close

Вход

Забыли?

вход по аккаунту

?

WMJ2015.1890

код для вставкиСкачать
Wageningen Academic
P u b l i s h e r s
World Mycotoxin Journal, 2016; 9 (2): 215-228
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
Production of the 14 kDa trypsin inhibitor protein is important for maize resistance
against Aspergillus flavus infection/aflatoxin accumulation
Z.-Y. Chen1*, M.L. Warburton2, L. Hawkins2, Q. Wei3, Y. Raruang1, R.L. Brown3, L. Zhang1 and D. Bhatnagar3
1Department
of Plant Pathology and Crop Physiology, Louisiana State University Agricultural Center, Baton Rouge, LA
70803, USA; 2Corn Host Plant Resistance Research Unit, U.S. Department of Agriculture-Agricultural Research Service,
Mississippi State, MS 39762-9555, USA; 3Southern Regional Research Center, USDA-ARS, New Orleans, LA 70124, USA;
zchen@agcenter.lsu.edu
Received: 5 February 2015 / Accepted: 28 April 2015
© 2015 Wageningen Academic Publishers
RESEARCH ARTICLE
Abstract
Maize (Zea mays L.) is one of the major crops susceptible to Aspergillus flavus Link ex. Fries infection and subsequent
aflatoxin contamination. Previous studies found the production of an antifungal 14 kDa trypsin inhibitor (TI) was
associated with maize aflatoxin resistance. To further investigate whether the TI plays any direct role in resistance,
a TI gene silencing vector was constructed and transformed into maize. Mature kernels were produced from 66
transgenic lines representing 18 independent events. A final total of twelve lines representing four independent
events were confirmed positive for transformation, five of which showed significant reduction (63 to 88%) in TI
transcript abundance in seedling leaf tissue and seven of which showed significant TI protein reduction (39-85%) in
mature kernels. Six of the seven silenced transgenic lines supported higher levels of aflatoxin production compared
to negative controls. To further confirm the role of TI in field resistance to aflatoxin accumulation, DNA sequence
polymorphisms from within the gene or linked simple sequence repeats were tested in four quantitative trait loci
(QTL) mapping populations for QTL effect, and three QTL with log of the odds scores of 11, 4.5, and 3.0 and possibly
caused by the TI protein encoding gene were found. Sequence polymorphisms were also tested for association to
aflatoxin levels in an association mapping panel, and three single nucleotide polymorphisms were found associated
with aflatoxin accumulation (P<0.01). The data from both RNAi and genetic mapping studies demonstrated that
production of the TI in maize is important for its resistance to A. flavus infection and/or aflatoxin production.
Keywords: Zea mays L., transgenic, RNAi silencing, association mapping, Hageman factor inhibitor
1. Introduction
Infection of maize (Zea mays L.) by Aspergillus flavus (Link
ex. Fries) and the subsequent accumulation of the toxic
and highly carcinogenic secondary metabolites, aflatoxins
(Squire, 1981), are serious agricultural problems, especially
under drought conditions (Diener et al., 1987; Kebede et al.,
2012; Payne, 1998). Aflatoxin contamination significantly
reduces the value of grain and poses health hazards to
humans and domestic animals (Hsieh, 1989; Payne, 1998;
Schmale and Munkvold, 2009; Shephard, 2008). In the past
decades, maize genotypes resistant to aflatoxin production
have been identified through field screening (Campbell and
White, 1995; Widstrom et al., 1987). However, the lack of
identifiable molecular markers in these resistant lines and
the poor understanding of host resistance mechanisms
have hindered the incorporation of resistance into lines
with good agronomic characteristics.
Recently, several microarray studies examined differential
gene expressions between resistant and susceptible maize
lines under control and A. flavus infection conditions to
better understand host pathogen interaction at the molecular
level. Luo et al. (2011) compared one resistant and one
susceptible line with similar genetic background, and found
that more PR genes were expressed in the resistant line
under control conditions, and more genes were differentially
expressed in the susceptible line upon A. flavus infection.
ISSN 1875-0710 print, ISSN 1875-0796 online, DOI 10.3920/WMJ2015.1890215
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
Z.-Y. Chen et al.
A separate study by Kelley et al. (2012) compared gene
expression profile differences between two resistant
(Mp313E, Mp04:86) to two susceptible maize lines (B73,
Va35). Of the fifty differentially expressed genes that were
verified by RT-PCR, sixteen of them were highly expressed in
Mp313E and fifteen in Va35 (Kelley et al., 2012). In another
study, the expression of A. flavus genes during infection of
immature maize kernels was examined and found that the
fungal phytase plays an important role in pathogenesis, but
does not affect aflatoxin production (Reese et al., 2011).
Dolezal et al. (2013, 2014) examined differential fungal gene
expressions in maize kernels in comparison to the fungus
grown on autoclaved kernels, and maize gene expressions
in inoculated vs control kernels and identified a series
of interesting genes that might be important during the
pathogenesis of maize kernels by A. flavus.
In addition, several studies have demonstrated a role
for kernel proteins in A. flavus infection and aflatoxin
accumulation (Brown et al., 1995; Chen et al., 1998; Gao
et al., 2011, 2009; Guo et al., 1997; Huang et al., 1997),
especially the role of constitutively expressed proteins as a
first layer of defence (Chen et al., 2001). A proteomics study
examined rachis tissues with or without A. flavus infection
(Pechanova et al., 2011) and found that resistant lines
contained higher levels of abiotic stress-related proteins
and proteins from phenylpropanoid metabolism, whereas
those from susceptible lines contained more abundant
pathogenesis-related proteins. This indicated that the
resistant lines rely on constitutive defences, whereas the
susceptible lines are more dependent on inducible defences.
An earlier proteomics study identified constitutively
expressed resistance-associated proteins (RAPs) from maize
endosperm and embryo tissues (Chen et al., 2002, 2007);
three categories of proteins (storage, stress-responsive,
and antifungal proteins including pathogenesis-related
protein 10 and the 14 kDa trypsin inhibitor) were found to
be either unique or significantly increased in abundance in
resistant lines (Chen et al., 1998, 2002, 2007). In particular,
the 14 kDa trypsin inhibitor protein (TI) was constitutively
expressed at high levels in the endosperm of resistant lines,
but low or absent in susceptible lines (Chen et al., 1998).
It also exhibited antifungal activities against a broad range
of plant pathogens (Chen et al., 1999).
The involvement of one RAP (PR-10) in maize aflatoxin
resistance was demonstrated through RNA interference
(Chen et al., 2010), a sequence-specific RNA degradation
process triggered by a dsRNA at the post-transcriptional
level (Fire et al., 1998; Gura, 2000). The objectives of the
present study were to determine whether the expression
of TI, another RAP, has a direct effect on maize aflatoxin
resistance through RNA interference (RNAi); and to validate
the effect of the corresponding gene in quantitative trait
loci (QTL) and association mapping of field aflatoxin
accumulation resistance. QTL mapping studies can provide
216
independent validation of gene function, especially in
different backgrounds and under many environmental
conditions (Warburton et al., 2011a). Confirmation of gene
effect within a significant QTL peak or associated sequence
would provide further proof of the ability of the TI gene to
suppress aflatoxin production in A. flavus infected maize.
2. Materials and methods
Construction of RNAi gene silencing vector for the 14
kDa trypsin inhibitor gene
The pBS-d35S-R4-R3 vector containing a double 35S
promoter, followed by an attR4-ccdB-CmR-attR3 cassette
amplified from pDEST™ R4-R3 (Invitrogen, Carlsbad, CA,
USA) in the pBluescript SK- was constructed as described
(Chen et al., 2010).
