close

Вход

Забыли?

вход по аккаунту

?

jcb.26437

код для вставкиСкачать
 Article
Knockdown of long non-coding RNA ANRIL inhibits proliferation, migration
and invasion but promotes apoptosis of human glioma cells by upregulation of
miR-34a†
Running title: Role of ANRIL in glioma
Xuechao Dong, Zheng Jin, Yong Chen, Haiyang Xu, Chengyuan Ma, Xinyu Hong,
Yunqian Li, Gang Zhao*
Department of Neurosurgery, The First Hospital of Jilin University, Changchun
130021, China
*Corresponding
author: Gang Zhao, Department of Neurosurgery, The First
Hospital of Jilin University, 71 Xinmin Street, Changchun 130021, Jilin, P.R. China;
E-mail: zhaogang146@126.com
†
This article has been accepted for publication and undergone full peer review but has not
been through the copyediting, typesetting, pagination and proofreading process, which may
lead to differences between this version and the Version of Record. Please cite this article as
doi: [10.1002/jcb.26437]
Received 24 May 2017; Revised 1 September 2017; Accepted 18 October 2017
Journal of Cellular Biochemistry
This article is protected by copyright. All rights reserved
DOI 10.1002/jcb.26437
This article is protected by copyright. All rights reserved
Abstract
Gliomas are the most common types of primary central nervous system malignancy
found in adults. Long non-coding RNA antisense non-coding RNA in the INK4 locus
(ANRIL) variants are associated with glioma and miR-34a is markedly
downregulated in U251 glioma cells. The 3’-untranslated region (3’UTR) of silent
information regulator 1 (Sirt1) contains a conserved site that is targeted directly by
miR-34a. Therefore, in this study, we investigated the roles of ANRIL, miR-34a and
Sirt1 in glioma and their potential interactions. Firstly, expression of ANRIL in
normal glia cells and five glioma cell lines was measured. Then, effects of ANRIL
suppression on cell proliferation, apoptosis, migration and invasion of U251 cells as
well as expression of miR-34a were assessed. Meanwhile, effects of miR-34a on
H251 cells silencing ANRIL were tested. Whether Sirt1 is a target of miR-34a was
verified, followed by estimating the role of Sirt1 overexpression in U251 cells
overexpressing miR-34a. Finally, the involved signaling pathways were assessed.
ANRIL was upregulated in glioma cells and its suppression inhibited cell proliferation,
migration and invasion but promoted cell apoptosis. ANRIL acted as a sponge of
miR-34a, and Sirt1 is a target of miR-34a. Then, Sirt1 was proved to function through
activation of the PI3K/AKT and mTOR signaling pathways. In conclusion, ANRIL
was upregulated in glioma, and its inhibition could repress cell proliferation,
migration and invasion but inhibit cell apoptosis through miR-34a-mediated
downregulation of Sirt1, involving the inactivation of the PI3K/AKT and mTOR
pathways. This article is protected by copyright. All rights reserved
Keywords: Glioma, ANRIL, miR-34a, Sirt1, PI3K/AKT, mTOR
This article is protected by copyright. All rights reserved
Introduction
Gliomas are the most common types of primary central nervous system malignancy
found in adults, accounting for approximately half of all primary intracranial tumors
[Caruso
and
Caffo,
2014].
Gliomas
are
classified
as
astrocytomas,
oligodendrogliomas, ependymomas and mixed tumors according to the histological
subtype, and are assigned malignancy grades I to IV [Louis et al., 2007]. These
tumors cause rapidly progressive disease associated with high mortality and a median
life expectancy of only 14 months after diagnosis [Delgado-López and
Corrales-García, 2016]. The poor prognosis of patients with glioma is due mainly to
the limitations and aggressive nature of the currently available treatments, which
include surgery, chemotherapy and radiotherapy. Therefore, new and effective
treatments for glioma are urgently required.
Only 2% of the human genome encodes proteins [Collins et al., 2003], while the vast
majority is transcribed to generate non-coding RNAs, including and long non-coding
RNAs (lncRNAs) and microRNAs (miRNAs) [Djebali et al., 2012]. LncRNAs are
endogenous non-coding transcripts of more than 200 nucleotides. Although thousands
of these molecules have been identified, few have been assigned a biological function.
Those that have been characterized have been found to be involved in a broad
spectrum of processes such as apoptosis, invasion, histone protein modification,
regulation of mRNA splicing and as a sink for some miRNAs [Fatica and Bozzoni,
2014; Geisler and Coller, 2013; Loewer et al., 2010; Mercer et al., 2009]. Furthermore,
lncRNA dysregulation is implicated in several human cancers [Lawson et al., 2012;
Tsai et al., 2011; Wapinski and Chang, 2011]. Antisense non-coding RNA in the INK4
locus (ANRIL) is a 3.8 kb lncRNA antisense transcription of the INK4B-ARF-INK4A
gene cluster located in the chromosome 9p21 region [Yap et al., 2010]. Variants in this
region have been associated with several cancers, including glioma [Rajaraman et al.,
2012]. However, the potential clinical significance of ANRIL in glioma is unclear.
