close

Вход

Забыли?

вход по аккаунту

?

jb.176.1.108-114.1994

код для вставкиСкачать
JOURNAL OF BACrERIOLOGY, Jan. 1994, p. 108-114
Vol. 176, No. 1
0021-9193/94/$04.00+0
Copyright X) 1994, American Society for Microbiology
The Nitrogen-Regulated Bacillus subtilis nrgAB Operon Encodes
a Membrane Protein and a Protein Highly Similar to the
Escherichia coli glnB-Encoded PI, Protein
LEWIS V. WRAY, JR., MARIETTE R. ATKINSON, AND SUSAN H. FISHER*
Department of Microbiology, Boston University School of Medicine, Boston, Massachusetts 02118
Received 3 September 1993/Accepted 28 October 1993
In order for cells to obtain nitrogen for macromolecular
synthesis, nitrogen-containing compounds must be transported
into the cell and, if necessary, degraded to either NH4' or
glutamate. The expression of enzymes required for the utilization of nitrogen-containing compounds is generally induced by
their substrates. In addition, the expression of many degradative and transport systems is regulated in response to nitrogen
availability in the growth medium (31).
In enteric bacteria, nitrogen regulation is mediated both
transcriptionally and posttranslationally. The nitrogen regulatory (Ntr) system controls the expression of many genes
involved in nitrogen metabolism, including glnA, the structural
gene for glutamine synthetase (GS). Transcriptional activation
of Ntr-regulated genes requires the phosphorylated form of
the NR, (NtrC) protein (31). NR,-phosphate binds to a specific
enhancer sequence and stimulates transcription initiation at
promoters transcribed by RNA polymerase containing the C(x4
sigma factor (29). The NRI, (NtrB) protein functions as a
kinase/phosphatase that determines the level of NR, phosphorylation (31).
The enzymatic activity of GS can be reduced posttranslationally by the covalent attachment of AMP to the GS protein
(adenylylation). In Escherichia coli, the glnE-encoded adenylyltransferase enzyme (ATase) catalyzes both the attachment
and removal of the AMP group from GS (31).
The enzymatic activities of both NRI, and ATase are
modulated by the glnB-encoded PI, protein (31). The activity of
PII is regulated posttranslationally by a reversible uridylylation
which is catalyzed by the glnD-encoded uridylyltransferase/
uridylyl-removing enzyme (UT/UR). The PI, protein is maintained in an unmodified state during growth in the presence of
excess nitrogen. Unmodified PI, stimulates NRI, phosphatase
activity, resulting in decreased transcriptional activation of
Ntr-regulated genes. In addition, the unmodified PI, protein
stimulates the adenylylation activity of ATase, causing the
adenylylation and inactivation of GS. During nitrogen-limited
growth, UT/UR converts PI, to PI,-UMP. This allows NRI, to
convert NRI to its transcriptionally active form, NR,-phos-
phate. Deadenylylation of adenylylated GS by ATase is also
stimulated by PI1-UMP. Homologs of PI, have been identified
in microorganisms as diverse as archaebacteria (39) and cyanobacteria (41), although their exact roles in cellular metabolism have not yet been established.
Nitrogen assimilation in Bacillus subtilis differs significantly
from that seen in enteric bacteria. The enzymatic activity of the
B. subtilis GS protein is not known to be regulated by adenylylation or any other posttranslational modification (9, 13). In
addition, there is no evidence for a global nitrogen regulatory
system analogous to the enteric Ntr system (14).
The B. subtilis GS structural gene, glnA, lies within the glnRA
operon (33). Expression of the glnRA operon is negatively
regulated by the GlnR repressor during growth with excess
nitrogen in response to an as yet unidentified metabolic signal
(14, 33). The glnRA operon is transcribed by the vegetative
(er) form of RNA polymerase. The B. subtilis homolog (uL) of
the enteric o7" sigma factor is required for expression of a
sucrose-degradative enzyme and for utilization of arginine,
ornithine, isoleucine, and valine as sole nitrogen sources but
does not control GS synthesis (8).
In B. subtilis, enzymes whose expression is known to be
derepressed during nitrogen-limited growth include GS (14),
aspartase (40), asparaginase (2, 16), urease (2), and -y-aminobutyrate permease (2, 44). During growth in the presence of
excess nitrogen, the expression of GS, urease, asparaginase,
and y-aminobutyrate permease is repressed in wild-type cells,
but not in glnA mutants (2, 34). This argues that the wild-type
OS protein is required for signalling nitrogen availability and
that nitrogen regulation appears to be mediated by a common
signal in B. subtilis. The B. subtilis GS regulatory protein,
GlnR, is not known to regulate the expression of any nitrogenregulated enzyme other than GS (2, 14).
To investigate further the mechanisms mediating nitrogen
regulation in B. subtilis, the genetic organization of another
operon transcribed from a nitrogen-regulated promoter was
determined. Unexpectedly, this operon, first identified by a
Tn917-lacZ insertion mutation (2), was found to encode a
protein whose amino acid sequence is similar to that of the E.
coli glnB-encoded P,, protein.
*
Corresponding author. Fax: 617-638-4286. Electronic mail address: shfisher@acs.bu.edu.
108
Downloaded from http://jb.asm.org/ on October 25, 2017 by guest
Expression of j8-galactosidase encoded by the nrg-29::Tn917-lacZ insertion increases 4,000-fold during
nitrogen-limited growth (M. R. Atkinson and S. H. Fisher, J. Bacteriol. 173:23-27, 1991). The chromosomal
DNA adjacent to the nmg-29::Tn917-lacZ insertion was cloned and sequenced. Analysis of the resulting
nucleotide sequence revealed that the Tn917-lacZ transposon was inserted into the first gene of a dicistronic
operon, nrg4B. The nrg4 gene encodes a 43-kDa hydrophobic protein that is likely to be an integral membrane
protein. The nrgB gene encodes a 13-kDa protein that has significant sequence similarity with the Escherichia
coli gInB-encoded PI, protein. Primer extension analysis revealed that the nrgAB operon is transcribed from a
single promoter. The nucleotide sequence of this promoter has significant similarity with the -10 region, but
not the -35 region, of the consensus sequence for Bacillus subtilis crA-dependent promoters.