The 5’ and 3’ arms of TI gene were amplified using PCR
with homologous recombination sites (underlined) attached
to the end of the gene specific primers. Briefly, the 5’ arm
corresponding to sequences from 228 to 514 of X54064
was amplified with attB4-TIf: GGGG ACA ACT TTG
TAT AGA AAA GTT G CCGGAGCTGAAGAGGAGATG
and attB1-TIr: GGGG AC TGC TTT TTT GTA CAA
ACT GT TATGCTCTTCGCAGTTACTTGG with the
TI cDNA clone pT7-7TI3 as a template and the 3’ arm
corresponding to sequences from 518 to 228 was amplified
with attB2-TIf: GGGG ACA GCT TTC TTG TAC AAA
GTG GGCACTATGCTCTTCGCAGTTACTTG and
attB3-TIr: GGGG AC AAC TTT GTA TAA TAA AGT
TGCCGGAGCTGAAGAGGAGATG in a similar manner.
The 5’ and 3’ arms were ligated into pDONR P4-P1R and
pDONR P2R-P3 (Invitrogen), respectively, through BP
clonase reactions as previously described (Chen et al., 2010).
The resulting vectors were named pENTR-L4-5’arm-R1
and pENTR-R2-3’arm-L3, respectively.
The third vector (pDONR221-PR10-intron-CmR) used to
create the inverted repeat sequence of 5’ and 3’ arms for
RNAi silencing was constructed in the previous study (Chen
et al., 2010). It contained a maize PR10 intron, in which the
DNA sequence between the Sph I and Cla I restriction sites
was replaced with a chloramphenicol resistance gene (CmR).
The insertion of antibiotic resistance marker CmR was for
easy selection of downstream target clones as well as for
increased stability of the inverted repeat of the 5’ and 3’ arms.
The pENTR-L4-5’arm-R1, pENTR-R2-3’arm-L3, and the
pDONR221-PR10-intron-CmR vectors were assembled
into the pBS-d35S-R4-R3 to produce the pBS-d35S-attB4TI 5’arm-attB1-pr10 intron-CmR-attB2-TI 3’arm-attB3
vector through an LR clonase reaction according to the
manufacturer’s instruction (Invitrogen). The resulting
vector pBS-TI-RNAi (pBS-d35S-attB4-5’arm-attB1-PR 10
intron-CmR-attB2-3’arm-attB3) was then verified through
World Mycotoxin Journal 9 (2)
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
restriction digestion and sequencing before being digested
with EcoR I and Sac I to remove the d35S-attB4-5’armattB1-PR 10 intron-CmR-attB2-3’arm-attB3 cassette, which
was then ligated into the corresponding sites of pTF102
(Frame et al., 2002) to generate the final RNAi vector
pTF102-TI-RNAi for use in maize transformation.
Maize transformation
The immature zygotic embryos of the maize Hi II hybrid
with the ability to produce close to 100% type II callus (A188
× B73 origin) (Armstrong et al., 1991) were used in this
study. The embryos were transformed with the pTF102TI-RNAi construct through both particle bombardment
and Agrobacterium-mediated methods at the Iowa State
University Plant Transformation Facility (Ames, IA, USA).
For particle bombardment, plasmid pTF102-TI-RNAi DNA
was coated onto 0.6 μm gold particles (Bio-Rad, Hercules,
CA, USA) following the protocol outlined by Frame et al.
(2000). F2 immature zygotic embryos (1.5-2.0 mm) of the
maize Hi II hybrid genotype were aseptically dissected
from greenhouse-grown ears harvested 10 to 13 days
post pollination, and were placed embryo axis-side down
(about 45 embryos per plate) onto N6-based media (Chu
et al., 1975), with modifications (Frame et al., 2000), for 3
days in the dark at 28 °C to induce callus initiation before
bombardment. Selection of bialaphos-resistant putative
callus events from bombarded immature embryos was
conducted according to Frame et al. (2000) before analysis
of TI transcript abundance in independent transformation
events was carried out. For Agrobacterium-mediated
transformation, the above plasmid DNA was introduced into
Agrobacterium strain EHA101. Immature embryo infection,
co-cultivation and resting, and selection and regeneration
of transgenic callus events on bialaphos-containing media
were performed according to Frame et al. (2002).
Evaluation of transgenic maize kernels and confirmation
of transformation
For each transgenic ear, kernel weight was determined
for all kernels (if total number of kernels is less than 30)
or 30 randomly selected kernels. The mean kernel weight
between each transgenic plant was separated using least
significant differences (P=0.05). Twenty transgenic lines
were randomly selected for further studies. Genomic DNA
was isolated from young leaves developed from transgenic
kernels regenerated from Agrobacterium transformation
according to the instructions from the Redextract-N-Amp
Plant PCR kit (Sigma, St. Louis, MO, USA). Genomic DNA
extracted from nontransformed seedlings was used as a
negative control. The isolated genomic DNA was then used
as a template to confirm the transformation through PCR
with PR10if (GTTCAACTTCACCTCAG G) and PR10ir
(AAGCTGAACGGCATGACT) primers corresponding
to the CmR region flanked by the intron.
World Mycotoxin Journal 9 (2)
Trypsin inhibitor protein is required for maize aflatoxin resistance
Determining trypsin inhibitor expression using real-time
RT-PCR
Total RNA was isolated from young leaves developed
from transgenic kernels regenerated from Agrobacterium
transformation according to the instructions from the
RNeasy Plant mini kit (Qiagen, Valencia, CA, USA). The
optional DNase treatment was included to remove trace
DNA contamination prior to reverse-transcription with
random primers using TaqMan Reverse Transcription
Reagents (Applied Biosystems, Foster City, CA, USA).
The resulting cDNAs were then used in realtime PCR with
TI-14RT-F (GGCGTCGCCGAATGC) and TI-14RT-R
(GCTCATTCCTCATGCACTATGC) primers and a
TaqMan probe (FAM-ATTCTCGGCGGCGGAACGTAMRA) to quantify TI transcript levels in the controls
and transformed maize seedling leaves. The expression of
18S RNA was used as an internal control to normalise the
transcript abundances. This experiment was conducted
twice, each time with three replicates. The data presented
here are means combined from the two repeats.
Trypsin inhibitor production in transgenic maize kernels
Kernels of the above randomly selected 20 lines representing
ten independent transformation events along with two nontransformed controls (HI 40917-1 × B73, HT40921-9 × B73)
were separated into embryo and endosperm tissues. The
endosperm tissue, where the TI protein was first identified
(Chen et al., 1998), was used for protein extraction according
to Chen et al. (1998). Protein extraction was conducted
twice, and each extract was separated in replicated 2-D gels,
followed by silver staining (Chen et al., 2007). Gel analysis
was performed using Progenesis (Nonlinear Dynamic,
Durham, NC, USA) to determine the TI protein production
in all four gels for each line. The sum of normalised volumes
of all the TI protein spots in each of the replicated gels
was combined with those from the other replicated gels to
calculate the mean normalised volume, which represents
the TI protein abundance in each of the TI RNAi lines. The
mean value of TI protein abundance from each line was
separated by LSD using the SAS software (SAS Institute
Inc., Cary, NC, USA), and was used to compare to that in
the control lines to determine the changes in TI production.
Changes in resistance of transgenic maize kernels to
Aspergillus flavus infection and aflatoxin production
The kernel screening assay (Brown et al., 1995) was used to
evaluate changes in resistance of these twenty transgenic
lines in two separate batches. Pioneer 3142 (P3142) and
MI 82 were also included in this study as susceptible
and resistant control, respectively. Fifteen kernels in five
replicates for transgenic line or 30 kernels in 10 replicates
for the controls (three kernels per replicate) were surfacesterilised and inoculated with A. flavus according to Brown
217
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
Z.-Y. Chen et al.
et al. (1995). At the end of incubation, fungal colonisation on
the surface of inoculated kernels, an index of fungal growth,
was rated according to a 0-5 scale, with 0 for kernels having
visible mycelium on kernel surface, but no sporulation and 5
for kernels having 81 to 100% of their kernel surface covered
by conidiophores bearing conidia (Guo et al., 1995). After
visual rating of fungal colonisation, kernels were dried and
used to determine aflatoxin concentrations according to
Brown et al. (1995). Aflatoxin concentrations were logtransformed to equalise variations before statistical analysis
using the SAS software (SAS Institute Inc., Cary, NC) to
determine whether there were any significant differences
among the RNAi silenced transgenic and control kernels.