MiRNAs are short, non-coding RNA molecules (20–25 nucleotides) that function as
repressors of gene expression by binding to specific sites in the 3’-untranslated region
(3’UTR) of mRNA molecules [Godnic et al., 2013]. These molecules have been
reported to exhibit distinct expression patterns with functional significance in
numerous cancers, including glioma [Godlewski et al., 2014]. MiR-34a is a direct
target of p53 and functions downstream as a tumor suppressor. Luan et al. showed
that miR-34a is markedly downregulated in U251 glioma cells (U251 cells express a
This article is protected by copyright. All rights reserved
mutant p53) and identified a conserved site in the 3’UTR of silent information
regulator 1 (Sirt1) that is targeted directly by miR-34a. MiR-34a overexpression in
U251 cells inhibited proliferation and decreased Sirt1 protein expression via
post-translational regulation [Luan et al., 2010]. Sirt1 is a member of the mammalian
sirtuin family that are implicated in the mechanisms underlying regulation of
transcriptional silencing and cell survival [Wu et al., 2015]. In this study, we
investigated the roles of ANRIL, miR-34a and Sirt1 in glioma and their potential
interaction in the regulation.
Materials and methods
Cells and cell culture
Human glioma U251 cells (Nanjing KeyGEN Biotech, Nanjing, China), U87 cells,
A172 cells, SHG-44 cells (all Chinese Academy of Sciences, Shanghai, China),
BT325 cells (XiangYa Central Experiment Laboratory, Changsha, China) and human
normal glia HEB cells (American Type Culture Collection, Manassas, VA, USA) were
cultured in Dulbecco's Modified Eagle’s Medium (Gibco-BRL, Carlsbad, CA, USA)
supplemented with 10% fetal calf serum (Gibco-BRL). Cells were incubated at 37°C
under 5% CO2 and routinely subcultured daily unless otherwise statements. The dual
inhibitor of AKT and mTOR, NVP-BEZ235 (Selleck Chemicals, Houston, TX, USA),
was dissolved in DMSO to obtain stock solution (100 μM). For inhibition of AKT and
mTOR, U251 cells were pre-treated with 100 nM NVP-BEZ235 at 1 h before other
treatments.
RNA extraction and quantitative RT-PCR
Total RNA was extracted from cells using TRIzol reagent (Life Technologies
Corporation, Carlsbad, CA, USA) according to the manufacturer’s instructions.
Real-time-PCR analysis of ANRIL expression levels was performed using the One
Step SYBR® PrimeScript®PLUS RT-RNA PCR Kit (TaKaRa Biotechnology, Dalian,
China). MiR-34a expression levels were analyzed using the TaqMan MicroRNA
Reverse Transcription Kit and TaqMan Universal Master Mix II (both Applied
Biosystems, Foster City, CA, USA) according to the recommendation of supplier.
Sirt1 mRNA expression levels were analyzed using the RNA PCR Kit (AMV) Ver.3.0
and SYBR® Premix Ex Taq™ (both TaKaRa Biotechnology). GAPDH was used as a
reference for estimation of ANRIL and Sirt1 mRNA expressions, whereas U6 was
This article is protected by copyright. All rights reserved
acted as an internal control of miR-34a. Fold changes in gene expression were
calculated using relative quantification (2−ΔΔCt) method [Livak and Schmittgen, 2001].
Transfection and generation of stably transfected cell lines
Short-hairpin RNA (sh-RNA) directed against human lncRNA ANRIL (Target
sequence, 1# GCACTGATCTGTCATCAATAC, 2# GGTCATCTCATTGCTCTATCC)
was ligated into the U6/GFP/Neo plasmid (GenePharma, Shanghai, China), and the
recombined plasmids were referred to as sh-ANRIL 1# and sh-ANRIL 2#. For the
analysis of Sirt1 function, the full-length Sirt1 sequence and short-hairpin RNA
directed against Sirt1 were constructed in the pEX-2 and U6/GFP/Neo plasmids
(GenePharma), respectively, and the resultant plasmids were referred to as pEX-Sirt1
and sh-Sirt1. U6/GFP/Neo vector carrying a non-targeting sequence was used as a
negative control (shNC) for sh-ANRILs and sh-Sirt1. Cell transfection was performed
using the Lipofectamine 3000 reagent (Life Technologies Corporation) according to
the manufacturer’s instructions. Stably transfected U251 cells were selected using
culture medium containing 0.5 mg/ml G418 (Sigma–Aldrich, St Louis, MO, USA).
After approximately 4 weeks, G418-resistant cell clones were established.
Scramble miRNAs, miR-34a mimic, miR-34a inhibitor and its negative control (NC)
were synthesized (Life Technologies Corporation) and transfected into U251 cells.
