close

Вход

Забыли?

вход по аккаунту

?

978-981-10-4801-2 11

код для вставкиСкачать
Exploitation of a KU70-Deficient Mutant
for Improving Gene Deletion Frequency
in Aspergillus niger
Liu-hua Yin, Lan Zhang, Ling Liu, Hongfei Zhang, Li Hou
and De-pei Wang
1 Introduction
Lack of objective functional gene, often referred as targeted gene knockout, is an
essential tool for genetic engineering and reverse genetics [1]. The gene knockout is
developed on the basis of homologous recombination between homologous DNA
and chromosomal DNA, with site specificity. The target fragment can be used to
characterize the genetic stability of chromosomal DNA. The process is mainly to
build a plasmid vector into cells after homologous recombination to achieve the
target gene knockout. This is of great significance for the transformation of
industrial production strains. It is a major obstacle in many industrially important
species such as A. niger.
The repair mechanism of DNA double-strand breaks is mainly HR and NHEJ
[2], both of which are mediated by competitive inhibition [3, 4]. HR repair process
mainly uses the homology of the DNA double-strand to carry out specific recognition, the protein responsible for matching and recombinant protein does not
include the specificity of the base sequence. NHEJ does not require homologous
chromosomes to be a template to repair the broken DNA double strand by connecting the two ends together, which is a powerful repair. Among the different
species, the proportion of HR and NHEJ involved in repair is different. In
eukaryotes, the repair of DSBs is more of the form of NHEJ. We can improve the
efficiency of gene targeting by reducing the NHEJ pathway [5]. Through a large
number of studies we affirm that KU protein [6] with NHEJ pathway has an
important link, by knock out the KU gene to reduce the NHEJ pathway [7]. Ku
protein is a widely located nuclear protein, encoded by the KU gene, which is
L. Yin L. Zhang L. Liu H. Zhang L. Hou D. Wang (&)
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education,
College of Biotechnology, Tianjin University of Science & Technology,
Tianjin 300457, China
e-mail: 15620074987@163.com
© Springer Nature Singapore Pte Ltd. 2018
H. Liu et al. (eds.), Advances in Applied Biotechnology, Lecture Notes
in Electrical Engineering 444, https://doi.org/10.1007/978-981-10-4801-2_11
105
106
L. Yin et al.
widely existed with a variety of biological functions [8] and involved in a number
of important cell metabolism, such as DNA replication, DSBs repair, transcription
regulation [9]. When the kusA gene is destroyed in A. niger, which is a homologous
sequence of ku70, the gene-targeting frequency of the gene-deleted strain was
increased to 80% and the sensitivity to UV and X-Ray increased as well [10].
In this study, we deleted the ku70 gene fragment to inhibit its non-homologous
end of the link and improved the transformation efficiency of Agrobacterium
tumefaciens in A. niger. It can be a convenient way for us to study the filamentous
fungi in Genetic Engineering.
2 Materials and Methods
2.1
2.1.1
Material
Strains, Plasmids and Primers
Aspergillus niger CGMCC 10142, a hyper-producer of citric acid, was obtained
from Tianjin Key Laboratory of Fermentation Microbiology, Tianjin, China.
Escherichia coli DH5a was used as the host for the propagation of plasmid DNA,
while Agrobacterium tumefaciens AGL1 was employed as T-DNA donor for fungal
transformation [11] (Table 1). Primers in this study were listed in Table 2.
2.1.2
Reagents, Media and Cultivation
Hygromycin B was purchased from Solarbio institute, Beijing, China. Bleomycin
and Geneticin were bought from Sigma institute, USA. All of the chemicals used
were of analytical grade.