This experiment was conducted twice. The data presented
here were means combined from the two experiments.
Quantitative trait loci and association mapping
QTL mapping populations were created by crossing a
resistant by a susceptible maize inbred line, and these
included Mp313E × Va35 (described in Willcox et al., 2013);
Mp715 × T173 (Warburton et al., 2011a); Mp717 × NC300
(Warburton et al., 2009); and Mp313E × B73 (Brooks et al.,
2005). The association mapping panel of 300 testcrossed
lines is described in Warburton et al. (2013). Phenotyping
of the populations and panels were as described in each
reference; briefly, hybrids were grown in replicated field
experiments in multiple locations and/or years. A 3.4
ml suspension containing 3×108 conidia/ml suspension
A. flavus strain NRRL 3357 (ATCC #200026) was inoculated
into the ear through the husk of each hybrid using the sideneedle technique 14 d after mid-silk (50% of the plants
in the plot had silks emerged) according to Zummo and
Scott (1989). The VICAM AflaTest (VICAM, Watertown,
MA) was used to determine aflatoxin concentration in 50 g
samples of mature, dried, and ground grain from each plot.
Genotyping of the four QTL mapping populations and
one association mapping panel was done according
to Warburton et al. (2011b). Briefly, the sequence of
the 14 kDa trypsin inhibitor (TI) Genbank accession
number X54064 (also known as the Z. mays gene
for Hageman factor inhibitor, hfi1) and located at
AGPv2:2:160150179:160152870 (Bin 2.06) was found in
the MaizeGDB database (www.maizegdb.org) (Lawrence
et al., 2008). The sequence was used to identify and extract
10 single nucleotide polymorphisms (SNPs) from within
the sequence of the eight diverse maize lines, and a KASP
SNP assay (LGC Genomics, Beverly, MA, USA) that can
be run on a fluorescence-based plate reader was identified
for each SNP. In addition, a restricition fragment length
polymorphism (RFLP) assay was developed from the same
sequence and closely linked simple sequence repeats (SSRs)
were identified for QTL mapping from the MaizeGDB
database. These included: umc1065, bnlg371, bnlg108,
umc1028, umc1079 and umc2178 (www.maizegdb.org).
218
Mapping of the F2:3 QTL mapping populations used the
initial marker data set and phenotypic data from replicated
field experiments reported in the published references for
each population, with the added markers for which each
population segregated. Maps were created using JoinMap
(version 4) (Van Ooijen, 2006). Linkage groups were
constructed using the Maximum Likelihood (ML) mapping.
Composite Interval Mapping (CIM) was performed using
QTL Cartographer version 2.5 (Basten et al., 1999) as
described by Brooks et al. (2005). To estimate the 0.05
significance threshold for QTL, 1000 permutations were
performed with each data set and across all data sets (Doerge
and Churchill, 1996). Candidate gene association analysis
was run with the association panel using the General Linear
Model and the TASSEL software package (Bradbury et al.,
2007). The subpopulation analysis and phenotypic data were
used as reported in Warburton et al. (2013).
3. Results
Construction of trypsin inhibitor RNAi vector
The correct assembly of the pBS-TI-RNAi containing
the inverted repeat of TI 5’ arm and TI 3’ arm separated
by the pr10 intron was first verified through restriction
enzyme digestion (Figure 1A). The clones demonstrating
correct restriction patterns were then confirmed through
DNA sequencing. The DNA region containing the TIRNAi cassette was then subcloned into pTF102 through
ligation and verified through digestion (Figure 1B). This
final pTF102-TI RNAi construct was 11,352 bp, capable
of producing a 287 bp double stranded TI RNA transcript
with an 85 bp single strand loop in the middle once it is
expressed and processed in the host plant. The restriction
map of the final construct is shown in Figure 2.
Production of transgenic maize kernels and confirmation
for transformation.
66 transgenic plants representing 18 independent
transformation events (3-4 plants/event) were regenerated
and pollinated with B73 to produce mature kernels. The
number of mature kernels produced per ear/plant varied
from 4 to 249. Average kernel weight from these ears ranged
from 0.315 to 0.072 g. Twenty transgenic lines varying in
kernel weight and size representing 10 independent events
along with the Hi II control (HT40917-12, HT40921-9)
(Table 1, Supplementary Figure S1) were selected for
further investigation. All the transgenic kernels examined
were viable and grow normally compared to the controls
(data not shown). Seedling leaves developed from these
selected kernels were used for genomic DNA isolation and
confirmation of presence of transgene via PCR. Twelve
out of the 20 selected transgenic lines were confirmed
positive for presence of transgene, while the remaining
eight (A96S1-1-1, A96S1-1-2, A96S1-1-4, A96S1-3-3,
World Mycotoxin Journal 9 (2)
Trypsin inhibitor protein is required for maize aflatoxin resistance
kb
10.0
8.0
6.0
4.0
3.0
2.0
1.55
1.4
1.0
0.75
0.5
0.4
0.3
0.2
0.1
Marker
PvuII
EcoRI+HindIII
HindIII+SacI
EcoRI+SacI
pTF-TI-RNAi
EcoRI+XhoI
B
PvuII
SphI
EcoRI+SacII
NcoI+SacI
pBS-TI-RNAi
Marker
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
A
kb
10.0
8.0
6.0
4.0
3.0
2.0
1.55
1.4
1.0
0.75
0.5
0.4
0.3
0.2
Figure 1. Digestion of the pBS-TI RNAi intermediate vector (A) and the final pTF102-TI RNAi vector (B) with restriction enzymes
confirming their correct assembly. The restriction enzymes used for digestion of the vectors and the molecular size markers were
labeled on the top and on the side of the gels, respectively. The expected sizes for pBS-TI RNAi digested with SacI and NcoI, or
SacII and EcoRI, or SphI, and PvuII were: 1.0 and 4.2 kbp; 0.46, 0.64, 0.98, and 3.1 kbp; 1.15 and 4.0 kbp; and 0.37, 0.39, 0.78, 1.09,
and 2.88 kbp; respectively. The expected sizes for pTF102-PR10 RNAi digested with EcoRI and XhoI, or EcoRI and SacI, or HindIII
and SacI, HindIII and EcoR I and PvuII were: 1.36, 1.62, and 8.37 kpb; 0.69, 1.62, and 9.04 kbp; 0.24, 2.29, and 8.82 kbp; 0.93, 1.61,
and 8.80 kbp; and 0.44, 0.71, 0.78, 1.1, 1.52, and 6.8 kbp, respectively.
A96S1-8-1, A96S1-8-2, A96S1-8-3, A96S1-25-5) were
negative (Table 1). It is interesting to note that nine out of
the 12 transgenic lines had the highest average kernel weight
and majority of the lines with smaller kernels were negative
for the target gene. This stimulated kernel development in
RNAi silenced kernels may indicate a trade-off in the host
plant between defence and development.
Evaluation of trypsin inhibitor gene expression in the leaf
tissue of the transgenic lines
Total RNA was also isolated from seedling leaves to
determine the level of TI expression. The TI transcript
abundances varied significantly among different lines. Of
the twelve lines that were positive for transformation, two
(A96S1-3-1 and A96S1-15-2) had significantly higher TI
transcript abundances than the non-transformed HT4091712 control, five had similar TI transcript abundances as
the control, and the remaining five lines had significantly
lower TI transcript abundances, ranging from 12 to 37% of
the control (Figure 3, Table 2). Of the eight lines that were
negative for transformation, four had significantly higher
World Mycotoxin Journal 9 (2)
TI transcript abundance, one had a level similar to in the
control, and three had levels less than the control (half to
one third) (Figure 3, Table 2).