NITROGEN-REGULATED BACILLUS SUBTILIS nrgAB OPERON
VOL. 176, 1994
TABLE 1. B. subtilis strains used in this study
Genotypea
Strain
168
SF10
SF12
SF300
SF305
SF320
SF321
SF330
SF335
trpC2
Wild type
nrg-29::Tn917-lacZ
nrg-29::Tn917-lacZ trpC2
nrgA::pNRG305 erm trpC2
nrg-29::Tn917-lacZ::pTV20 cat
nrg-29::Tn9J7-lacZ::pTV21A2 cat
AamyE::lacZ cat trpC2
AamyE::'F(nrgA-lacZ)335 cat
IlacZ
Tn917
Reference, source, or
derivation
This laboratory
2
2
168 x SF12 DNA
168 x pNRG305
SF12 x pTV20
SF12 x pTV21A2
168 x pSFL1
168 x pNRG335
pNRG301, pSFN20
pNRG303, pSFN21
(4)
------
/7
pNRG342
pNRG305
pNRG325
pNRG323
trpC2
pNRG328
SF335 x SF368 DNA
AnrgAB368::spec trpC2
168 X pNRG364
SF364 AnrgB364::spec trpC2
168 X pNRG365
SF365 4D(nrgB-lacZ)365 cat trpC2
168 X pNRG368
SF368 AnrgAB368::spec trpC2
aGenotype symbols are those of Anagnostopoulos et al. (1), with the addition
SF364
SF348
AamyE::4(nrgA-lacZ)335 cat
AnrgB364::spec trpC2
AamyE::4F(nrgA-lacZ)335 cat
Ispec
SF368
of nrg to denote nitrogen-regulated gene.
MATERUILS AND METHODS
Bacterial strains and plasmids. E. coli strains NM522 (17)
and KE93, a derivative of MM294 which contains the pcnB80
(22) mutant allele, were used as hosts for DNA cloning
experiments. Plasmid pJL73 contains a spectinomycin resistance gene cloned into the SmaI site of pBluescriptII SK
(Stratagene). E. coli plasmid pJDC9 was designed to allow the
cloning of DNA fragments with strong promoter activity and
contains a polylinker cloning region flanked by transcriptional
terminators (6). pJDC9 confers erythromycin resistance to
both E. coli and B. subtilis, although it does not replicate in B.
subtilis. The B. subtilis strains used in this study are listed in
Table 1.
Cell growth and media. Methods used for bacterial cultivation have been described previously (3). Glucose was added at
0.5%, and glutamate, proline, and NH4Cl were added at 0.2%
to the MOPS (morpholine propanesulfonic acid) minimal
medium of Neidhardt et al. (27). The growth phenotype of the
nrgAB deletion mutants was examined on BSS minimal plates
(5) made with Noble agar (Difco Laboratories, Detroit,
Mich.). All nitrogen sources were filter sterilized and added at
0.2% to the BSS minimal plates. Spore production was examined in liquid cultures grown overnight in Difco sporulation
medium (38) or in Sterlini-Mandelstam resuspension medium
as previously described (28). Spore formation was measured by
titration of the survivors of heating for 10 min at 80 to 85°C
(28).
Enzyme assays. 1-Galactosidase activity was assayed as
previously described (3) in extracts of cultures grown to
mid-log growth phase (70 to 90 Klett units) in MOPS minimal
medium. One unit of ,B-galactosidase activity produced one
nanomole of o-nitrophenol per minute. GS activity was determined by the Mn24-dependent reverse transferase assay in
permeabilized cells (13).
DNA cloning and plasmid constructions. Chromosomal
DNA adjacent to the nrg-29::Tn917-lacZ insertion was cloned
by using the method described by Youngman (46). Plasmid
pSFN20, which contains nrgAB DNA from the nrg-29::
Tn917-lacZ insertion site to the downstream EcoRI site (Fig.
1), was obtained by using the integrative plasmid pTV20 (46).
Plasmid pNRG301 was constructed by subcloning an EcoRIBglII DNA fragment containing the downstream end of Tn917
r'
SF365
nrg
lacZ
cat
S
FIG. 1. Physical structure of the nrgAB operon. The position of the
nrg-29::Tn917-lacZ insertion is indicated at the top. The nrgAB promoter is indicated by the arrow to the left of the nrgA gene. A putative
transcription terminator is indicated by the stem-and-loop structure to
the right of the nrgB gene. The EcoRI site at the left is located
approximately 15 kb upstream of the nrgAB operon. Physical maps of
the cloned DNA inserts are shown below the map of the nrgAB
operon. A deletion (A) in pNRG303 and pSFN21 is indicated. The
chromosomal structures of strains SF364, SF365, and SF368 are shown
at the bottom. The Tn917-lacZ transposon and lacZ cat gene cassette
are not drawn to scale.
and the adjacent nrgAB DNA from pSFN20 into pMTL20P
(4).
With the integrative plasmid pTV21A2 (46), pSFN21 was
obtained by digesting chromosomal DNA from SF321 with
EcoRI (Fig. 1). Plasmid pSFN21 contains 1.0 kb of DNA
upstream of the nrg-29::Tn917-lacZ insertion. Southern blot
analysis of B. subtilis chromosomal DNA revealed that the
EcoRI site is located approximately 15 kb upstream of the
nrg-29::Tn917-lacZ insertion (46). Since pSFN21 contains only
1 kb of B. subtilis chromosomal DNA, a deletion must have
occurred in the B. subtilis chromosomal sequences present in
the original clone. A plasmid containing the entire 15 kb of
upstream DNA, pNRG342, was obtained by using the E. coli
strain KE93 (pcnB80) as the cloning host. The pcnB80 mutation lowers the copy number of ColEl-derived plasmids 16fold (22) and thus facilitates the cloning of B. subtilis chromosomal DNA which is toxic in E. coli (46).
Plasmid pNRG303 (Fig. 1) was constructed by subcloning a
1.3-kb EcoRI-BamHI DNA fragment containing the upstream
end of Tn917 and the adjacent nrgA DNA from pSFN21 into
pJDC9 (6). The nrgAB promoter was subcloned as a 300-bp
TaqI fragment from pNRG303 into the AccI site of mpl8 (45).