The bacterial strains were cultivated in LB medium at 37 °C (DH5a) or 28 °C
(AGL1), respectively [12]. Potato dextrose agar (PDA) was used for the growth of A.
niger [13]. Liquefied corn medium, provided by RZBC Co., Ltd., Rizhao, Shandong,
China, was used for citric acid fermentation, the content of initial total sugar was 179.8
g L−1, the mineral element: FeSO47H2O 30 mg L−1, CaCl22H2O 10 mg L−1,
MnCl24H2O 7 mg L−1, CuSO45H2O 0.3 mg L−1, MgSO47H2O 0.3 g L−1,
ZnSO47H2O 10 mg L−1, KH2PO4 0.3 g L−1, yeast extract 0.004% (w/v). Fungal
culture medium (FCM) was composed of 30 g L−1 sucrose, 10 mg L−1 FeSO47H2O,
0.5 g L−1 KCl, 0.5 g L−1 MgSO47H2O, 1 g L−1 K2HPO4, and 20 g L−1 agar powder
(pH 5.0–6.0).
Exploitation of a KU70-Deficient Mutant for Improving …
107
Table 1 Strains and plasmids in this study
Strains and plasmids
Relevant genotype/description
Aspergillus niger
CGMCC10142
E.coli DH5a
Agrobacterium
tumefaciens AGL1
pGM-T
pBackZero-T
p60
p80
p10
p74
p81
p90
2.2
Ampr
Ampr
BlerHYGrKanr
E. coli DH5a-A. tumefaciens
shuttle vector,
HYGrKanr, containing the deletion
cassette of ku70
E. coli DH5a-A. tumefaciens
shuttle vector,
HYGrKanr, containing the deletion
cassette of cs
E. coli DH5a-A. tumefaciens
shuttle vector,
HYGrKanr, containing the deletion
cassette of aox1
E. coli DH5a-A. tumefaciens
shuttle vector,
G418rKanr, containing the deletion
cassette of tpsA
E. coli DH5a-A. tumefaciens
shuttle vector,
G418rKanr, containing the deletion
cassette of pd
Source
Tianjin University of Science
and Technology
Tianjin University of Science
and Technology
Tianjin University of Science
and Technology
Purchased from Tiangen, China
Purchased from Takara, Japan
Tianjin University of Science
and Technology
This work
This work
This work
This work
This work
Construction of the ku70 Deletion Cassette
Construction of the ku70 deletion cassette and PCR verification were shown in
Figs. 1 and 2, respectively. The deletion cassette containing the hygromycin
resistance gene (hyg) was designed to replace the ku70 gene coding region
according to a method of double-crossover homologous recombination. Briefly, a
955-bp fragment of the 5′-flanking region (the deletion cassette left arm) and
another 874-bp fragment of the 3′-flanking region (the deletion cassette right arm)
were amplified from the genomic DNA using primer pairs P3/P4 and P5/P6
(Table 2), respectively, and served as homologous arms for the recombination
event. The right arm fragment and plasmid p60 were respectively digested with PstI
and HindIII, the two linear fragments were linked by T4 DNA ligase to create the
intermediate plasmid p80-R. The left arm fragment and plasmid p80-R were
108
L. Yin et al.
Table 2 The primers used for the experiment
Primers
Sequence (5′ ! 3′)
Descriptions
pI
pII
TTAAACGATTCCACAACATTCTACT
CCTAATGCTCTTCGTTTTGACAT
p1
p2
GTCGACGTTAACTGATATTG
TTTGCCCTCGGACGAGTGCT
p3
GGGGTACCGAGCTCGAGGCCAAACAGGCAGAC
p4
CGGGATCC AGATCTATCGCTGGGCAATGACTTG
p5
AACTGCAG TCTAGAGCAGCTGCCGAAGGGA
p6
CCCAAGCTT TCTAGATAACTGTACATCGCCT
p7
p8
p9
p10
CCGCCGATGTCCGCATACTG
TCATTGTACGCATACCGTTA
CTCACCGAGGCAGTTCCATAGG
GCCCGATGCGCCAGAGTTGTTT
Upstream primer of ku70
Downstream primer of
ku70
Upstream primer of hyg
Downstream primer of
hyg
Upstream primer of left
deletion cassette
Downpstream primer of
left deletion cassette
Upstream primer of right
deletion cassette
Downstream primer of
right deletion cassette
For verification of the
2684 bp of the ku70 gene
Upstream primer of G418
Downstream primer of
G418
digested with KpnI and BamHI, respectively; the two linear fragments were linked
by T4 DNA ligase to generate the deletion plasmid p80 (5′-flanking region-hyg
gene-3′-flanking region).