Changes in trypsin inhibitor protein production in the
transgenic kernels
The abundance of TI protein in the transgenic and control
lines was analysed using 2-D gel electrophoresis (Figure 4).
Here, the mean of the combined volume of all spots in the
boxed area, from four replicated gels for each line was
used for comparison. For the eight lines that are negative
for transformation, no significant reduction in TI protein
was observed compared to the control lines (HT40917
and HT40921) (Figure 4, left panel). Of the twelve lines
that are positive for transformation, seven (A96S1-6-2,
A96S1-6-4, A96S1-8-4, A96S1-13-2, A96S1-15-2, A96S121-1, and A96S1-25-3) had significantly lower abundance
of TI protein, ranging from 15% to 61% of the controls
(Figure 4, right bottom panel). The remaining five lines had
similar levels of TI protein as the controls (Figure 4, right
top panel). The average relative TI protein abundance in
219
Z.-Y. Chen et al.
SacII (9955)
Intron splici(9786)
PvuII (9990)
SpeI (10150)
EcoRV (10309)
HindIII (10914)
EcoRI (10929)
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
XbaI (9754)
PvuII (11108)
NcoI (9608)
EcoRI (9307)
Intron splici(8985)
PR10 End (8968)
PvuII (8767)
SacI (8620)
KpnI (8614)
1
d35S promoter
attB1
PvuII (9207)
SacII (8804)
NotI (881)
attB4
attB2
attB3
pVS1
NotI (2414)
PR10 intron
TI 3'arm
pTF102-d35S-Ti-RNAi
T35S
11352bp
P35S
bar ORF
HindIII (8381)
PstI (8397)
NotI (3704)
pBR322
Tvsp
EcoRV (8042)
XhoI (7945)
SalI (7531)
SacII (7366)
PvuII (7304)
KpnI (7286)
NdeI (1550)
TI 5' arm
PR10 intron
CmR
NdeI (4040)
aadA
PvuI (5525)
NdeI (6989)
PvuII (6594)
PvuI (6565)
Figure 2. Restriction map of pTF-TI RNAi construct. This construct contains the following DNA sequence components: Pvs1, a
broad host range plasmid from Pseudomonas; a 1.3 kb sequence from pBR322; aadA, aminoglycoside 3’-adenylyltransferase gene
from Shigella flexneris 2a that confers resistance to streptomycin; Tvsp, 3’ terminator from soybean vegetative storage protein
gene; bar ORF, phosphinothricin acetyltransferase from Streptomyces hygroscopicus that confers resistance to glufosinate and
bialophos; P35S, cauliflower mosaic virus 35S promoter; T35S, 3’ terminator from 35S transcript of cauliflower mosaic virus;
attB1-4, homologous recombination sites; d35S, double 35S promoter from cauliflower mosaic virus; and part of TI in reverse
orientation (TI 5’ arm and 3’ arm) separated by an intron from PR-10 that contains chloramphenicol (CmR) selection marker.
the transgenic lines compared to the controls is shown in
Table 2. To confirm the identities of putative TI proteins,
the protein spots in the boxed area were recovered from
Coomassie stained gels and sequenced. Eight of them were
confirmed to be TI based on the obtained peptide sequence
information (Supplementary Table S1).
Changes in fungal growth and aflatoxin production in
trypsin inhibitor gene silenced transgenic kernels
The transgenic maize kernels also showed high variation in
fungal colonisation 7 days after inoculation using the kernel
screening assay (KSA) (Figure 5). The highest colonisation
was observed in A96S1-21-1, A96S1-25-3, and A96S1-5-1.
Of the nine lines with colonisation rating of 1.5 or higher,
seven were confirmed transgenic lines (Table 3). Most of
the lines with high colonisation ratings also had higher
levels of aflatoxin with the exception of A96S1-25-1 and
A96S1-8-2, which had relatively high fungal colonisation
but low aflatoxin production (Table 3). The seven lines
producing the highest aflatoxin levels (A96S1-25-3, A96S1220
21-1, A96S1-8-4, and A96S1-13-2 from the first study, and
A96S1-5-1, A96S1-6-4, and A96S1-6-2 from the second)
were RNAi transgenic lines confirmed positive for the
presence of transgene.
Confirmation of trypsin inhibitor effect in QTL and
association mapping tests
In the Mp313E × Va35 mapping population, an RFLP marker
from within the TI/Hageman factor inhibitor hfi1 gene
sequence was found at the exact peak of a QTL in bin 2.06,
with a LOD (log of the odds) value of 4.5 (Table 4). No SNP
or RFLP from within in the hfi1 sequence was polymorphic
in the other three mapping populations, so the regions were
mapped with nearby SSRs. A QTL spanning bin 2.06 was
identified in the Mp313E × B73 mapping population with
a LOD of 11, possibly containing the hfi1 gene sequence.
A QTL spanning bin 2.06 was also identified in the Mp715
× T173 mapping population, with a LOD of 3.0. There is
no QTL in the region of bin 2.06 in the Mp717 × NC300
mapping population (Supplementary Figure S2). Five of
World Mycotoxin Journal 9 (2)
Trypsin inhibitor protein is required for maize aflatoxin resistance
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
Table 1. Differences in average kernel weight of the 20 tripsin inhibitor RNAi transgenic lines selected for evaluation.
Line name
Positive for
transformation1
Total # of kernels
Ave. weight (g)
Max. weight (g)
Min. weight (g)
Statistics2
A96S1-21-1
A96S1-6-4
A96S1-13-2
A96S1-5-1
A96S1-25-3
A96S1-15-2
A96S1-1-1
A96S1-25-1
A96S1-8-4
A96S1-3-2
A96S1-8-3
A96S1-6-2
A96S1-8-1
A96S1-3-1
A96S1-25-5
A96S1-1-4
A96S1-8-2
A96S1-18-5
A96S1-1-2
A96S1-3-3
HT40917-1
HT40917-3
HT40917-12
HT40921-9
yes
yes
yes
yes
yes
yes
no
yes
yes
yes
no
yes
no
yes
no
no
no
yes
no
no
no
no
no
no
65
74
84
92
167
105
128
154
174
214
182
192
188
180
220
122
136
249
191
244
174
95
59
89
0.315
0.281
0.255
0.242
0.238
0.235
0.223
0.215
0.177
0.174
0.166
0.153
0.144
0.133
0.130
0.114
0.108
0.106
0.089
0.087
0.159
0.168
0.144
0.258
0.396
0.320
0.291
0.298
0.299
0.271
0.291
0.270
0.228
0.215
0.210
0.193
0.182
0.164
0.177
0.180
0.136
0.156
0.207
0.115
0189
0.204
0.177
0.292
0.149
0.190
0.090
0.157
0.182
0.094
0.165
0.156
0.065
0.126
0.100
0.098
0.090
0.080
0.033
0.040
0.061
0.035
0.023
0.018
0.129
0.105
0.099
0.212
a
b
c
cd
de
de
ef
f
g
g
gh
hi
ij
j
jk
kl
l
l
m
m
hi
gh
ij
c
1
Positive transformation was verified through PCR with PR10if (5’-GTTCAACTTCACCTCAGG) and PR10ir (5’-AAGCTGAACGGCATGACT) primers
corresponding to the CmR region spanned by the intron using the genomic DNA isolated from seedling leaves of the corresponding transgenic lines.