The highest transfection efficiency occurred at 48 h (data not shown); thus, cells were
harvested at 72 h post-transfection.
Cell Counting Kit-8 (CCK-8) assay
Cell viability was assessed using the CCK-8 method. Briefly, transfected U251 cells
(5 × 103 cells/well) were seeded in 96-well plates. After treatments, 10 μl CCK-8
solution (Dojindo Molecular Technologies, Gaithersburg, MD, USA) was added to the
culture medium, and the cells were incubated for 1 h at 37°C in a humidified
atmosphere comprising 95% air and 5% CO2. Absorbance was measured at 450 nm
using a Microplate Reader (Bio-Rad, Hercules, CA, USA).
Colony formation assay
U251 cell suspensions were plated onto 60-mm dishes (1× 103 cells/dish) in triplicate,
and the dishes were subjected into a humidified incubator at 37°C. After 14 days’
incubation, culture medium was removed and the cell colonies were stained by crystal
This article is protected by copyright. All rights reserved
violet (0.1%; Sigma–Aldrich). Clearly visible colonies (>50 cells/colony) were
counted under a microscope (Olympus, Tokyo, Japan)
Apoptosis assay
Cell apoptosis of U251 cells was analyzed by propidium iodide (PI) and fluorescein
isothiocynate (FITC)-conjugated Annexin V staining. Briefly, cells were washed in
phosphate-buffered saline (PBS). Fixed cells were then washed twice in PBS,
resuspend by binding buffer and stained with PI/FITC-Annexin V for 1 h at room
temperature in the dark and in the presence of 50 μg/ml RNase A (Sigma–Aldrich).
Flow cytometric analysis was performed using a FACScan (Beckman Coulter,
Fullerton, CA, USA) with FlowJo software (Tree Star, San Carlos, CA, USA).
Migration and invasion assays
Cell migration and invasion of U251 cells were evaluated by using a modified
two-chamber 24-well Transwell plate (Corning, NY, USA) containing a permeable
polycarbonate membrane (pore size, 8 μm). For invasion assays, the membrane was
pre-coated with Matrigel solution (BD, Franklin Lakes, NJ, USA) and incubated for 4
h at 37°C. Assays were performed following the procedures provided by the
manufacturer. In brief, cells (suspended in 200 μl serum-free medium) were seeded in
the upper chamber of the Transwell culture plate, and 600 μl complete medium was
added to the lower chamber. After incubation at 37°C, cells were fixed with methanol.
Non-traversed cells were removed from the upper surface of the filter carefully with a
cotton swab. Traversed cells on the lower side of the filter were stained with 0.1%
crystal violet and counted under a light microscope.
Reporter vector constructs and luciferase reporter assay
The fragment of the Sirt1 3’UTR containing the predicted miR-34a binding site was
amplified by PCR and then cloned into a pmirGlO Dual luciferase miRNA Target
Expression Vector (Promega, Madison, WI, USA) to generate the reporter vector
Sirt1-wild-type (Sirt1-wt). To mutate the putative binding site of miR-34a in the Sirt1
3’UTR, the sequence of putative binding site was replaced to generate the
Sirt1-mutated-type reported construct (Sirt1-mt). Then the vectors (Sirt1-wt or
Sirt1-mt) and miR-34a mimics or scramble miRNAs were co-transfected into U251
cells, and the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA)
This article is protected by copyright. All rights reserved
were used for testing the luciferase activity.
Western blot analysis
The protein used for Western blotting was extracted using RIPA lysis buffer
(Beyotime Biotechnology, Shanghai, China) supplemented with protease inhibitors
(Roche, San Francisco, CA, USA). The proteins were quantified using the BCA™
Protein Assay Kit (Pierce, Appleton, WI, USA). The Western blot system was
established using a Bio-Rad Bis-Tris Gel system according to the manufacturer’s
instructions. Primary antibodies were prepared in 5% blocking buffer at a dilution of
1:1,000. Primary antibody was incubated with the membrane at 4°C overnight,
followed by wash and incubation with secondary antibody marked by horseradish
peroxidase for 1 h at room temperature. After rinsing, the polyvinylidene difluoride
(PVDF) membranes were transferred into the Bio-Rad ChemiDoc™ XRS system, and
then 200 μl Immobilon Western Chemiluminescent HRP substrate (Millipore,
Billerica, MA, USA) was added to cover the membrane surface. The signals were
captured and the intensity of the bands was quantified using Image J software
(National Institute of Health, Bethesda, MA, USA).
Statistical analysis
Statistical analyses were performed using GraphPad 6.0 statistical software. Data
represent the mean ± standard deviation (SD) of three independent experiments.
Differences between groups of data were evaluated by one-way analysis of variance
(ANOVA) or unpaired two-tailed t test and P-values <0.05 were considered to
indicate a statistical significance.