2.3
Electroporation Parameters
The constructed plasmid p80 was transformed into A. tumefaciens AGL1 by electric
transformation [14]. The electroporational parameters were as follows: plasmid
1.2 lL, A. tumefaciens 70 lL, electric shock 0.5 s at 2.5 kV.
2.4
Infection Experiment
The A. tumefaciens AGL1 that carried plasmid 80 were cultured untill OD600
reached 0.8 in induction medium. Then, 200 lL A. tumefaciens AGL1 and 200 lL
A. niger spores were added on 0.45 lm cellulose acetate membrane which placed in
induction medium with 200 lmol/L AS and 100 lg/L Kanamycin. The co-culture
was performed in 25 °C for 48 h [15, 16].
Exploitation of a KU70-Deficient Mutant for Improving …
109
Fig. 1 Construction schematic diagram of plasmid p80
3 Results and Discussions
3.1
Cloning of the ku70 Gene from A. niger CGMCC 10142
The genomic DNA of A. niger was extracted from mycelia that grew on PDA media
by the cetyltrimethylammonium bromide method [17]. The BLAST method was
used to survey the whole genomic sequences of A. niger CBS 513.88 to search for
an ku70-like gene [18, 19]. PCR was carried out to amplify the homolog of the
ku70-like gene using a pair of pI and pII primers. The protocol and results were
shown in Table 3 and Fig. 2, respectively.
3.2
Sequence Alignment
The result of ku70 gene purification recovery was shown in Fig. 3. The DNA
sequences of ku70 gene of A. niger CGMCC 10142 was assigned with GenBank
110
L. Yin et al.
Fig. 2 The PCR test of left arm, right arm, full length and restriction enzyme analysis of p80.
a M 5000 bp DNA marker; lane 1 PCR product was amplified by using p80 as template with the
primers P3/P4; lane 2 PCR product amplified by using p80 as template with the primers P5/P6;
b M 10,000 bp DNA marker; lane 1 PCR product was amplified by using p80 as template with the
primers P3/P6; c M 10,000 bp DNA marker; lanes 1,2 restriction enzyme analysis of p80 amplified
with KpnI/HindIII
Table 3 The reaction system of PCR using rTaq polymerase
Reaction system
Total volume
10 buffer
d NTPs (2.5 mmol/L)
Template
Primer I (10 lmol/L)
Primer II (10 lmol/L)
rTaq (5 U/lL)
ddH2O
Condition
50 lL
5 lL
4 lL
1 lL
2 lL
2 lL
0.5 lL
33 lL
Step 1 (1 cycle)
95 °C
5 min
Step 2 (30 cycles)
95 °C
60 °C
72 °C
30 s
30 s
3 min
Step 3 (1 cycle)
72 °C
10 min
Step 4 (1 cycle)
4 °C
30 min
accession numbers XM001396771 and the homeology was 99.75% between the
augmented sequence after identified by sequencing appraisal and nucleotide
sequence reported in Genbank.
Exploitation of a KU70-Deficient Mutant for Improving …
111
Fig. 3 The PCR product of ku70 gene
3.3
Analysis of Phylogenetic Tree of ku70 Gene
A Neighbor-Joining tree was constructed from the amino acids sequences encoding
ku70 gene of the same 22 fungi of filamentous fungi and sacchromyces classes
which were used to construct phylogenetic tree of ku70 gene (Fig. 4). According to
the phylogenetic tree, Aspergillus niger strain CGMCC10142 have the closest
relation compare to the other strains incorporated filamentous fungi and saccharomyces. The distantly regarding ku70 gene from saccharomyces was showed the
farthest relation are Candida ablicans strain SC 5314 and Pichia farinosa strain
CBS 7064.