Plasmid pNRG305 (Fig. 1) was constructed by subcloning the
EcoRI-HindIIl DNA fragment containing the nrgAB promoter
from the M13 clone into pJDC9. B. subtilis SF305, which
contains the plasmid pNRG305 integrated at the nrgAB chromosomal locus, was constructed by transforming strain 168 to
Downloaded from http://jb.asm.org/ on October 25, 2017 by guest
SF335 x SF364 DNA
SF344
109
110
WRAY ET AL.
RESULTS AND DISCUSSION
DNA sequencing of the nrgAB operon. Chroand
Cloning
mosomal DNA adjacent to the B. subtilis nrg-29::Tn917-lacZ
transposon insertion (2) was cloned in E. coli plasmids (see
Materials and Methods). Additional clones were obtained by
using an integrational plasmid, pNRG305, for chromosomal
walking. Figure 1 shows the physical map of the DNA inserts
for these clones. The nucleotide sequence obtained from these
clones is presented in Fig. 2.
Analysis of the DNA sequence revealed that the
nrg-29::Tn917-lacZ transposon was inserted into the first gene
of a dicistronic operon that we have designated nrgAB. Both of
the open reading frames are preceded by nucleotide sequences
that are complementary to the 3' end of the B. subtilis 16S
rRNA (25) and most likely serve as in vivo ribosome-binding
sites. Immediately downstream of the second open reading
frame (at nucleotides 1712 to 1734) is an inverted repeat
followed by seven T residues that is likely to function as a
factor-independent transcription terminator.
The first open reading frame encodes a protein with 404
amino acid residues and a deduced molecular weight of 42,733.
A search of the translated DNA sequence entries in GenBank
(release 77.0) revealed that the DNA sequence in GenBank
entry M98350 contained a truncated open reading frame which
encoded a protein of 251 amino acids that is 48% identical with
the sequence of the amino-terminal region of the NrgA
protein. The DNA for this GenBank entry is reported to be of
unknown bacterial origin and was isolated as a contaminant in
a commercial rat liver cDNA library. This result suggests that
there exists at least one other bacterium which contains a
homolog of the nrgA gene.
As calculated by the method of Kyte and Doolittle (21), the
NrgA protein has a mean hydropathicity of 8.39, indicating
that the NrgA protein is extremely hydrophobic. The hydropathicity profile of the NrgA protein is presented in Fig. 3. It
is apparent that the NrgA protein contains a large number of
highly hydrophobic regions that are separated by stretches of
relatively hydrophilic amino acids. A hydropathicity profile
with alternating hydrophobic and hydrophilic regions is typically obtained with membrane-bound proteins (21, 36). Thus, it
seems reasonable to assume that the nrgA gene encodes an
integral membrane protein. The NrgA protein may function as
a transport protein or possibly serves as a sensor of the cell's
external environment.
The nrgB gene encodes a protein with 116 amino acid
residues and a deduced molecular weight of 12,822. Comparison of the NrgB protein sequence with the translated GenBank sequences revealed significant sequence similarity with
the E. coli glnB-encoded PI, protein and its related homologs
(Fig. 4). The B. subtilis NrgB protein has the highest level of
similarity with the E. coli and Klebsiella pneumoniae glnBencoded proteins (57 and 58%, respectively). In contrast, the
NrgB protein is least similar to the Methanococcus thermolithotrophicus ORF105 protein (41%). To our knowledge, this is the
first report of a glnB homolog in a gram-positive organism.
The E. coli PI, protein is uridylyated at the tyrosine residue
located at position 51 (37). The NrgB protein contains an
isoleucine residue at this position, as does the Methanococcus
homolog. Moreover, there are 9 contiguous amino acid residues within this region of the NrgB protein which lack
similarity to the other related proteins (Fig. 4). This suggests
that the B. subtilis NrgB protein may not be subject to
posttranslational modification by uridylyation in the same way
as the enteric PI, protein. E. coli GlnB mutants are not
complemented by the B. subtilis nrgB gene (23).
Identification of the nrgAB operon transcription start sites.
Primer extension analysis was used to determine the transcription start sites of the nrgAB operon. With RNA isolated from
cells grown in medium containing poor nitrogen sources, e.g.,
glutamate or proline, two major transcripts were detected (Fig.
Downloaded from http://jb.asm.org/ on October 25, 2017 by guest
erythromycin resistance with pNRG305. By the method described for cloning chromosomal DNA sequences adjacent to
plasmid integrations (46), the plasmids pNRG323, pNRG325,
and pNRG328 (Fig. 1) were isolated from SF305 chromosomal
DNA digested with the restriction enzymes HindlIl, PstI, and
SphI, respectively.
Plasmid pNRG364 contains the spectinomycin resistance
gene fronm pJL73 cloned between the MluI and SspI restriction
sites located within the nrgB gene. In plasmid pNRG368, the
spectinomycin resistance gene from pJL73 was cloned between
the nrg-29::Tn917-lacZ insertion site in the nrg4 gene and the
SspI restriction site in the nrgB gene. Plasmid pNRG365
contains the promoterless spoIL4-lacZ cat cartridge from
pSGMU38 (12) cloned between the MluI and SspI restriction
sites located within the nrgB gene. B. subtilis strains SF364,
SF365, and SF368 were constructed by transforming strain 168
with linearized DNA of plasmids pNRG364, pNRG365, and
pNRG368, respectively. The chromosomal structure of these
strains was verified by Southern blot analysis (data not shown).
The plasmid pSFL1 is a lacZ transcriptional fusion vector
that integrates at the amyE locus. This vector is derived from
the plasmid pDH32 (18), which is a promoterless derivative of
ptrpBG1 (35) that has unique EcoRI and BamHI restriction
sites located upstream of a spoVG-lacZ translational fusion.
pSFL1 was constructed by cloning an EcoRI-SacI DNA fragment containing the E. coli trpA-lacZ translational fusion from
pCED6 (11) into pDH32. pSFL1 has unique EcoRI and
HindIII restriction sites located upstream of a promoterless
trpA-lacZ gene. Plasmid pNRG335 was constructed by cloning
the EcoRI-HindIll nrg4 promoter DNA fragment from
pNRG305 into pSFL1.