Results
ANRIL is upregulated in glioma cells and suppression of ANRIL inhibits cell
proliferation, migration and invasion but promotes apoptosis in U251 cells
First of all, expression of ANRIL in glioma cells and normal glia cells were estimated.
In Fig. 1A, expression level of ANRIL in glioma cells were significantly higher than
that in normal cells (P < 0.01 or P < 0.005). Then, U251 cells were transfected with
sh-ANRIL1# or sh-ANRIL 2# to silence this lncRNA. Compared with the sh-NC
group, transfection with sh-ANRIL 1# caused a significant reduction in ANRIL
expression (P < 0.05) while a significantly greater reduction in ANRIL expression
This article is protected by copyright. All rights reserved
was observed following transfection with sh-ANRIL 2# (P < 0.01, Fig. 1B). There
was no significant difference in ANRIL expression between the untransfected cells
(control group) and those transfected with sh-NC. Due to the more significant effect
of sh-ANRIL #2, silence of ANRIL was realized using cell transfection with
sh-ANRIL 2# in further investigations.
Next, we investigated the effects of ANRIL-silencing on U251 cell function.
Compared with the sh-NC group, cell viability (Fig. 1C) and relative number of
colony formation (Fig. 1D) were significantly reduced by transfection with sh-ANRIL
2# (both P < 0.01). Western blot analysis showed expressions of cyclin D1, CDK4
and CDK6 were all remarkably downregulated by ANRIL silence (all P < 0.01, Fig.
1E, F). Those results above illustrated ANRIL silence inhibited U251 cell
proliferation. In Fig. 1G, the proportion of apoptotic cells was significantly increased
(P < 0.005). Furthermore, Transwell assays revealed significant reductions in the
migration (P < 0.05, Fig. 1H) and invasion (P < 0.01, Fig. 1I) of U251 cells
transfected with sh-ANRIL compared with the shNC group.
ANRIL acts as a sponge of miR-34a
We next investigated the potential interaction between miR-34a and ANRIL in U251
cells. qRT-PCR analysis of U251 cells transfected with sh-ANRIL 2# showed
significant upregulation of miR-34a expression compared with that of the shNC group
(P < 0.001, Fig. 2). Results indicate that ANRIL is acted as a sponge of miR-34a.
Effects of ANRIL suppression on cell viability, apoptosis, migration and invasion
are abrogated by miR-34a inhibitor in U251 cells
We next investigated the association of miR-34a with the functional effects of ANRIL
in U251 cells. Accordingly, cell viability, apoptosis, migration and invasion were all
measured in untransfected cells and co-transfected cells. The significant reduction in
cell viability (P < 0.01, Fig. 3A), migration (P < 0.05, Fig. 3D, E) and invasion (P <
0.01, Fig. 3F, G), induced by ANRIL suppression, were significantly ameliorated by
concomitant silencing of miR-34a (both P < 0.05). As shown in Figures 3B and 3C,
the significant enhancement in U251 cell apoptosis associated with ANRIL
suppression (P < 0.01) was significantly reduced by concomitant silencing of
miR-34a (P < 0.05). These findings indicated that the effects of ANRIL suppression
on U251 cells are mediated via upregulating miR-34a.
This article is protected by copyright. All rights reserved
Sirt1 is a target gene of miR-34a
It has been reported previously that miR-34a acts as a tumor suppressor in U251 cells
by regulating the expression of Sirt1 [17]. Therefore, we analyzed the effects of
miR-34a overexpression and silencing on Sirt1 expression in U251 cells. qRT-PCR
analysis showed that miR-34a overexpression resulted in significant downregulation
of Sirt1 mRNA levels (P < 0.05), while expression of Sirt1 mRNA was significantly
increased by miR-34 silencing (P < 0.005, Fig. 4A). Western blot analysis revealed a
similar pattern of changes in Sirt1 protein expression (Fig. 4B, C). The relationship
between Sirt1 expression and miR-34a was then investigated by using dual luciferase
reporter assays. Compared with the scramble miRNAs group, relative luciferase
activity was significantly decreased by the presence of miR-34a in cells transfected
with the Sirt1-wt construct (P < 0.01), while there were no significant differences in
relative luciferase activity between the cells transfected with the Sirt1-mt construct
(Fig. 4D). These observations indicated that Sirt1 is a target of miR-34a.
MiR-34a overexpression inhibits cell viability, migration and invasion but
promotes apoptosis by downregulating Sirt1in U251 cells
The role of Sirt1 in the effects of miR-34a on U251 cells was investigated. Firstly,
protein expression of Sirt1 was significantly upregulated by transfection with
pEX-Sirt1 while was markedly downregulated by transfection with sh-Sirt1 as
compared to the respective controls (both P < 0.005, Fig. 5A). Subsequently, the
effects of the miR-34a mimic on U251 cells overexpressing Sirt1 were investigated.