3.4
Screening of the ku70 Deletion Mutant
The plasmid p80 was transformed into A. niger CGMCC 10142 by AMAT, and 35
transformants were obtained on CM plates containing 250 lg/mL hygromycin. All
of transformants were verified by PCR of deletion cassette gene and hygromycin
resistant in Fig. 5. The results demonstrated that transformant was the ku70 gene
knockout mutant therefore named as Dku70.
3.5
The Genetic Stability of Transformant
15th passage culture from the transformant was amplified in Fig. 6. The result
indicated that Dku70 was genetically stable.
112
L. Yin et al.
Fig. 4 Phylogenetic tree constructed from ku70 gene amino acid sequence
Fig. 5 The PCR test of A. niger transformation of ku70 deletion. M 5000 bp DNA marker; lane 1
negative control; lane 2 3240 bp PCR product amplified by using Dku70 as template wit, the
primers P1/P7; lane 3 2375 bp PCR product amplified by using Dku70 as template with the
primers P2/P8; lane 4 1400 bp fragment of hyg amplified by using p80 as template with
the primers P1/P2; lane 5 1400 bp fragment of hyg amplified using transformant as template with
the primers P1/P2
Exploitation of a KU70-Deficient Mutant for Improving …
113
Fig. 6 The PCR test of A. niger transformation. M 5000 bp DNA marker; lane 1 PCR product
amplified by using the genome of 1st Dku70 subculture as template with the primers P1/P7; lane 2
PCR product amplified by using the genome of 10th Dku70 subculture as template with the
primers P1/P7; lane 3 PCR product amplified by using the genome of 15th Dku70 subculture as
template with the primers P1/P7; lane 4 PCR product amplified by using the genome of 10th
Dku70 subculture as template with the primers P2/P8; lane 5 PCR product amplified by using the
genome of 15th Dku70 subculture as template with the primers P2/P8
Table 4 The number of
transformants by different
plasmids infect A. niger
3.6
CGMCC 10142
Dku70
Efficiency (%)
p10
p74
p81
p90
8
12
50
18
31
72.2
39
56
43.5
31
47
51.6
Reduce-Representation Genome Sequencing
The result of Reduce-Representation Genome Sequencing showed that the hyg had
a unique insertion site in 68,064 at An15. It is consistent within the locus of
CBS513.88 ku70 gene (GenBank No: ANI_1_420134) in 679,864–682,385.
3.7
The Efficiency of Different Plasmids Affected by ku70
Gene Insertion
The strain of Dku70 and original strain CGMCC 10142 were infected by plasmids
p10, p74, p81 and p90 which preserved in our laboratory, respectively. The
transformants were selected in the plate form containing 150 lL/mL hyg after
incubating 72 h at 35 °C. The numbers of transformants were counted in Table 4,
and partial transformants verification as shown in Fig. 7. The result indicated that
strain Dku70 had a higher efficiency comparing with original strain CGMCC 10142.
114
L. Yin et al.
Fig. 7 The PCR test of A. niger transformation. a M 5,000 bp DNA marker; lane 1–8 1400 bp
fragment of hyg amplified by using the genome of CGMCC Dcs as template with the primers
P1/P2; b M 5000 bp DNA marker; lane 1–19 1400 bp fragment of hyg amplified by using the
genome of CGMCC Daox 1 as template with the primers P1/P2; c M 5000 bp DNA marker; lane
1–17 550 bp fragment of G418 amplified by using the genome of CGMCC Dtps A as template
with the primers P9/P10; d M 5000 bp DNA marker; lane 1–15 550 bp fragment of G418
amplified by using the genome of CGMCC Dpd as template with the primers P9/P10
4 Conclusion
Aspergillus niger CGMCC10142 was successfully transformed by Agrobacterium
tumefaciens with plasmid p80 and the hereditary stability of the transformant Dku70
was confirmed by subculture verification. A. niger CGMCC10142 and Dku70 were
transformed by different plasmids respectively. It is indicated that all of genes
segment insertion efficiency were dramatically improved by 40–80% compared
with the original strain. The plasmids p10 and p74 (hyg) have a higher deletion
efficiency of 50 and 72.2% respectively in Dku70 compared with A. niger CGMCC
10142. Meanwhile, the deletion efficiency conducted with plasmids p81 and p90
(G418) was improved 43.5 and 51.6% respectively. The results showed that G418
was a beneficial marker for inserting target fragment in A. niger.