DNA sequencing. The nucleotide sequence was determined
by the dideoxynucleotide chain-termination method (32). Sequencing reactions were performed at 70°C with Taq DNA
polymerase (TaqTrack; Promega Cor.), with double-stranded
plasmid DNA as the template and 2P-end-labeled oligodeoxynucleotide primers. The entire sequence was determined
from both DNA strands by using the plasmids pNRG301,
pNRG303, pNRG323, pNRG325, pNRG328, and pNRG342
as templates. The 290 bp of DNA sequence upstream of
the nrg-29::Tn917-lacZ insertion are identical in plasmids
pNRG303 and pNRG342. This indicates that the deletion of
the B. subtilis chromosomal DNA present in pNRG303 did not
extend into the DNA sequences reported here. The sequence
of the 5-bp duplication generated by the nrg-29::Tn917-lacZ
insertion was deteirmined by using synthetic oligonucleotide
primers complementary to the ends of the transposon to
sequences pNRG301 and pNRG303. The wild-type DNA
sequence corresponding to the transposon insertion site was
determined by using pNRG328 DNA as a sequencing template. No alterations in the DNA sequence adjacent to the
transposon insertion junctions were observed.
RNA isolation and primer extensions. RNA was isolated
from B. subtilis cells grown to mid-log growth phase (70 to 90
Klett units) by extraction with guanidine thiocyanate and by
CsCl centrifugation (3). Primer extension experiments were
performed as previously described (15).
Nucleotide sequence accession number. The nucleotide sequence reported in this communication has been assigned
GenBank accession number L03216.
J. BAcrERIOL.
NITROGEN-REGULATED BACILLUS SUBTILIS nrgAB OPERON
VOL. 176, 1994
1
111
TCGATAACATTTCTCAAACCATGTCAGGUATCTTACATGAAAATGTTTTATCATTCTTTTTTCTCTATAATGAAGAAITTATAATTGCTTTTTAT
101
-10
-35
TCTGMAGATACGGAGGAATGAGACATGCAAATGGGCGATACAGTTTTTATGTTCTTTTGCGCTTTACTCGTGTGGCTGATGACCCCGGGATTAGCGTTA
nrgA M 0 M G D T V F M F F C A L L V W L M T P G L A L
201
TTTTATGGAGGAATGGTAAAGAGCAAMATGTGCTGAGCACTGCCATGCACAGTTTCTCTTCCATTGCCATCGTTTCCATCGTTTGGGTGCTGTTCGGAT
F Y G G M V K S K N V L S T A M H S F S S I A. I V S I V W V L F G Y
301
ATACACTTGCCTTCGCACCAGGCMTTCMTCATCGGCGGGCTGGAGTGGGCAGGCCTCAAAGGGGTCGGATTTGATCCGGGAGATTACAGCGATACCAT
401
CCCCCACTCGTTATTTATGATGTTCCAAATGACGTTCGCCGTTCTGACTACAGCGATTATTTCCGGGGCTTTCGCAGAGCGGATGCGATTCGGC.GCTTTT
P H S L F M M F Q M T F A V L T T A I I S G A F A E R M R F G A F
CTTTTATTCTCGGTTTTATGGGCCTCTTTGGTTTACACACCCGTAGCGCACTGGGTATGGGGCGGCGGCTGGATCGGCCAGCTTGGAGCGCTCGATTTCG
L L F S V L W A S L V Y T P V A H W V W G G G W I G Q L G A L D F A
TaqI
501
F A P
L A
T
G
I
N S
I
G G
E W A G
L
L K G V G
F
P
D
I
D Y S D T
G
601
N V V H
G G
S S G V A G L V L A
I
I V L G K R K D G T A S
S
N
H
P
701
CCTCATTTACACCTTCTTAGGAGGAGCTTTGATTTGGTTCGGCTGGTTCGGCTTTMCGTCGGCAGCGCATTGACCTTAGATGGTGTGGCCATGTACGCG
801
TTCATCMCACAAACACCGCGGCTGCAGCCGGGATCGCCGGCTGGATCTTAGTAGAATGGATCATTMCAAAAMCCGACAATGCTCGGAGCGGTATCTG
901
GGGCMTCGCCGGGCTTGTCGCCATTACGCCGGCTGCCGGATTTGTCACACCGTTCGCTTCCATTATTATCGGCATCATCGGCGGAGCTGTTTGTTTCTG
A I A G L V A I T P A A G F V T P F A S I I I G I I G G A V C F W
1001
GGGAGTATTCTCGCTTAAAAAGAATTCGGATACGACGACGCGCTTGACGCCTTTGGCCTGCACGGGATCGGCGGCACATGGGGCGGAATCGCMCAGGA
1101
TTATTCGCAACAACCTCTGTTMCTCAGCGGGCGCAGATGGGTTATTTTACGGTGATGCAAGCTTMTCTGGAAACAAATCGTCGCCATCGCCGCCACTT
1201
ATGTTTTTGTATTTATTGTCACTTTCGTTATTATTAAAATTGTAAGCCTCTTCCTTCCCCTTCGCGCAACTGAAGAAGAAGAGTCACTTGGGCTTGACTT
1301
AACGATGCACGGGGAAAAAGCATATCAAGATTCTATGTGAGGAGTGACGCTATGAGCGGTCAAATGTTCMGGTAGAAATTGTAACGCGTCCGGCAAATT
1401
TTGAAAAGCTGAAGCAGGAACTCGGAAAAATCGGAGTGACCTCTCTGACTTTCTCCAATGTACACGGCTGCGGCCTTCAAAAAGCACATACGGAGCTCTA
I
L
I
G V
L
T
N
F S
F
L
F
M H G
T
E
K
S
I
V T
E
Q
L
I
A G W
S A G A
F V
K A Y Q
E
K
L
N
V
I
L V
F G Y D D A L D A
K K K
T
V
I W F G W F G F N V G S A
L
T A A A A G
N
F A T
V
L G G A
G
D G
I
I
K
D S M
K
I
I
F G
F Y G
L
V S
L
F
I
E W
I
L H G
L
D A S
L
P
L
L T
G V T S
F
S N V H
D G V A M Y A
L
K K P
W K Q
I
L G A V
T M
G G T W G G
I
R A T
nrgB M S G Q M
*
N
L T
F
E
G
E
E
L
Q
I
S
V
A T
I
V A
E
I
E
K V
G C
I
L
T
G
H
L
Y
T
D
P A
T
G
G
A A
R
K A
S
L
F
N
E
Y
L
150 1
TCGAGGGGTAAAAATAGAAAGCAATGTATACGAGCGTTTAAMAATAGAAATTGTGGTCAGCAAGGTTCCTGTTGATCMAGTGACAGAGACCGCTAAMAGG
160 1
GTGCTGAAAACGGGATCACCAGGTGACGGTAAMATATTTGTCTATGAAATCAGCAATACGATCAACATCCGCACAGGCGAAGAAGGACCTGAAGCACTTT