2 Average kernel weight was based on the measurement of 30 random-selected kernels. The means within the column followed by the same letter were
not significantly different based on Waller-Duncan K-ratio t test (at P=0.05).
the 10 polymorphic SNPs identified in the association
mapping panel were not useable due to a very low (<3.5%)
minor allele frequency or large proportion of missing data
in the panel. There is a known InDel of over 300 base pairs
in this gene, and it was assumed that the missing SNPs fell
within that region, but because this was not confirmed, they
were not used for mapping. The remaining five SNPs were
run in an association analysis with aflatoxin accumulation
level in the association panel. Three SNPs (at positions
2:160151389, 160151358 and 160151277) were weakly
associated with aflatoxin accumulation (P<0.01) in one or
more field locations.
4. Discussion
Resistance to Aspergillus flavus infection and aflatoxin
production in maize is a multi-gene controlled trait (Davis
and Williams, 1999; Paul et al., 2003; Warburton et al.,
2011a). Previous proteomic comparisons of constitutivelyWorld Mycotoxin Journal 9 (2)
expressed embryo and endosperm proteins between
resistant and susceptible maize genotypes determined
that the expression of certain storage, stress-related, and
antifungal proteins (such as the pathogenesis-related
protein 10 [PR-10] and the 14 kDa TI) was associated
with aflatoxin-resistance (Chen et al., 2002, 2007). The
association of stress-related and antifungal proteins with
maize aflatoxin resistance is of particular interest. Recent
studies of the stress-related PR-10 protein through RNAi
gene silencing demonstrated its importance in aflatoxin
resistance (Chen et al., 2010). TI was observed to be highly
expressed in resistant maize lines, but was low or missing
in susceptible lines (Chen et al., 1998). However, no data
exists to date to suggest its direct involvement in maize
resistance to A. flavus.
In the present study, transgenic maize lines were produced
through Agrobacterium-mediated transformation of
immature maize Hi II (A188 × B73, Armstrong et al., 1991)
221
Z.-Y. Chen et al.
4
2
1
0
A96S1-3-1
A96S1-3-2
A96S1-5-1
A96S1-6-2
A96S1-6-4
A96S1-8-4
A96S1-13-2
A96S1-15-2
A96S1-18-5
A96S1-21-1
A96S1-25-1
A96S1-25-3
40917-12
A96S1-1-1
A96S1-1-2
A96S1-1-4
A96S1-3-3
A96S1-8-1
A96S1-8-2
A96S1-8-3
A96S1-25-5
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
3
Figure 3. Real time PCR analysis of trypsin inhibitor (TI) transcript levels in the seedlings of the TI RNAi transgenic lines. Lines
from the left (blue colour) and right (light grey colour) were confirmed positive and negative for transformation, respectively. The
line 40917-12 (green colour, middle) is the non-transformed control included in the study. The values on the Y-axis are the mean
expression levels of TI relative to the control (HT40917-12) after first normalising to the internal control of 18S.
Table 2. Summary of trypsin inhibitor (TI) expression at transcript and protein levels in the RNAi silenced transgenic maize lines.
Line name
Transgenic1
Transcript abund.2
TI protein abund.3
A96S1-3-1
A96S1-3-2
A96S1-5-1
A96S1-6-2
A96S1-6-4
A96S1-8-4
A96S1-13-2
A96S1-15-2
A96S1-18-5
A96S1-21-1
A96S1-25-1
A96S1-25-3
A96S1-1-1
A96S1-1-2
A96S1-1-4
A96S1-3-3
A96S1-8-1
A96S1-8-2
A96S1-8-3
A96S1-25-5
40921-9
40917-12
yes
yes
yes
yes
yes
yes
yes
yes
yes
yes
yes
yes
no
no
no
no
no
no
no
no
no
no
3.02cd
0.78ef
0.53fg
0.16hi
0.54fg
0.37g
0.74f
4.29c
0.35g
0.32gh
1.22ef
0.12i
2.79cd
91.63a
0.39g
0.31gh
0.57fg
15.79b
0.25gh
1.94d
ND
1.0ef
83%
87%
76%
55%*
61%*
27%*
35%*
32%*
82%
15%*
91%
24%*
96%
88%
93%
79%
78%
83%
86%
77%
91%
100%
1 Transformation was verified through PCR with PR10if (GTTCAACTTCACCTCAG G) and PR10ir (AAGCTGAACGGCATGACT) primers corresponding
to the CmR region spanned by the intron using the genomic DNA isolated from seedling leaves of the corresponding transgenic lines.
2 The mean trypsin inhibitor transcript abundance in seedling leaf tissue was determined using real time PCR, and is expressed as relative to that in the
control Hi II line (HT40917-12) after first normalising to the internal control of 18S.
3 The mean reduction of 14 kDa trypsin inhibitor proteins was relative to the level of TIs in the Hi II control (HT40917-12) determined through gel analysis
of three protein extractions after normalising the samples for loading and staining variations. * indicates the reduction was significant (at P=0.05). ND =
not determined.
222
World Mycotoxin Journal 9 (2)
Trypsin inhibitor protein is required for maize aflatoxin resistance
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
HT 40917-12 X B73
HT 40921-9 X B73
A96S1-3-1
A96S1-3-2
A96S1-1-1
A96S1-1-2
A96S1-5-1
A96S1-18-5
A96S1-1-4
A96S1-3-3
A96S1-6-2
A96S1-25-1
A96S1-8-1
A96S1-8-2
A96S1-6-4
A96S1-8-4
A96S1-8-3
A96S1-25-5
A96S1-13-2
A96S1-15-2
A96S1-21-1
A96S1-25-3
Figure 4. Proteomic comparison of the 14 kDa trypsin inhibitor (TI) proteins in the kernels of two non-transformed controls (top,
left panel) with eight lines that were negative for transformation (left panel) and 12 lines that were positive for transformation
(right panel). The lines in the bottom half of the right panel had significant reduced TI protein levels compared to controls. The
relative abundance of trypsin inhibitor proteins was calculated based on mean normalised volume of all TI protein spots in the
boxed area for each line that was quantified using Progenesis and is summarised in Table 2.
embryos with a TI-RNAi construct. This line can be easily
transformed via Agrobacterium. However, its hybrid genetic
background limited our choice of materials to T1 kernels and
the seedlings developed from these seeds for examination
of the effect of silencing the TI on A. flavus and aflatoxin
accumulation resistance due to that the F2 and F3 seeds
represent a mixture of plants that were non-transgenic,
World Mycotoxin Journal 9 (2)
heterologous, and homogeneous for the transgene. Of
the 66 potential TI RNAi transgenic lines representing 18
independent events, 20 lines representing 10 independent
events were randomly selected to take into account the
potential variation in genetic background and transgene
position effects. These T1 lines were used to determine
whether TI expression affects maize aflatoxin resistance.
223
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
Z.-Y. Chen et al.
Figure 5. Variation in Aspergillus flavus colonisation of RNAi silenced transgenic maize kernels compared to the non-silenced
resistant (MI82) and susceptible (Pioneer 3142) control kernels under Kernel Screening Assay conditions.
224
World Mycotoxin Journal 9 (2)
Trypsin inhibitor protein is required for maize aflatoxin resistance
Table 3. Summary of differences in fungal colonisation and aflatoxin production of the first and second batch transgenic maize
lines compared to known aflatoxin resistant (MI82, R) and susceptible maize line (P3142, S).