References
1. Meyer V (2008) Genetic engineering of filamentous fungi-progress, obstacles and future
trends. Biotechnol Adv 26:177–185
2. Shrivastav M, De Haro LP, Nickoloff JA (2008) Regulation of DNA double-strand break
repair pathway choice. Cell Res 18:134–147
Exploitation of a KU70-Deficient Mutant for Improving …
115
3. Krappmann S (2007) Gene targeting in filamentous fungi: the benefits of impaired repair.
Fungal Biol Rev 21:25–29
4. Kück U, Hoff B (2010) New tools for the genetic manipulation of filamentous fungi. Appl
Microbiol Biotechnol 86:51–62
5. Weld RJ, Plummer KM, Carpenter MA, Ridgway HJ (2006) Approaches to functional
genomics in filamentous fungi. Cell Res 16:31–44
6. Walker JR, Corpina RA, Goldberg J (2001) Structure of the Ku heterodimer bound to DNA
and its implications for double-strand break repair. Nature 412:607–614
7. Lieber MR (2010) The mechanism of double-strand DNA break repair by the nonhomologous
DNA end-joining pathway. Ann Rev Biochem 79:181–211
8. Daley JM, Palmbos PL, Wu D et al (2005) Nonhomologous end joining in yeast. Ann Rev
Genet 39:431–451
9. Ninomiya Y, Suzuki K, Ishii C et al (2004) Highly efficient gene replacements in Neurospora
strains deficient for nonhomologous end-joining. Proc Natl Acad Sci U S A 101:12248–
12253
10. Meyer V, Arentshorst M, El-Ghezal A et al (2007) Highly efficient gene targeting in the
Aspergillus niger kusA mutant. J Biotechnol 128:770–775
11. Lazo GR, Stein PA, Ludwig RA (1991) A DNA transformation-competent Arabidopsis
genomic library in Agrobacterium. Nat Biotech 9:963–967
12. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor
13. Atlas RM (1997) Handbook of microbiological media, 2nd edn. CRC Pr I Llc, pp 283–284
14. Haq I, Ali S, Iqbal J (2003) Direct production of citric acid from raw starch by Aspergillus
niger. Process Biochem 38:921–924
15. de Groot MJA, Bundock P, Hooykaas PJJ et al (1998) Agrobacterium tumefaciens-mediated
transformation of filamentous fungi. Nat Biotechnol 16:839–842
16. Sugui JA, Chang YC, Kwon-Chung KJ (2005) Agrobacterium tumefaciens-mediated
transformation of Aspergillus fumigatus: an efficient tool for insertional mutagenesis and
target gene disruption. Appl Environ Microbiol 71:1798–1802
17. Shao YC, Ding YD, Zhao Y et al (2009) Characteristic analysis of transformants in T-DNA
mutation library of Monascus ruber. World J Microbiol Biotechnol 25(6):989–995
18. Yuan LX, van der Kaaij RM, van den Hondel CA et al (2008) Aspergillus niger genome-wide
analysis reveals a large number of novel alpha-glucan acting enzymes with unexpected
expression profiles. Mol Genet Genomic 279:545–561
19. Cheng Z, Xue YF, Zhang YL et al (2009) Recombinant expression and characterization of
Thermoanaerobacter tengcongensis thermostable a-glucosidase with regioselectivity for
high-yield isomaltooligosaccharides synthesis. J Microbiol Biotechnol 19:1547–1556
Документ
Категория
Без категории
Просмотров
2
Размер файла
286 Кб
Теги
978, 981, 4801
1/--страниц
Пожаловаться на содержимое документа