As shown in Figures 5B and 5C-D, the significant reduction in U251 cell viability
and increased apoptosis induced by miR-34a treatment (P < 0.01 and P < 0.005,
respectively) were partially alleviated by Sirt1 overexpression (both P < 0.05).
Similarly, as shown in Figures 5E-F and 5G-H, the significant reduction in the
migration and invasion abilities of U251 cells following treatment with the miR-34a
mimic (both P < 0.01) were significantly restored by Sirt1 overexpression (both P <
0.05). These findings indicate that miR-34a affects cell viability, apoptosis, migration
and invasion through downregulating Sirt1in U251 cells.
Signaling pathways involved in Sirt1 function
The signaling pathways involved in the effects of Sirt1 in U251 cells were
This article is protected by copyright. All rights reserved
investigated by Western blot analysis of components of the PI3K/AKT and mTOR
signaling pathways. As shown in Figure 6A and 6C, Sirt1 overexpression
significantly increased the levels of p-PI3K and p-AKT (both P < 0.005), while levels
were markedly decreased by Sirt1 silencing (both P < 0.005). Furthermore, Sirt1
overexpression observably increased the levels of p-mTOR and p-p70S6K (both P <
0.005), while levels were significantly decreased by Sirt1 silencing (both P < 0.005,
Fig. 6B, C). These observations indicate that Sirt1 may activate the PI3K/AKT and
mTOR signaling pathways.
Dual inhibitor of the PI3K/AKT and mTOR pathways reverses the effects of
Sirt1 overexpression on U251 cells overexpressing miR-34a
To verify whether Sirt1 affects the U251 cells through the PI3K/AKT and mTOR
pathways, the dual inhibitor of these two pathways were added, and cells treated with
the identical concentration of DMSO (0.1%) were acted as the control. In U251 cells
overexpressing miR-34a, the increases of cell viability (P < 0.01, Fig. 7A), migration
(P < 0.01, Fig. 7B, C) and invasion (P < 0.01, Fig. 7D, E) were all significantly
abrogated by the stimulation of NVP-BEZ235 as compared to the miR-34a mimic +
pEX-Sirt1 + DMSO group (all P < 0.05). These data consolidate Sirt1 functions
through activating the PI3K/AKT and mTOR pathways.
Discussion
In this study, we investigated the effects and mechanisms of lncRNA ANRIL on
human U251 glioma cells. Firstly, expression of ANIRL was identified to be
upregulated in glioma cells compared with the normal ones. Then, we found ANRIL
suppression inhibited cell proliferation, migration, and invasion of U251 cells in vitro,
while apoptosis was promoted. Further studies showed that miR-34a was upregulated
by suppression of ANRIL, and ANIRL suppression affected U251 cells through
upregulating miR-34a. Moreover, we found that Sirt1 is a target gene of miR-34a, and
miR-34a affected U251 cells through downregulating Sirt1 expression. Meanwhile,
Sirt1 was proved to activate the PI3K/AKT and mTOR pathways. Thus, our findings
indicate that the inhibition of U251 cell proliferation, migration and invasion as well
as the increase of U251 cell apoptosis observed following ANRIL suppression occurs
via a mechanism that involves miR-34 mediated downregulation of Sirt1 expression
and concomitant inhibition of the PI3K/AKT and mTOR pathways. Thus, the findings
This article is protected by copyright. All rights reserved
of the present study implicate mechanisms of ANRIL suppression and miR-34a
upregulation as therapeutic strategies for glioma.
Allelic expression of ANRIL and the variants in the region of ANRIL are reported to
be associated with glioma [Congrains et al., 2013; Cunnington et al., 2010]. However,
the underlying mechanism of the ANRIL-associated modulation in glioma remains
unclear, thus we focused on the roles of ANRIL in glioma. To preliminarily verify the
hypothesis, expressions of ANRIL in human normal glia HEB cells and five human
glioma cell lines were measured. The upregulated ANRIL in glioma cells also
suggested the potential role of ANRIL in progression of glioma. Inhibition of ANRIL
suppresses cell proliferation, migration and invasion in several cancers [Li et al.,
2016]. In accordance with this, we showed that suppression of ANRIL inhibited cell
proliferation, migration, and invasion in human U251 glioma cells, while apoptosis
was promoted.
Several mechanisms have been reported to be responsible for the important roles of
ANRIL in the development and progression of a number of malignancies. For
example, increased ANRIL expression has been reported to promote lung cancer
metastasis [Lin et al., 2015], while gastric cancer was shown to be promoted by
epigenetic silencing of miR99a/miR-449a [Zhang et al., 2014]. In this study, we
showed that ANRIL suppression resulted in upregulation of miR-34a. Meanwhile,
ANRIL inhibition promoted cell viability, migration and invasion but repressed cell
apoptosis in U251 cells through upregulating miR-34a. These observations are
consistent with the results reported by Luan et al. showing that miR-34a
overexpression in U251 cells inhibited cell growth and caused cell cycle arrest in the
G0/G1 phase, while migration and invasion were significantly inhibited [Zhang et al.,
2014].
