cai, X., & Huang, H. Y. (2015). Atractylodes macrocephala
Koidz stimulates intestinal epithelial cell migration through a polyamine dependent
mechanism. Journal of Ethnopharmacology, 159, 23–35. http://dx.doi.org/10.1016/j.
jep.2014.10.059.
Tahrani, A. A., Barnett, A. H., & Bailey, C. J. (2016). Pharmacology and therapeutic
implications of current drugs for type 2 diabetes mellitus. Nature Reviews
Endocrinology, 12(2), 27339889. http://dx.doi.org/10.1038/nrendo.2016.86.
Tangvarasittichai, S. (2015). Oxidative stress, insulin resistance, dyslipidemia and type 2
diabetes mellitus. World Journal of Diabetes, 6(3), 456–480. http://dx.doi.org/10.
4239/wjd.v6.i3.456.
Tottey, W., Gaci, N., Borrel, G., Alric, M., O’Toole, P. W., & Brugère, J. F. (2015). In-vitro
model for studying methanogens in human gut microbiota. Anaerobe, 34, 50–52.
http://dx.doi.org/10.1016/j.anaerobe.2015.04.009.
Turnbaugh, P. J., Hamady, M., Yatsunenko, T., Cantarel, B. L., Duncan, A., Ley, R. E., ...
Gordon, J. I. (2009). A core gut microbiome in obese and lean twins. Nature,
457(7228), 480–484. http://dx.doi.org/10.1038/nature07540.
Ulevitch, R. J., & Tobias, P. S. (1999). Recognition of Gram-negative bacteria and endotoxin by the innate immune system. Current Opinion in Immunology. http://dx.doi.
org/10.1016/S0952-7915(99)80004-1.
Vaez, H., Najafi, M., Rameshrad, M., Toutounchi, N. S., Garjani, M., Barar, J., & Garjani,
A. (2016). AMPK activation by metformin inhibits local innate immune responses in
the isolated rat heart by suppression of TLR 4-related pathway. International
Immunopharmacology, 40, 501–507. http://dx.doi.org/10.1016/j.intimp.2016.10.
002.
Vaez, H., Rameshrad, M., Najafi, M., Barar, J., Barzegari, A., & Garjani, A. (2016).
Cardioprotective effect of metformin in lipopolysaccharide-induced sepsis via suppression of toll-like receptor 4 (TLR4) in heart. European Journal of Pharmacology,
772, 115–123. http://dx.doi.org/10.1016/j.ejphar.2015.12.030.
Wang, J.-H., Bose, S., Kim, H.-G., Han, K.-S., & Kim, H. (2015). Fermented Rhizoma
Atractylodis Macrocephalae alleviates high fat diet-induced obesity in association
with regulation of intestinal permeability and microbiota in rats. Scientific Reports, 5,
8391. http://dx.doi.org/10.1038/srep08391.
Wang, K.-T., Chen, L.-G., Wu, C.-H., Chang, C.-C., & Wang, C.-C. (2010). Gastroprotective
activity of atractylenolide III from Atractylodes ovata on ethanol-induced gastric
ulcer in vitro and in vivo. The Journal of Pharmacy and Pharmacology, 62(3), 381–388.
http://dx.doi.org/10.1211/jpp.62.03.0014.
Wang, R., Zhou, G., Wang, M., Peng, Y., & Li, X. (2014). The metabolism of polysaccharide from Atractylodes macrocephala Koidz and its effect on intestinal microflora. Evidence-Based Complementary and Alternative Medicine, 2014, 1–7. http://dx.
(2015). IL-1beta reciprocally regulates chemokine and insulin secretion in pancreatic
beta-cells via NF-kappaB. American Journal of Physiology. Endocrinology and
Metabolism, 309(8), E715–E726. http://dx.doi.org/10.1152/ajpendo.00153.2015.
Clemente, J. C., Ursell, L. K., Parfrey, L. W., & Knight, R. (2012). The impact of the gut
microbiota on human health: An integrative view. Cell, 148(6), 1258–1270. http://
dx.doi.org/10.1016/j.cell.2012.01.035.
Cooke, A. A., Connaughton, R. M., Lyons, C. L., McMorrow, A. M., & Roche, H. M. (2016).
Fatty acids and chronic low grade inflammation associated with obesity and the
metabolic syndrome. European Journal of Pharmacology, 785, 207–214. http://dx.doi.
org/10.1016/j.ejphar.2016.04.021.
da Rocha Fernandes, J., Ogurtsova, K., Linnenkamp, U., Guariguata, L., Seuring, T.,
Zhang, P., ... Makaroff, L. E. (2016). IDF Diabetes Atlas estimates of 2014 global
health expenditures on diabetes. Diabetes Research and Clinical Practice, 117, 48–54.
http://dx.doi.org/10.1016/j.diabres.2016.04.016.