V L K T G S P G D G K I F V Y E I S N T I N I R T G E E G P E A L*
1 701
AATATCGGTACGAGATTCGGACACTCCGGATCTCTTTTTTTGTGCACAGAATCCCCCCAGAAACCGCGATTCCTCTTCGAATTCTCTTCAAGCGCCGTTA
R G V
K
I
E
N V Y
S
E
R
L K
I
E
I
V V
S
K V
P
V
D Q V
T
E
T A
K
R
i
180 1
TTTCAGACAATCTCTATTTTTATTTGAAACTTTTCATGAGTAAGATTAGTCTACTAAATATAAAMATGTAAMAGGTGATTATTTGAACTACGAAATTTTT
1901
2001
AAAGCAATCCATGGACTATCTCATCACAATTCAGTTCTCGATTCCATTATGGTCTTCATCACGGAATATGCCATTGTCGCCTATGCCCTTATCCTATTGG
CAATCTGGCTGTTTGGGAACACACAAAGCAGAAMACATGTGCTATACGCAGGCATCACAGGAATTGCAGGCCTTGTGATCAACTATTTGATTACGCTTGT
2101
TTATTTCGAACCGCGCCCGTTCGTTGCGCATACAGTGCATACACTGATTCCGCATGC
FIG. 2. Nucleotide sequence of the nrgAB operon. The derived amino acid sequences of the nrg genes are shown below the coding sequences.
Stop codons for the nrgA and nrgB genes are starred. The likely -10 and - 35 promoter regions are underlined once. Apparent transcription start
sites at nucleotides positions 81 and 83 (see Fig. 5) (arrow), an inverted repeat upstream of the promoter (divergent arrows), and the upstream
TaqI site used for cloning pNRG305 at nucleotide positions 1 through 4 are indicated. Putative ribosome-binding sites are underlined twice. The
5-bp sequence underlined at nucleotide positions 291 to 295 is the DNA target sequence duplicated by the nrg-29::Tn917-lacZ insertion. The stems
of the putative transcription terminator are indicated by converging arrows at nucleotide positions 1712 to 1734.
5, lanes 1 and 3). In contrast, no extension products were
observed with RNA isolated from cells grown in medium
containing excess nitrogen, e.g., glutamate plus NH4' or
proline plus NH4' (Fig. 5, lanes 2 and 4). The transcriptional
regulation observed in the primer extension experiments is in
agreement with results obtained from examination of ,B-galactosidase expression from transcriptional nrgAB-lacZ fusions
(discussed in reference 2 and below).
Since the 5' ends of the two transcripts are separated by only
a single nucleotide, we presume that they originate from a
single promoter. Examination of the DNA sequence upstream
of the transcription start sites reveals the presence of an
appropriately positioned sequence that is a perfect match to
the B. subtilis o-Adependent -10 promoter region (26) (Fig.
2). The -35 promoter region contains only 2 nucleotides
which match those in the 35 consensus sequence ITGACA
(26). Many E. coli promoters with poor homology to the 35
-
-
consensus sequence are activated by positive regulatory proteins (30). Located immediately upstream of the nrgAB promoter is an inverted repeat (Fig. 2) which might function as the
DNA binding site for such a regulatory protein.
P-Galactosidase expression of lacZ fusions. A 295-bp TaqI
DNA fragment containing 80 bp of DNA upstream of th,e
nrgAB transcriptional start sites was transcriptionally fused to
the lacZ gene [(nrgA-lacZ)335] and integrated as a single copy
at the amyE locus in the B. subtilis chromosome. Regulation of
expression of this lacZ fusion was examined by growing SF335
cells in medium containing excess or limiting nitrogen (Table
2). 1-Galactosidase levels were 8,800-fold higher in extracts of
cells grown with a poor nitrogen source, glutamate, -than in
extracts of cells grown in medium with excess nitrogen, glutamate plus NH44. Since the regulation of the [(nrgA-lacZ)335]
fusion duplicates the regulation of the nrg-29::Tn917-lacZ
fusion (2), all of the cis-acting sites required for the regulation
Downloaded from http://jb.asm.org/ on October 25, 2017 by guest
F
F
Y T
112
J. BACTERIOL.
WRAY ET AL.
1 2
s"-
A C G T 3 4
x
CL
.2
V
"2
I1
@extension. A 32P-end-labeled oligodeoxynucleotide primer comple-
I t
Z
J X
..........................
......
g
FIG. 5. Identification of the 5' termini of nrgAB RNA by primer
n a y t
u l o i e
6 to
o 1
a
s d f r t e p i e
160
180 iin Fi
Fig..,22 was
used
for the primer
to nucleotides
vW.,..............m
^
~~~~~~~~mentary
}
extension analysis (lanes 1 to 4) and for dideoxy sequencing of
pNRG305 (lanes A, C, G, and T). RNA was isolated from B. subtilis
|
....
| .,
| * | W minimal
s | g | medium containing various nitrogen
in glucose
~168
grown
S
S
241
sources. Lanes: 1, glutamate; 2, glutamate plus
3, proline; 4,
t il
l
,s
-2@1
I -
IS
w f * | W | * .......
NH4+;
proline plus NH4+.