Sirt1 is an NAD-dependent deacetylase that regulates apoptosis under conditions of
stress [Fan et al., 2004; Haigis and Guarente, 2006; Longo and Kennedy, 2006].
Based on recent evidence, Sirt1 is implicated as an oncogene and may play a role in
tumorigenesis [Hida et al., 2007; Huffman et al., 2007]. The 3’UTR of Sirt1 contains
a site that is targeted directly by miR-34a and miR-34a overexpression in U251 cells
has been shown to inhibit proliferation and decrease Sirt1 protein expression via
post-translational regulation [Luan et al., 2010]. This was confirmed in the present
study via dual luciferase reporter assays. Furthermore, we showed that Sirt1 was
negatively regulated by miR-34a in U251 cells. These observations are consistent
This article is protected by copyright. All rights reserved
with the tumor suppressor function of miR-34a via the Sirt1-p53 pathway in human
colon cancer cells [Yamakuchi et al., 2008].
Although the mechanism, underlying the effects of ANRIL in glioma remains to be
fully elucidated, it has recently been reported that ANRIL promotes tumorigenesis in
glioma via MAPK signaling pathways [Xu et al., 2016]. In the current study, we
showed that Sirt1 overexpression increased levels of p-PI3K and p-AKT, as well as
p-mTOR and p-p70S6K. These observations indicate that Sirt1 may affect U251 cells
via activation of the PI3K/AKT and mTOR signaling pathways. Following
experiments using the dual inhibitor of the PI3K/AKT and mTOR pathways proved
that inhibition of these two pathways could reverse the effects of Sirt1 overexpression
on U251 cells, consolidating the involvements of these two pathways in the
modulation of Sirt1 in U251 cells.
The results of our study provide evidence that the inhibition of U251 cell proliferation,
migration, and invasion observed following ANRIL suppression occurs via a
mechanism that involves upregulation of miR-34. Furthermore, we showed that the
tumor suppressor function of miR-34a is likely to be mediated, at least partially, by
downregulation of Sirt1 expression and concomitant inhibition of PI3K/AKT and
mTOR pathways. Thus, the findings of the present study implicate mechanisms of
ANRIL suppression and miR-34a upregulation as therapeutic strategies for glioma.
Acknowledgements
The work received no funding support.
Conflict of interests
No conflict of interests
This article is protected by copyright. All rights reserved
References
Caruso G, Caffo M. 2014. Antisense oligonucleotides in the treatment of cerebral
gliomas. Review of concerning patents. Recent Patents on Cns Drug Discovery
9:2-12.
Collins FS, Lander ES, Rogers J, Waterson RH. 2003. International Human Genome
Sequencing Consortium, Finishing the euchromatic sequence of the human
genome. Nature 431:931-945.
Congrains A, Kamide K, Ohishi M, Rakugi H. 2013. ANRIL: molecular mechanisms
and implications in human health. Int J Mol Sci 14:1278-92.
Cunnington MS, Santibanez Koref M, Mayosi BM, Burn J, Keavney B. 2010.
Chromosome 9p21 SNPs Associated with Multiple Disease Phenotypes Correlate
with ANRIL Expression. PLoS Genet 6:e1000899.
Delgado-López PD, Corrales-García EM. 2016. Survival in glioblastoma: a review
on the impact of treatment modalities. Clinical & translational oncology : official
publication of the Federation of Spanish Oncology Societies and of the National
Cancer Institute of Mexico 18:1-10.
Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, Tanzer A,
Lagarde J, Lin W, Schlesinger F. 2012. Landscape of transcription in human cells.
Nature 489.
Fan Y, Hoberg JE, Ramsey CS, Keller MD, Jones DR, Frye RA, Mayo MW. 2004.
Modulation of NF‐κB‐dependent transcription and cell survival by the SIRT1
deacetylase. Embo Journal 23:2369.
Fatica A, Bozzoni I. 2014. Long non-coding RNAs: new players in cell
differentiation and development. Nature Reviews Genetics 15:7.
Geisler S, Coller J. 2013. RNA in unexpected places: long non-coding RNA functions
in diverse cellular contexts. Nature Reviews Molecular Cell Biology 14:699.
Godlewski J, Krichevsky AM, Johnson MD, Chiocca EA, Bronisz A. 2014. Belonging
to a network—microRNAs, extracellular vesicles, and the glioblastoma
microenvironment. Neuro-Oncology 17:147-158.
Godnic I, Zorc M, Skok DJ, Calin GA, Horvat S, Dovc P, Kovac M, Kunej T. 2013.
Genome-Wide and Species-Wide In Silico Screening for Intragenic MicroRNAs in
Human, Mouse and Chicken.
8:e65165.
Haigis MC, Guarente LP. 2006. Mammalian sirtuins—emerging roles in physiology,
This article is protected by copyright. All rights reserved
aging, and calorie restriction. Genes & Development 20:2913-21.