Dai, B., Wu, Q., Zeng, C., Zhang, J., Cao, L., Xiao, Z., & Yang, M. (2016). The effect of
Liuwei Dihuang decoction on PI3K/Akt signaling pathway in liver of type 2 diabetes
mellitus (T2DM) rats with insulin resistance. Journal of Ethnopharmacology, 192,
382–389. http://dx.doi.org/10.1016/j.jep.2016.07.024.
Drucker, D. J., & Nauck, M. A. (2006). The incretin system: Glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors in type 2 diabetes. Lancet.
http://dx.doi.org/10.1016/S0140-6736(06)69705-5.
Ebbert, J. O., & Jensen, M. D. (2013). Fat depots, free fatty acids, and dyslipidemia.
Nutrients, 5(2), 498–508. http://dx.doi.org/10.3390/nu5020498.
Everard, A., & Cani, P. D. (2013). Diabetes, obesity and gut microbiota. Best
Practice & Research Clinical Gastroenterology, 27(1), 73–83. http://dx.doi.org/10.
1016/j.bpg.2013.03.007.
Fullerton, M. D., Galic, S., Marcinko, K., Sikkema, S., Pulinilkunnil, T., Chen, Z.-P., ...
Steinberg, G. R. (2013). Single phosphorylation sites in Acc1 and Acc2 regulate lipid
homeostasis and the insulin-sensitizing effects of metformin. Nature Medicine, 19(12),
1649–1654. http://dx.doi.org/10.1038/nm.3372.
Hawkins, P. T., & Stephens, L. R. (2015). PI3K signalling in inflammation. Biochimica et
Biophysica Acta - Molecular and Cell Biology of Lipids, 1851(6), 882–897. http://dx.doi.
org/10.1016/j.bbalip.2014.12.006.
Herrema, H., IJzerman, R. G., & Nieuwdorp, M. (2016). Emerging role of intestinal microbiota and microbial metabolites in metabolic control. Diabetologia. http://dx.doi.
org/10.1007/s00125-016-4192-0.
Holst, J., Christensen, M., Lund, A., De Heer, J., Svendsen, B., Kielgast, U., & Knop, F. K.
(2011). Regulation of glucagon secretion by incretins. Diabetes, Obesity and
Metabolism. http://dx.doi.org/10.1111/j.1463-1326.2011.01452.x.
Hsieh, P.-S., & Hsieh, Y.-J. (2011). Impact of liver diseases on the development of type 2
diabetes mellitus. World Journal of Gastroenterology, 17(48), 5240–5245. http://dx.
doi.org/10.3748/wjg.v17.i48.5240.
Johnson, A. M. F., & Olefsky, J. M. (2013). The origins and drivers of insulin resistance.
Cell. http://dx.doi.org/10.1016/j.cell.2013.01.041.
Kaneto, H., & Matsuoka, T. A. (2015). Role of pancreatic transcription factors in maintenance of mature ??-cell function. International Journal of Molecular Sciences, 16(3),
6281–6297. http://dx.doi.org/10.3390/ijms16036281.
Kaneto, H., Miyatsuka, T., Kawamori, D., Yamamoto, K., Kato, K., Shiraiwa, T., ...
Matsuoka, T.-A. (2008). PDX-1 and MafA play a crucial role in pancreatic beta-cell
differentiation and maintenance of mature beta-cell function. Endocrine Journal,
55(2), 235–252. http://dx.doi.org/10.1507/endocrj.K07E-041.
Kelly, D., Campbell, J. I., King, T. P., Grant, G., Jansson, E.a., Coutts, A. G. P., ... Conway,
S. (2004). Commensal anaerobic gut bacteria attenuate inflammation by regulating
nuclear-cytoplasmic shuttling of PPAR-gamma and RelA. Nature Immunology, 5(1),
104–112. http://dx.doi.org/10.1038/ni1018.
Kim, C. K., Kim, M., Oh, S. D., Lee, S. M., Sun, B., Choi, G. S., ... Min, B. Il. (2011). Effects
of Atractylodes macrocephala Koidzumi rhizome on 3T3-L1 adipogenesis and an
animal model of obesity. Journal of Ethnopharmacology, 137(1), 396–402. http://dx.
doi.org/10.1016/j.jep.2011.05.036.
Kitamura, T., Nakae, J., Kitamura, Y., Kido, Y., Biggs, W. H., Wright, C. V. E., ... Accili, D.