FIG. 3. Hydropathy profile of the NrgA protein. A version of the
SOAP program (PC/GENE; Intelligenetics, Inc.) described by Kyte
and Doolittle (21) was used to determine the average hydropathy of a
moving segment of 15 amino acid residues. The dotted line at -5 is
the standard midpoint line that is used to divide the hydrophobic
domains of the protein (above the line) from the hydrophilic. domains
(below the line).
and expression of the nrgAlB operon are probably contained
within the 295-bp TaqI DNA fragment. In addition, the
regulation of the [(nrgA-LacZ)335] fusion is not altered in
strains containing deletions of either the nrgB gene or the
operon (Table 2). This suggests that the NrgA and NrgB
nr&4B
gene products are not required for the nitrogen-regulated
expression of the nrgAB operon.
To determine whether the expression of the nrgB gene is
UMP
BS
Ec
R4
C GLQKAHTELYRGVKI E S N V Y
EGIV
TSLFS
VE1
E
N K K I D A I I K P F K L D D V R E A L A E V G I T G M T V T E V K G F G R Q K G H T E L Y R G A E Y M VD F L
NSGQ N
Kp
MKK I DAI I KPFKLDDVREALAEVGI TGMTVTEVKGFGR KG HTELYRGAEYMVD FL
Ap
NK K
0
I EAI
I KP F KLD E
VKEAL
EVG I K G
I T V T E A K G F G RQ K G H T E L Y R G A E Y V V D F L
RI
E|A|K G F G R O K G H T D L YR G AE Y I V D F L
SLSV
M K K I E A I I K P f K L D E V R -S P S G V G L Q G I T V T E AK G F G R O K G H T E L Y R G A E Y V V D F L
Rc
M K K V E AI
BJ
G L QG I T V T
K K I EA I I K P F K L D E V R
Sy
AG QG L SVE V K G F G R Q KG H T E L YR G A EY VD
NK K I E A I I R P F K L D E V K I A L V A G I V GMTVS E VR G f G R Q K G
R RG E YVE
Mt
NN
Bs
E
I K P F K L D E VK EAL
N AGYP AFF
RKIRDKVDDVDSE
V
EIVVSKVP
K I E I V VVD
T AKRVLK
a
D I V D T C V D T|I I|R T
KINSB
GQ
L----
GDGKI F;VYEI
FL
F L
FYd
GE
IR TGEE
I R T G E ED D A I
Ec
PK
Kp
P K VI K I E I V V T D D I V D T C V D TJ I I t TA Q T G K I G D G K I F V F D V A RV I R I R T G E E|D D A A I|
Az
|P K V K I EV V
Bj
P K V K I E I V
T G K I G D G K I F V F D VA R
Rt
SDEL V E R A It E A IIHCA AB T G R I G D G K I F V TIPIV E E V V R I R TG E K D A I
G|D D L V E|R A I D A I Rft A A Q T B R I G D G K I F V S N!I E E[]l R I R T G E|S|G L D A!
P It V K V E V V L|A|D E ;E AS I E A I R K A A Q T G R I G D G K I F V S NIV E E V I R I R T G E T G I D A 1|
Rc
P K V K I E V L P DE N
Sy
QK L K L E I V V E D| Q V D T V I D
0
E A I VGA ARTEKI G D G K I F V S|S|I EQA
1 V A^I^ |R T G|E|I G D G K I F V S P|V D
R I R T G E
T IR
T[qED A Vl
R T G E|K N A D A
1I|
FIG. 4. Alignment of the deduced amino acid sequence of the B. subd&E NrgB protein with similar protein sequences from other bacteria. Amino
acid residues that are identical or similar among the nine proteins are boxed. Groups of similar amino acids are LVI, AG, ST, DE, and RK The
position of the tyrosine residue which is uridylyated in E. coli is indicated by the arrow marked UMP. Abbreviations and sequence references: Bs,
B. subtilis; Ec, E. coli (37, 43); Kp, K pneumoniae (19); Az, Azospirillum brasilense (10); Bj, Bradyrhizbium japonicum (24); RI, Rhizobium
leguminosarum (7); Rc, Rhodobacter capsulatus (20), Sy, Synechococcus strain PCC 7942 (41); Mt, M. thermolithotrophicus ORF105 (39).
Downloaded from http://jb.asm.org/ on October 25, 2017 by guest
Amino Acid Residue
VOL. 176, 1994
NITROGEN-REGULATED BACILLUS SUBTILIS nrgAB OPERON
TABLE 2. 1-Galactosidase levels in nrg-lacZ fusion strains
Strain
Relevant genotype
SF335
SF344
AamyE::FD(nrgA-lacZ)335
AamyE::A(nrgA-lacZ)335
SF348
AamyE::I(nrgA-lacZ)335
,-Galactosidase sp act (U/mg of
protein) by nitrogen source"
Glutamate + NH4
Glutamate
0.02
0.01
177
160
<0.02
172
AnrgB364::spec
AnrgAB368::spec
SF365
1'(nrgB-lacZ)365
<0.02
13.4
aAverage of three to four determinations. The values did not vary by more
than 20%. ,B-Galactosidase activity was corrected for endogenous 3-galactosidase activity present in strain SF330, e.g., 0.08 in glutamate-plus-NH4Cl-grown
cells and 0.26 in glutamate-grown cells. Cells were grown in MOPS minimal
medium containing 0.5% glucose as the carbon source and the indicated nitrogen
sources.
ACKNOWLEDGMENTS
We thank Patricia Rice and Florence Pettengill for their technical
assistance, W. Hillen for providing pDH32, J. Le Deaux for pJL73,
D. A. Morrison for pJDC9, J. Mueller for pSGMU38, A. L. Sonenshein for pCED6, and P. Youngman for pTV20, pTV21A21 and KE93.
We are grateful to B. Magasanik for helpful discussions.
This work was supported by Public Health Service research grant
RO1-AI23168 from the National Institutes of Health.
REFERENCES
1. Anagnostopoulos, C., P. J. Piggot, and J. A. Hoch. 1993. The
genetic map of Bacillus subtilis, p. 425-461. In A. L. Sonenshein, J.
Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive
bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington, D.C.
2. Atkinson, M. R., and S. H. Fisher. 1991. Identification of genes
and gene products whose expression is activated during nitrogenlimited growth in Bacillus subtilis. J. Bacteriol. 173:23-27.
3. Atkinson, M. R., L. V. Wray, Jr., and S. H. Fisher. 1990.
Regulation of histidine and proline degradation enzymes by amino
acid availability in Bacillus subtilis. J. Bacteriol. 172:4758-4765.