Hida Y, Kubo Y, Murao K, Arase S. 2007. Strong expression of a longevity-related
protein, SIRT1, in Bowen’s disease. Archives of Dermatological Research
299:103-106.
Huffman DM, Grizzle WE, Bamman MM, Kim JS, Eltoum IA, Elgavish A, Nagy TR.
2007. SIRT1 is significantly elevated in mouse and human prostate cancer. Cancer
Research 67:6612-8.
Lawson J, Singh R, Hultner M, Ariyur K, Martin L. 2012. Long non-coding RNAs
and cancer: a new frontier of translational research? Oncogene 31:4577-4587.
Li Z, Yu X, Shen J. 2016. ANRIL: a pivotal tumor suppressor long non-coding RNA
in human cancers. Tumour Biol 37:5657-61.
Lin L, Gu ZT, Chen WH, Cao KJ. 2015. Increased expression of the long non-coding
RNA ANRIL promotes lung cancer cell metastasis and correlates with poor
prognosis. Diagnostic Pathology 10:14.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods
25:402-8.
Loewer S, Cabili MN, Guttman M, Loh YH, Thomas K, Park IH, Garber M, Curran M,
Onder T, Agarwal S. 2010. Large intergenic non-coding RNA-RoR modulates
reprogramming of human induced pluripotent stem cells. Nature Genetics
42:1113-7.
Longo VD, Kennedy BK. 2006. Sirtuins in aging and age-related disease. Cell
126:257-268.
This article is protected by copyright. All rights reserved
Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, Scheithauer
BW, Kleihues P. 2007. The 2007 WHO Classification of Tumours of the Central
Nervous System. Acta Neuropathologica 9 Spec No A:S1.
Luan S, Sun L, Huang F. 2010. MicroRNA-34a: A Novel Tumor Suppressor in
p53-mutant Glioma Cell Line U251. Archives of Medical Research 41:67.
Mercer TR, Dinger ME, Mattick JS. 2009. Long non-coding RNAs: insights into
functions. Nature Reviews Genetics 10:155.
Rajaraman P, Melin BS, Wang Z, Mckeancowdin R, Michaud DS, Wang SS, Bondy M,
Houlston R, Jenkins RB, Wrensch M. 2012. Genome-wide association study of
glioma and meta-analysis. Human Genetics 131:1877-1888.
Tsai MC, Spitale RC, Chang HY. 2011. Long Intergenic Noncoding RNAs: New Links
in Cancer Progression. Cancer Research 71:3-7.
This article is protected by copyright. All rights reserved
Wapinski O, Chang HY. 2011. Long noncoding RNAs and human disease. Trends in
Cell Biology 21:354-361.
Wu Y, Meng X, Huang C, Li J. 2015. Emerging role of silent information regulator 1
(SIRT1) in hepatocellular carcinoma: a potential therapeutic target. Tumor
Biology 36:4063-4074.
Xu X, Wan X, Zhang Z. 2016. Long non-coding RNA ANRIL promotes
tumorigenesis in glioma via MAPK signaling pathways. International Journal of
Clinical & Experimental Medicine.
Yamakuchi M, Ferlito M, Lowenstein CJ. 2008. miR-34a repression of SIRT1
regulates apoptosis. Proceedings of the National Academy of Sciences
105:13421-13426.
Yap KL, Li S, Muñozcabello AM, Raguz S, Zeng L, Mujtaba S, Gil J, Walsh MJ, Zhou
MM. 2010. Molecular Interplay of the Non-coding RNA ANRIL and Methylated
Histone H3 Lysine 27 by Polycomb CBX7 in Transcriptional Silencing of INK4a.
Molecular Cell 38:662.
Zhang EB, Kong R, Yin DD, You LH, Sun M, Han L, Xu TP, Xia R, Yang JS, De W. 2014.
Long noncoding RNA ANRIL indicates a poor prognosis of gastric cancer and
promotes tumor growth by epigenetically silencing of miR-99a/miR-449a.
Oncotarget 5:2276-92.
This article is protected by copyright. All rights reserved
Figure legends
Figure 1. Effects of ANRIL-silencing on human U251 glioma cell function.
A Quantitative RT-PCR analysis of ANRIL expression in normal glia cells (HEB) and
five glioma cell lines. Human U251 glioma cells were transfected with sh-ANRIL (1#
or 2#) or the sh-NC negative control. Untransfected cells were included as a
transfection control. B Quantitative RT-PCR analysis of ANRIL expression in U251
cells. C CCK-8 assays of cell viability. D Relative colony formation number. E, F
Western blot analysis of proteins associated with cell cycle. G Flow cytometric
analysis of cell apoptosis. H, I Transwell assays of cell migration and invasion
capacity. Data represent the mean ± standard deviation (SD) of three independent
experiments. *P < 0.05, ** P < 0.01, *** P < 0.005. ANRIL, antisense non-coding
RNA in the INK4 locus; CDK, cyclin-dependent kinase.