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
First batch of 10 lines
Second batch of 10 lines
Line name (genotype) Visual rating2 (0-5)
Aflatoxin (μg/kg)3
Line name (genotype) Visual rating2 (0-5)
Aflatoxin (μg/kg)3
P3142(S)
A96S1-25-3 (+)1
A96S1-21-1 (+)
MI 82 (R)
A96S1-8-4 (+)
A96S1-13-2 (+)
A96S1-3-2 (+)
A96S1-3-3 (-)
A96S1-8-1 (-)
A96S1-25-1 (+)
A96S1-18-5 (+)
A96S1-25-5 (-)
2,607.5 a
1,940.0 ab
1,252.0 bc
689.6 cd
611.2 cd
510.6 cde
323.4 def
213.4 def
186.6 def
154.3 def
130.0 ef
7.1 f
P3142(S)
A96S1-5-1 (+)
A96S1-6-4 (+)
A96S1-1-1 (-)
MI 82 (R)
A96S1-6-2 (+)
A96S1-1-4 (-)
A96S1-8-2 (-)
A96S1-15-2 (+)
A96S1-1-2 (-)
A96S1-3-1 (+)
A96S1-8-3 (-)
11,568 a
6,772 b
2,992 c
2,870 c
1,998 cd
1,494 d
426 e
427 e
205 e
62 e
15 e
12 e
1
2.2 c
2.9 b
4.5 a
1.1 f
1.8 cd
1.6 de
1.1 f
1.4 ef
1.2 f
2.1 c
1.1 f
1.2 f
2.2 a
2.2 a
1.6 bc
1.5 bcd
1.1 de
1.4 bcd
1.0 e
1.6 bc
1.1 de
1.1 de
1.0 e
1.0 e
(+) and (-) indicate positive and negative for transformation verified through PCR, respectively.
2 Fungal colonisation was rated after Aspergillus flavus inoculation and incubation at kernel screening assay conditions for 7 days as follows: 0 = mycelium
visible on kernel surface but no sporulation; 1 = 1 to 20%; 2= 21 to 40%; 3 = 41 to 60%; 4 = 61 to 80%; and 5 = 81 to 100% of the kernel surface covered
by conidiophores bearing conidia. The means of ratings for individual kernels from two repeated experiments was presented here. The means within the
column followed by the same letter were not significantly different based on Waller-Duncan K-ratio t test (at P=0.05).
3 Combined means from two experiments are presented. Aflatoxin data were log transformed to equalise variations before statistical analysis using SAS.
The values within the column with the same letters were not significantly different as determined using Duncan’s Multiple Range test (P=0.05).
Table 4. Summary of mapping results with polymorphic markers found within or linked to the gene encoding the trypsin inhibitor
protein.
Pop. in which analysed1
Marker name
Type2
Bin
# positive
associations3
Test statistic
value4
Assoc. Panel
Assoc. Panel
Assoc. Panel
Assoc. Panel
MpB, MpVa, MpT, MpNC
MpB, MpVa, MpT, MpNC
MpB
MpB, MpVa, MpT, MpNC
MpNCn MpT
MpB
MpT
MpVa
S2_160151277
S2_160151308
S2_160151358
S2_160151389
umc1065
bnlg371
bnlg108
umc1028
umc1079
mmc0271
umc1637
tripinh
SNP
SNP
SNP
SNP
SSR
SSR
SSR
SSR
SSR
SSR
SSR
RFLP
2.06
2.06
2.06
2.06
2.06
2.05
2.04
2.05
2.06
2.07
2.06
2.06
1
0
1
2
2
2
1
1
1
1
3
2
P<0.05
P<0.05
P<0.05
LOD>2.4
LOD>3.2
LOD>6.4
LOD>2.4
LOD>2.4
LOD>7.2
LOD>2.4
LOD>3.4
Test statistic
range5
0.008-0.04
2.5-8.8
3.2-7
2.4-2.8
3.4
1 Polymorphisms were analysed in the association mapping panel of 300 testcrossed lines or one or more F
2:3 mapping populations as described in the
materials and methods.
2 SNP = single nucleotide polymorphism; SSR = simple sequence repeats; RFLP = restriction fragment length polymorphism.
3 Number of significant SNP/trait associations or number of significant QTL effects in a growing environment totaled over mapping populations in which
the marker segregated.
4 P-value (in association tests) or log of the odds (LOD) value (in QTL mapping tests) of the least significant test statistic.
5 Range in P-value (in association tests) or LOD value (in QTL mapping tests) of all significant test statistics.
World Mycotoxin Journal 9 (2)
225
Z.-Y. Chen et al.
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
Correlations were sought among the TI expression at RNA
and protein levels in those lines, and fungal colonisation and
aflatoxin production in those lines under KSA conditions.
The weight of transgenic kernels from different lines
varied significantly and the true TI RNAi transgenic lines
tended to have higher average kernel weight than those
lines that were negative for transformation, indicating that
expression of TI may adversely affect the accumulation
of dry matter in maize kernels. This was not observed in
the silencing of maize PR-10 protein (Chen et al., 2010).
The trade-off between weight and susceptibility seen here
could be the result of a natural selection during evolution.
This also brings up a debatable question on whether
pursuing high yield as our single most important goal in
breeding is a wise choice. Our current breeding practices
may have inadvertently selected against the expression
of some resistance genes, making the high yielding lines
more susceptible to diseases than their ancestral lines. A
better and more balanced breeding strategy may be more
beneficial in the long run for agricultural production and
environmental conservation.
When the target gene expression in the seedling leaf tissue
developed from the germinating kernels was examined
using real time PCR, five (A96S1-6-2, A96S1-8-4, A96S118-5, A96S1-21-1, and A96S1-25-3) of the 12 transgenic
lines showed significant reduction in TI expression, and two
other lines (A96S1-5-1 and A96S1-6-4) showed a smaller
reduction. When examining these lines for TI protein
abundances, seven lines (A96S1-6-2, A96S1-6-4, A96S1-84, A96S1-13-2, A96S1-15-2, A96S1-21-1, and A96S1-25-3)
showed significant reductions. Seven of the transgenic lines
(A96S1-5-1, A96S1-6-2, A96S1-6-4, A96S1-8-4, A96S1-132, A96S1-21-1, and A96S1-25-3) were more susceptible to
A. flavus infection and had more fungal colonisation and/
or aflatoxin production than the non-transgenic controls.
Overall, six of the seven lines that showed significant
reduction in TI protein abundances also showed significant
reduction in host resistance to A. flavus infection. The TI
transcript abundance in all but one (A96S1-13-2) was also
reduced by about 50% or more. These data provide strong
evidence that the expression of TI has a positive impact
on maize resistance to A. flavus infection.
Of the eight lines that were negative for transformation,
three (A96S1-1-4, A96S1-3-3, and A96S1-8-3) were
also found to have significantly reduced TI transcript
abundances. However, none was found to have significantly
less TI protein. When examining changes in aflatoxin
resistance of these eight lines, seven had equal or less
aflatoxin compared to resistant control MI82. These data
further support the hypothesis that TI protein abundance
was important for maize aflatoxin resistance. The only
exception was A96S1-1-1, which was more susceptible
to A. flavus infection compared to other lines that were
226
negative for TI, despite the presence of TI protein in this
line. This same A96S1-1-1 was also the only non-transgenic
line that had significantly higher average kernel weight
than the rest of lines that were negative for transformation.
Further studies will be necessary to determine the cause of
increased susceptibility in A96S1-1-1. Finally, an increased
TI transcript abundance was observed in both transgenic
and non-transgenic lines compared to the Hi II control
(HT40917) (Figure 4/Table 3). It has been reported that
silencing of PR 10 in Medicago truncatula resulted in an
antagonistic induction of other PR proteins (Colditz et al.,
2007). More studies are needed to understand the exact
cause of this increase. One possibility is the integration of
T-DNA into a region in the genomic DNA that suppressed
the TI transcription or its stability. Alternately, somaclonal
variation may have introduced many different mutations
in the different lines.
Fungal colonisation usually correlates well with the aflatoxin
concentrations observed inside inoculated kernels. The
correlation is not perfect, however, and two of the transgenic
lines, (A96S1-21-1 and A96S1-25-1) accumulated less
aflatoxin compared to other lines with similar levels of
fungal colonisation. Previous study (Brown et al., 2001)
has reported maize lines with heavy fungal colonisation
that supported little or no aflatoxin production and vise
versa, possibly resulting from different host resistance
mechanisms in operation or environmental conditions
not supporting the production of aflatoxin by the fungus.