4. Chambers, S. P., S. E. Proir, D. A. Barstow, and N. P. Minton.
1988. The pMTL nic cloning vectors. I. Improved pUC polylinker
regions facilitate the use of sonicated DNA for nucleotide sequencing. Gene 68:139-149.
5. Chasin, L. A., and B. Magasanik. 1968. Induction and repression
of the histidine-degrading enzymes of Bacillus subtilis. J. Biol.
Chem. 243:5165-5178.
6. Chen, J., and D. A. Morrison. 1987. Cloning of Streptococcus
pneumoniae DNA fragments in Escherichia coli requires vectors
protected by strong transcriptional terminators. Gene 55:179-187.
7. Colonna-Romano, S., A. Riccio, M. Guida, R. Defez, A. Lamberti,
M. laccarino, W. Arnold, U. Priefer, and A. Puhier. 1987. Tight
linkage of glnA and a putative regulatory gene in Rhizobium
leguminosarum. Nucleic Acids Res. 15:1951-1964.
8. Debarbouille, M., I. Martin-Verstraete, F. Kunst, and G.
Rapoport. 1991. The Bacillus subtilis sigL gene encodes an equivalent of u" from gram-negative bacteria. Proc. Natl. Acad. Sci.
USA 88:9092-9096.
9. Deuel, T. F., and E. R. Stadtman. 1970. Some kinetic properties of
Bacillus subtilis glutamine synthetase. J. Biol. Chem. 245:52065213.
10. de Zamaroczy, M., F. Delorme, and C. Elmerich. 1990. Characterization of three different nitrogen-regulated promoter regions
for the expression of glnB and glnA in Azospirillum brasilense. Mol.
Gen. Genet. 224:421-430.
11. Donnelly, C. E., and A. L. Sonenshein. 1984. Promoter-probe
plasmid for Bacillus subtilis. J. Bacteriol. 157:965-967.
12. Errington, J. 1986. A general method for fusion of the Escherichia
coli lacZ gene to chromosomal genes in Bacillus subtilis. J. Gen.
Microbiol. 132:2953-2966.
13. Fisher, S. H., and A. L. Sonenshein. 1984. Bacillus subtilis glutamine synthetase mutants pleiotropically altered in glucose catabolite repression. J. Bacteriol. 157:612-621.
14. Fisher, S. H., and A. L. Sonenshein. 1991. Control of carbon and
nitrogen metabolism in Bacillus subtilis. Annu. Rev. Microbiol.
45:107-135.
15. Fisher, S. H., and L. V. Wray, Jr. 1989. Regulation of glutamine
synthetase in Streptomyces coelicolor. J. Bacteriol. 171:2378-2383.
16. Golden, K. J., and R. W. Bernhohr. 1985. Nitrogen catabolite
repression of the L-asparaginase of Bacillus licheniformis. J. Bacteriol. 164:938-940.
17. Gough, J. A., and N. E. Murray. 1983. Sequence diversity among
related genes for recognition of specific targets in DNA molecules.
J. Mol. Biol. 166:1-19.
18. Henner, D. J. (Genentech). 1991. Personal communication.
19. Holtel, A., and M. Merrick. 1988. Identification of the Klebsiella
pneumoniae glnB gene: nucleotide sequence of wild-type and
mutant alleles. Mol. Gen. Genet. 215:134-138.
20. Kranz, R. G., V. M. Pace, and I. M. Caldicott. 1990. Inactivation,
sequence, and lacZ fusion analysis of a regulatory locus required
for repression of nitrogen fixation genes in Rhodobacter capsulatus. J. Bacteriol. 172:53-62.
21. Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying
the hydropathic character of a protein. J. Mol. Biol. 157:105-132.
22. Lopilato, J., S. Bortner, and J. Beckwith. 1986. Mutations in a new
Downloaded from http://jb.asm.org/ on October 25, 2017 by guest
nitrogen regulated, a portion of the nrgB gene was replaced
with a promoterless lacZ cat cassette, and the resulting nrgBlacZ fusion was used to replace the chromosomal nrgB gene
(SF365 in Fig. 1). 1-Galactosidase levels in SF365 cells grown
with excess and limiting nitrogen were determined (Table 2).
f-Galactosidase synthesis was derepressed in cells grown with
glutamate as a nitrogen source, while only background levels of
3-galactosidase activity were detected in cells grown with
glutamate and NH4' as a nitrogen source. Thus, expression of
the nrgB gene is nitrogen regulated. Since expression of
,B-galactosidase from the chromosomal nrgB-lacZ fusion and
transcription from the promoter located upstream of the nrgA
gene show similar patterns of regulation, there is no constitutive promoter which transcribes the nrgB gene. Interestingly,
expression of the E. coli glnB gene is not regulated in response
to nitrogen availability (42).
Growth phenotype of strains containing AnrgAB and AnrgB
mutations. Since the B. subtilis GS protein is not known to be
posttranslationally modified (9, 13), the NrgB "PI,-like" protein is unlikely to regulate GS activity in B. subtilis. Indeed, GS
specific activity in permeabilized SF12 (nrg-29::Tn917-lacZ)
cells grown in glucose minimal medium containing either
glutamate plus NH4' or glutamate alone as the nitrogen
source was similar to that seen in SFiO (wild-type) cells (data
not shown).
To investigate the roles played by the NrgA and NrgB gene
products in nitrogen metabolism in B. subtilis, strains SF364
(AnrgB) and SF368 (zXnrgAB) (Fig. 1) were constructed. Strains
SF364 (AnrgB) and SF368 (AnrgAB) sporulated at wild-type
frequencies in either Difco sporulation medium or SterliniMandelstam resuspension medium (data not shown). By
streaking the wild-type and nrgAB deletion strains on glucose
minimal plates containing different nitrogen sources (allantoin,
y-aminobutyrate, L-asparagine, glucosamine, L-glutamate, Lhistidine, L-isoleucine, KNO3, L-ornithine, L-threonine, urea,
and L-valine), we determined that strains SF364 (AnrgB) and
SF368 (AnrgAB) are not defective in the utilization of these
nitrogen sources. However, on glucose-KNO3 minimal plates,
both deletion strains grew more slowly than did the wild-type
strain, although all three strains eventually formed colonies
with similar sizes. This suggests that the NrgA and NrgB gene
products either participate in nitrate utilization or facilitate
adaptation to growth on this medium.