Figure 2 ANRIL acts as a sponge of miR-34a
Human U251 glioma cells were transfected with sh-ANRIL 2# or the sh-NC.
Untransfected cells were included as a transfection control. Data represent the mean ±
standard deviation (SD) of three independent experiments. *** P < 0.005. ANRIL,
antisense non-coding RNA in the INK4 locus.
Figure 3. Effects of ANRIL-silencing on human U251 glioma cell function are
mediated by miR-34a upregulation.
Human U251 cells were co-transfected with recombined plasmids and miRNAs.
shNC and NC were used as the corresponding negative controls and untransfected cells
were included as a transfection control. A CCK-8 assays of cell viability. B, C Flow
cytometric analysis of cell apoptosis. D, E Transwell assays of cell migration capacity.
F, G Transwell assays of cell invasion capacity. Data represent the mean ± standard
deviation (SD) of three independent experiments. *P < 0.05, ** P < 0.01. ANRIL,
antisense non-coding RNA in the INK4 locus; NC, negative control of miR-34a
inhibitor.
Figure 4. MiR-34a is a direct negative regulator of Sirt1 expression.
Human U251 glioma cells were transfected with miRNAs. Scramble miRNAs and NC
were used as the corresponding negative controls and untransfected cells were included
This article is protected by copyright. All rights reserved
as a transfection control. A Quantitative RT-PCR analysis of Sirt1 mRNA expression.
B, C Western blot analysis of Sirt1 protein expression. D Dual luciferase reporter
assays of U251 cells co-transfected with vectors (Sirt1-wt or Sirt1-mt) and scramble
miRNAs or miR-34a mimic. Data represent the mean ± standard deviation (SD) of
three independent experiments. *P < 0.05, ** P < 0.01, *** P < 0.005. Sirt1, silent
information regulator 1; NC, negative control of miR-34a inhibitor; Sirt1-wt,
pmirGlO vector carrying fragments of wild-type Sirt1 3’UTR that targeting miR-34a;
Sirt1-mt, mutant Sirt1-wt.
Figure 5. MiR-34a affected U251 cells via downregulating Sirt1.
Human U251 glioma cells were transfected with a Sirt1 expression vector (pEX-Sirt1)
or sh-Sirt1 to induce overexpression or silencing of Sirt1. A Western blot analysis of
Sirt1 protein expression. U251 cells overexpressing Sirt1 were treated with or without
miR-34a mimic. Scramble and pEX were used as the corresponding negative controls
and untransfected cells were included as a transfection control. B CCK-8 assays of cell
viability. C, D Flow cytometric analysis of cell apoptosis E, F Transwell assays of cell
migration capacity. G, H Transwell assays of cell invasion capacity. Data represent the
mean ± standard deviation (SD) of three independent experiments. *P < 0.05, ** P <
0.01, *** P < 0.005. Sirt1, silent information regulator 1.
Figure 6. Signaling pathways involved in Sirt1 function.
Human U251 cells were transfected with a Sirt1 expression vector (pEX-Sirt1) or
sh-Sirt1 to induce overexpression or silencing of Sirt1. Untransfected cells were
included as a transfection control. A Western blot analysis of components of the
PI3K/AKT signaling pathway. B Western blot analysis of components of the mTOR
signaling pathway. C Relative protein expression fold. Data represent the mean ±
standard deviation (SD) of three independent experiments. *** P < 0.005. Sirt1, silent
information regulator 1; p-, phosphorylated; t-, total; p/t-, phosphorylated/total.
This article is protected by copyright. All rights reserved
Figure 7. Dual inhibitor of the PI3K/AKT and mTOR pathways reverses the
effects of Sirt1 overexpression in U251 cells overexpressing miT-34a.
Human U251 cells were co-transfected with plasmids and miRNAs with the presence
of DMSO (0.1%) or NVP-BEZ235 (Dual inhibitor, 100 nM). Untransfected cells were
included as a transfection control. A CCK-8 assays of cell viability. B, C Transwell
assays of cell migration capacity. D, E Transwell assays of cell invasion capacity. Data
represent the mean ± standard deviation (SD) of three independent experiments. * P <
0.05, ** P < 0.01. Sirt1, silent information regulator 1.
This article is protected by copyright. All rights reserved
Figure 1
This article is protected by copyright. All rights reserved
Figure 2
This article is protected by copyright. All rights reserved
Figure 3
This article is protected by copyright. All rights reserved
Figure 4
This article is protected by copyright. All rights reserved
Figure 5
This article is protected by copyright. All rights reserved
Figure 6
This article is protected by copyright. All rights reserved
Figure 7
This article is protected by copyright. All rights reserved
Документ
Категория
Без категории
Просмотров
2
Размер файла
1 563 Кб
Теги
26437, jcb
1/--страниц
Пожаловаться на содержимое документа