There was a significant QTL over the genomic location of
the trypsin inhibitor gene (hfi1) in maize. The resistant
allele comes from the aflatoxin accumulation resistant
maize line Mp313E, and it is consistent over more than
one location and in two different genetic backgrounds. In
addition, a small QTL in the same region is found from
a different resistant maize line, Mp715. Three SNPs in
the same sequence were weakly associated with aflatoxin
accumulation resistance in a panel of 300 testcrossed maize
lines. The resistant allele was found in only 7 individuals
for SNP 2:160151389, the same 7 individuals for SNP
2:160151358, and 16 individuals (including the same 7)
for SNP 2:160151277. The genomic data support the
conclusions of the RNAi gene silencing results and indicate
that the trypsin inhibitor is playing a role in decreasing
the accumulation of aflatoxin in inoculated maize grown
in field conditions.
In summary, the present study constructed a TI RNAi
gene silencing vector, demonstrated that most of the lines
transformed with this vector had significantly lower levels
of TI expression in the seedling tissues, reduced levels of
TI protein in the transgenic kernels, and supported higher
aflatoxin production. This indicates that the lack of TI
expression significantly reduced maize kernel resistance
to aflatoxin production. This effect was confirmed in
mapping studies. These data support an important role
World Mycotoxin Journal 9 (2)
for TI expression in maize kernel resistance to infection
and subsequent aflatoxin contamination by A. flavus.
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
Supplementary material
Supplementary material can be found online at http://
dx.doi.org/10.3920/WMJ2015.1890.
Figure S1. Visual comparison of 20 randomly selected
trypsin inhibitor RNAi transgenic kernels that were used
in the present study.
Figure S2. Quantitative trait loci centered on the RFLP
marker tripinh designed from within the trypsin inhibitor
DNA sequence and run in the F2:3 mapping population
MpVa.
Table S1. List of peptide sequences obtained through LCMS/MS of those putative trypsin inhibitor protein spots
that showed significant reduction in RNAi transgenic maize
lines.
Acknowledgements
We thank Dr. David A. Lightfoot for critical reviewing of
the manuscript and Nicole Hazard and David Ambrogio for
technical assistance. The authors also thank Drs. Kan Wang
and Bronwyn R. Frame (the Center for Plant Transformation,
Plant Science Institute, Iowa State University, Ames, IA
50011) for providing the pTF102 vector and for their help
in the transformation of the RNAi vector into maize. This
study was supported by USDA cooperative agreement 586435-1-576, USDA ARS Aflatoxin Elimination Workshop
and Louisiana State Soybean and Small Grain Promotion
Board. Published with the approval of the Director of the
Louisiana Agricultural Experiment Station as manuscript
number 2013-240-12902.
References
Armstrong, C.L., Green, C.E. and Phillips, R.L., 1991. Development
and availability of germplasm with high Type II culture formation
response. Maize Genetics Cooperation Newsletter 65: 92-93.
Basten, C.J., Weir, B.S. and Zeng, Z.B., 1999. QTL cartographer. v. 1.13.
North Carolina State University, Raleigh, NC, USA.
Bradbury, P.J., Zhang, Z., Kroon, D.E., Casstevens, T.M., Ramdoss, Y.
and Buckler, E.S., 2007. TASSEL: software for association mapping
of complex traits in diverse samples. Bioinformatics 23: 2633-2635.
Brooks, T.D., Williams, W.P., Windham, G.L., Willcox, M.C. and
Abbas, H.K., 2005. Quantitative trait loci contributing resistance to
aflatoxin accumulation in the maize inbred Mp313E. Crop Science
45: 171-174.
Brown, R.L., Chen, Z.-Y., Menkir, A., Cleveland, T.E., Cardwell, K.,
Kling, J. and White, D.G., 2001. Resistance to aflatoxin accumulation
in kernels of maize inbreds selected for ear rot resistance in West
and Central Africa. Journal of Food Protection 64: 396-400.
World Mycotoxin Journal 9 (2)
Trypsin inhibitor protein is required for maize aflatoxin resistance
Brown, R.L., Cleveland, T.E., Payne, G.A., Woloshuk, C.P., Campbell,
K.W. and White, D.G., 1995. Determination of resistance to aflatoxin
production in maize kernels and detection of fungal colonization
using an Aspergillus flavus transformant expressing Escherichia coli
β-glucuronidase. Phytopathology 85: 983-989.
Campbell, K.W. and White, D.G., 1995. Evaluation of corn genotypes
for resistance to Aspergillus ear rot, kernel infection, and aflatoxin
production. Plant Disease 79: 1039-1045.
Chen, Z.Y., Brown, R.L., Cleveland, T.E., Damann, K.E. and Russin,
J.S., 2001. Comparison of constitutive and inducible maize
kernel proteins of genotypes resistant or susceptible to aflatoxin
production. Journal of Food Protection 64: 1785-1792.
Chen, Z.Y., Brown, R.L., Damann, K.E. and Cleveland, T.E., 2007.
Identification of maize kernel endosperm proteins associated
with resistance to aflatoxin contamination by Aspergillus flavus.
Phytopathology 97: 1094-1103.
Chen, Z.Y., Brown, R.L., Damann, K.E. and Cleveland, T.E., 2010.
PR10 expression in maize and its effect on host resistance against
Aspergillus flavus infection and aflatoxin production. Molecular
Plant Pathology 11: 69-81.
Chen, Z.-Y., Brown, R.L., Demann, K.E. and Cleveland, T.E., 2002.
Identification of unique or elevated levels of kernel proteins in
aflatoxin-resistant maize genotypes through proteome analysis.
Phytopathology 92: 1084-1094.
Chen, Z.Y., Brown, R.L., Lax, A.R., Cleveland, T.E. and Russin, J.S.,
1999. Inhibition of plant-pathogenic fungi by a corn trypsin inhibitor
overexpressed in Escherichia coli. Applied and Environmental
Microbiology 65: 1320-1324.
Chen, Z.Y., Brown, R.L., Lax, A.R., Guo, B.Z., Cleveland, T.E. and
Russin, J.S., 1998. Resistance to Aspergillus flavus in corn kernels
is associated with a 14-kDa protein. Phytopathology 88: 276-281.
Chu, C.C., Wang, C.C., Sun, C.S., Hsu, C., Yin, K.C., Chu, C.Y. and Bi,
F.Y., 1975. Establishment of an efficient medium for anther culture
of rice through comparative experiments on the nitrogen source.
Scientia Sinica 18: 659-668.
Colditz, F., Niehaus, K. and Krajinski, F., 2007. Silencing of PR-10-like
proteins in Medicago truncatula results in an antagonistic induction
of other PR proteins and in an increased tolerance upon infection
with the oomycete Aphanomyces euteiches. Planta 226: 57-71.
Davis, G.L. and Williams, W.P., 1999. QTL for aflatoxin reduction in
maize. Maize Genetics Conference Abstract, Lake Geneva, WI,
USA, p. 41.22.
Diener, U.L., Cole, R.J., Sanders, T.H., Payne, G.A., Lee, L.S. and Klich,
M., 1987. Epidemiology of aflatoxin formation by Aspergillus flavus.
Annual Review of Phytopathology 25: 249-270.
Doerge, R.W. and Churchill, G.A., 1996. Permutation tests for multiple
loci affecting a quantitative character. Genetics 142: 285-294.
Dolezal, A.L., Obrian, G.R., Nielsen, D.M., Woloshuk, C.P., Boston, R.S.
and Payne, G.A., 2013. Localization, morphology and transcriptional
profile of Aspergillus flavus during seed colonization. Molecular
Plant Pathology 14: 898-909.
Dolezal, A.L., Shu, X., OBrian, G.R., Nielsen, D.M., Woloshuk, C.P.,
Boston, R.S. and Payne, G.A., 2014. Aspergillus flavus infection
induces transcriptional and physical changes in developing maize
kernels. Frontiers in Microbiology 5: 384.