(2002). The forkhead transcription factor Foxo1 links insulin signaling to Pdx1 regulation of pancreatic β cell growth. Journal of Clinical Investigation, 110(12),
1839–1847. http://dx.doi.org/10.1172/JCI200216857.
Kohn, A. D., Summers, S. A., Birnbaum, M. J., & Roth, R. A. (1996). Expression of a
constitutively active Akt Ser/Thr kinase in 3T3-L1 adipocytes stimulates glucose
uptake and glucose transporter 4 translocation. Journal of Biological Chemistry,
271(49), 31372–31378. http://dx.doi.org/10.1074/jbc.271.49.31372.
Lammerts van Bueren, A., Mulder, M., van Leeuwen, S., & Dijkhuizen, L. (2017). Prebiotic
galactooligosaccharides activate mucin and pectic galactan utilization pathways in
the human gut symbiont Bacteroides thetaiotaomicron. Scientific Reports, 7(August
2016), 40478. http://dx.doi.org/10.1038/srep40478.
Leech, C. A., Dzhura, I., Chepurny, O. G., Kang, G., Schwede, F., Genieser, H. G., & Holz,
G. G. (2011). Molecular physiology of glucagon-like peptide-1 insulin secretagogue
action in pancreatic β cells. Progress in Biophysics and Molecular Biology, 107(2),
236–247. http://dx.doi.org/10.1016/j.pbiomolbio.2011.07.005.
Li, C. Q., He, L. C., Dong, H. Y., & Jin, J. Q. (2007). Screening for the anti-inflammatory
activity of fractions and compounds from Atractylodes macrocephala koidz. Journal
of Ethnopharmacology, 114(2), 212–217. http://dx.doi.org/10.1016/j.jep.2007.08.
002.
Li, X., Lin, J., Han, W., Mai, W., Wang, L., Li, Q., ... Chen, D. (2012). Antioxidant ability
and mechanism of rhizoma atractylodes macrocephala. Molecules, 17(11),
13457–13472. http://dx.doi.org/10.3390/molecules171113457.
Li, D., Wang, P., Wang, P., Hu, X., & Chen, F. (2016). The gut microbiota: A treasure for
human health. Biotechnology Advances, 34(7), 1210–1224. http://dx.doi.org/10.
1016/j.biotechadv.2016.08.003.
Li, W., Yang, X., Zheng, T., Xing, S., Wu, Y., Bian, F., ... Jin, S. (2017). TNF-α stimulates
150
Journal of Functional Foods 39 (2017) 139–151
W.-Y. Zhang et al.
Journal of Ethnopharmacology, 136(1), 279–282. http://dx.doi.org/10.1016/j.jep.
2011.04.020.
Zhang, J., Huang, W., & Zeng, Q. (2015). Atractylenolide I protects mice from lipopolysaccharide-induced acute lung injury. European Journal of Pharmacology, 765, 94–99.
http://dx.doi.org/10.1016/j.ejphar.2015.08.022.
Zhao, H., Zhang, M., Zhou, F., Cao, W., Bi, L., Xie, Y., ... Wang, S. (2016).
Cinnamaldehyde ameliorates LPS-induced cardiac dysfunction via TLR4-NOX4
pathway: The regulation of autophagy and ROS production. Journal of Molecular and
Cellular Cardiology, 101, 11–24. http://dx.doi.org/10.1016/j.yjmcc.2016.10.017.
doi.org/10.1155/2014/926381.
Yan, F., & Zheng, X. (2017). Anthocyanin-rich mulberry fruit improves insulin resistance
and protects hepatocytes against oxidative stress during hyperglycemia by regulating
AMPK/ACC/mTOR pathway. Journal of Functional Foods, 30, 270–281. http://dx.doi.
org/10.1016/j.jff.2017.01.027.
Yang, X., Xu, Z., Zhang, C., Cai, Z., & Zhang, J. (2016). Metformin, beyond an insulin
sensitizer, targeting heart and pancreatic ?? cells. Biochimica et Biophysica Acta Molecular Basis of Disease, 1–7. http://dx.doi.org/10.1016/j.bbadis.2016.09.019.
Ye, Y., Wang, H., Chu, J.-H., Chou, G.-X., Chen, S.-B., Mo, H., ... Yu, Z.-L. (2011).
Atractylenolide II induces G1 cell-cycle arrest and apoptosis in B16 melanoma cells.
151
Документ
Категория
Без категории
Просмотров
1
Размер файла
1 607 Кб
Теги
2017, 020, jff
1/--страниц
Пожаловаться на содержимое документа