113
114
23.
24.
25.
26.
27.
29.
30.
31.
32.
33.
34.
chromosomal gene of Escherichia coli K-12, pcnB, reduce plasmid
copy number of pBR322 and its derivatives. Mol. Gen. Genet.
205:285-290.
Magasanik, B. (Massachusetts Institute of Technology). 1992.
Personal communication.
Martin, G. B., M. F. Thomashow, and B. K. Cheim. 1989.
Bradyrhizobium japonicum glnB, a putative nitrogen-regulatory
gene, is regulated by NtrC at tandem promoters. J. Bacteriol.
171:5638-5645.
McLaughlin, J. R., C. L. Murray, and J. C. Rabinowitz. 1981.
Unique features in the ribosome binding site sequence of the
Gram-positive Staphylococcus aureus j3-lactamase gene. J. Biol.
Chem. 256:11283-11291.
Moran, C. P., Jr., N. Lang, S. F. J. LeGrice, G. Lee, M. Stephens,
A. L. Sonenshein, J. Pero, and R. Losick 1982. Nucleotide
sequences that signal the initiation of transcription and translation
in Bacillus subtilis. Mol. Gen. Genet. 186:339-346.
Neidhardt, F. C., P. L. Bloch, and D. F. Smith. 1974. Culture
medium for enterobacteria. J. Bacteriol. 119:736-747.
Nicholson, W. L., and P. Setlow. 1990. Sporulation, germination
and outgrowth, p. 391-450. In C. R. Harwood and S. M. Cutting
(ed.), Molecular biological methods for Bacillus. John Wiley &
Sons, New York.
North, A. K., K. E. Klose, K. M. Stedman, and S. Kustu. 1993.
Prokaryotic enhancer-binding proteins reflect eukaryote-like modularity: the puzzle of nitrogen regulatory protein C. J. Bacteriol.
175:42674273.
Raibaud, O., and M. Schwartz. 1984. Positive control of transcription initiation in bacteria. Annu. Rev. Genet. 18:173-206.
Reitzer, L. J., and B. Magasanik. 1987. Ammonium assimilation
and the biosynthesis of glutamine, glutamate, aspartate, asparagine, L-alanine, and D-alanine, p. 302-320. In F. C. Neidhardt, J. L.
Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E.
Umbarger (ed.), Escherichia coli and Salmonella typhimurium:
cellular and molecular biology. American Society for Microbiology, Washington, D.C.
Sanger, F., S. Nicklen, and A. Ri Coulson. 1977. DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA
74:5463-5467.
Schreier, H. J., S. W. Brown, K. D. Hirschi, J. F. Nomeilini, and
A. L. Sonenshein. 1989. Regulation of the Bacillus subtilis glutamine synthetase gene expression by the product of the glnR gene.
J. Mol. Biol. 210:51-63.
Schreier, H. J., and A. L. Sonenshein. 1986. Altered regulation of
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
the ginA gene in glutamine synthetase mutants of Bacillus subtilis.
J. Bacteriol. 167:3543.
Shimotsu, H., and D. J. Henner. 1986. Construction of a singlecopy integration vector and its use in analysis of regulation of the
tip operon of Bacillus subtilis. Gene 43:85-94.
Singer, S. J. 1990. The structure and insertion of integral proteins
in membranes. Annu. Rev. Cell Biol. 6:247-296.
Son, H. S., and S. G. Rhee. 1987. Cascade control of Escherichia
coli glutamine synthetase. Purification and properties of PI, protein and nucleotide sequence of its structural gene. J. Biol. Chem.
262:8690-8695.
Sonenshein, A. L., B. Cami, J. Brevet, and Ri Cote. 1974. Isolation
and characterization of rifampin-resistant and streptolydigin-resistant mutants of Bacillus subtilis with altered sporulation properties. J. Bacteriol. 120:253-265.
Souillard, N., and L. Sibold. 1989. Primary structure, functional
organization and expression of nitrogenase structural genes of the
thermophilic archaebacterium Methanococcus thermolithotrophicus. Mol. Microbiol. 3:541-551.
Sun, D., and P. Setlow. 1991. Cloning, nucleotide sequence, and
expression of the Bacillus subtilis ans operon, which codes for
L-asparaginase and L-aspartase. J. Bacteriol. 173:3831-3845.
Tsinoremas, N. F., A. M. Castets, M. A. Harrison, J. F. Allen, and
N. Tandeau de Marsac. 1991. Photosynthetic electron transport
controls nitrogen assimilation in cyanobacteria by means of posttranslational modification of the glnB gene product. Proc. Natl.
Acad. Sci. USA 88:45654569.
van HeeswiJk, W. C., M. Rabenberg, H. V. Westerhoff, and D.
Kahn. 1993. The genes of the glutamine synthetase adenylylation
cascade are not regulated by nitrogen in Escherichia coli. Mol.
Microbiol. 9:443457.
Vasudevan, S. G., W. L. F. Armarego, D. C. Shaw, P. E. Lilley,
N. E. Dixon, and Ri K. Poole. 1991. Isolation and nucleotide
sequence of the hmp gene that encodes a haemoglobin-like
protein in Escherichia coli K-12. Mol. Gen. Genet. 226:49-58.
Wray, L. V., Jr., and S. H. Fisher. Unpublished data.
Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved
M13 phage cloning vectors and host strains: nucleotide sequences
of the M13mpl8 and pUC19 vectors. Gene 33:103-119.
Youngman, P. 1990. Use of transposons and integrational vectors
for mutagenesis and construction of gene fusions in Bacillus
species, p. 221-266. In C. R. Harwood and S. M. Cutting (ed.),
Molecular biological methods for Bacillus. John Wiley & Sons,
New York.
Downloaded from http://jb.asm.org/ on October 25, 2017 by guest
28.
J. BAcrERIOL.
WRAY ET AL.
Документ
Категория
Без категории
Просмотров
0
Размер файла
1 468 Кб
Теги
114, 108, 176, 1994
1/--страниц
Пожаловаться на содержимое документа