227
http://www.wageningenacademic.com/doi/pdf/10.3920/WMJ2015.1890 - Tuesday, October 24, 2017 8:00:59 PM - Queen's University of Belfast IP Address:143.117.16.36
Z.-Y. Chen et al.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E. and Mello,
C.C., 1998. Potent and specific genetic interference by doublestranded RNA in Caenorhabditis elegans. Nature 391: 806-811.
Frame, B.R., Shou, H., Chikwamba, R.K., Zhang, Z., Xiang, C., Fonger,
T.M., Pegg, S.E.K., Li, B., Nettleton, D.S., Pei, D. and Wang, K., 2002.
Agrobacterium tumefaciens-mediated transformation of maize
embryos using a standard binary vector system. Plant Physiology
129: 13-22.
Frame, B.R., Zhang, H., Cocciolone, S.M., Sidorenko, L.V., Dietrich,
C.R., Pegg, S.E., Zhen, S., Schnable, P.S. and Wang, K., 2000.
Production of transgenic maize from bombarded type II callus:
effect of gold particle size and callus morphology on transformation
efficiency. In vitro Cellular and Developmental Biology – Plant
36: 21-29.
Gao, Q.-M., Venugopal, S., Navarre, D. and Kachroo, A., 2011. Low
oleic acid-derived repression of jasmonic acid-inducible defense
responses requires the WRKY50 and WRKY51 proteins. Plant
Physiology 155: 464-476.
Paul, C., Naidoo, G., Forbes, A., Mikkilineni, V., White, D. and
Rocheford, T., 2003. Quantitative trait loci for low aflatoxin
production in two related maize populations. Theoretical and
Applied Genetics 107: 263-270.
Payne, G.A., 1998. Process of contamination by aflatoxin-producing
fungi and their impact on crops. In: Sinha, K.K. and Bhatnagar, D.
(eds.) Mycotoxins in agriculture and food safety. Marcel Dekker,
New York, NY, USA, pp. 279-306.
Pechanova, O., Pechan, T., Williams, W.P. and Luthe, D.S., 2011.
Proteomic analysis of the maize rachis: Potential roles of constitutive
and induced proteins in resistance to Aspergillus flavus infection
and aflatoxin accumulation. Proteomics 11: 114-127.
Reese, B.N., Payne, G.A., Nielsen, D.M. and Woloshuk, C.P., 2011.
Gene expression profile and response to maize kernels by Aspergillus
flavus. Phytopathology 101: 797-804.
Schmale, D.G. and Munkvold, G.P., 2009. Mycotoxins in crops: a threat
to human and domestic animal health. The Plant Health Instructor,
DOI: http://dx.doi.org/10.1094/PHI-I-2009-0715-01.
Gao, X.Q., Brodhagen, M., Isakeit, T., Brown, S.H., Gobel, C., Betran,
J., Feussner, I., Keller, N.P. and Kolomiets, M.V., 2009. Inactivation
of the lipoxygenase ZmLOX3 increases susceptibility of maize to
Aspergillus spp. Molecular Plant-Microbe Interactions 22: 222-231.
Guo, B.Z., Chen, Z.Y., Brown, R.L., Lax, A.R., Cleveland, T.E., Russin,
J.S., Mehta, A.D., Selitrennikoff, C.P. and Widstrom, N.W., 1997.
Germination induces accumulation of specific proteins and
antifungal activities in corn kernels. Phytopathology 87: 1174-1178.
Guo, B.Z., Russin, J.S., Brown, R.L., Cleveland, T.E. and Widstrom,
N.W., 1995. Resistance to aflatoxin contamination in corn as
influenced by relative humidity and kernel germination. Journal
of Food Protection 59: 267-281.
Gura, T., 2000. A silence that speaks volumes. Nature 404: 804-808.
Hsieh, D.P.H., 1989. Potential human health hazards of mycotoxins.
In: Natori, S., Hashimoto, K. and Ueno, Y. (eds.) Mycotoxins
and phycotoxins. Elsevier, Biomedical Press, Amsterdam, the
Netherlands, pp. 69-80.
Huang, Z., White, D.G. and Payne, G.A., 1997. Corn seed proteins
inhibitory to Aspergillus flavus and aflatoxin biosynthesis.
Phytopathology 87: 622-627.
Kebede, H., Abbas, H.K., Fisher, D.K. and Bellaloui, N., 2012.
Shephard, G.S., 2008. Impact of mycotoxins on human health in
developing countries. Food Additives and Contaminants Part A
25: 146-151.
Squire, R.A., 1981. Ranking animal carcinogens: a proposed regulatory
approach. Science 214: 877-880.
Van Ooijen, J.W., 2006. JoinMap® 4, Software for the calculation of
genetic linkage maps in experimental populations. Kyazma BV,
Wageningen, the Netherlands.
Warburton, M.L., Brooks, T.D., Krakowsky, M.D., Shan, X., Windham,
G.L. and Williams, W.P., 2009. Identification and mapping of new
sources of resistance to aflatoxin accumulation in maize. Crop
Science 49: 1403-1408.
Warburton, M.L., Brooks, T.D., Windham, G.L. and Williams, W.P.,
2011a. Identification of novel QTL contributing resistance to
aflatoxin accumulation in maize. Molecular Breeding 27: 491-499.
Warburton, M.L., Williams, W.P., Hawkins, L., Bridges, S., Gresham,
C., Harper, J., Ozkan, S., Mylroie, J.E. and Shan, X., 2011b. A public
platform for the verification of the phenotypic effect of candidate
genes for resistance to aflatoxin accumulation and Aspergillus flavus
infection in maize. Toxins 3: 754-765.
Warburton, M.L., Williams, W.P., Windham, G.L., Murray, S.C., Xu,
Relationship between aflatoxin contamination and physiological
responses of corn plants under drought and heat stress. Toxins
4: 1385-1403.
Kelley, R.Y., Williams, W.P., Mylroie, J.E., Boykin, D.L., Harper, J.W.,
Windham, G.L., Ankala, A. and Shan, X., 2012. Identification of
maize genes associated with host plant resistance or susceptibility
to Aspergillus flavus infection and aflatoxin accumulation. PLoS
ONE 7: e36892.
Lawrence, C.J., Harper, L.C., Schaeffer, M.L., Sen, T.Z., Seigfried, T.E.
and Campbell, D.A., 2008. MaizeGDB: the maize model organism
database for basic, translational, and applied research. International
Journal of Plant Genomics 2008: 496957.
Luo, M., Brown, R.L., Chen, Z.-Y., Menkir, A., Yu, J. and Bhatnagar, D.,
2011. Transcriptional profiles uncover Aspergillus flavus-induced
resistance in maize kernels. Toxins 3: 766-786.
W., Hawkins, L.K. and Duran, J.F., 2013. Phenotypic and genetic
characterization of a maize association mapping panel developed
for the identification of new sources of resistance to Aspergillus
flavus and aflatoxin accumulation. Crop Science 53: 2374-2383.
Widstrom, N.W., McMillian, W.W. and Wilson, D.M., 1987. Segregation
for resistance to aflatoxin contamination among seeds on an ear of
hybrid maize. Crop Science 27: 961-963.
Willcox, M., Davis, G., Warburton, M., Windham, G., Abbas, H.,
Betrán, J., Holland, J. and Williams, W.P., 2013. Confirming
quantitative trait loci for aflatoxin resistance from Mp313E in
different genetic backgrounds. Molecular Breeding 32: 15-26.
Zummo, N. and Scott, G.E., 1989. Evaluation of field inoculation
techniques for screening maize genotypes against kernel infection
by Aspergillus flavus in Mississippi. Plant Disease 73: 313-316.
228
World Mycotoxin Journal 9 (2)
Документ
Категория
Без категории
Просмотров
3
Размер файла
1 634 Кб
Теги
wmj2015, 1890
1/--страниц
Пожаловаться на содержимое документа