close

Вход

Забыли?

вход по аккаунту

?

00015458.2017.1394673

код для вставкиСкачать
Acta Chirurgica Belgica
ISSN: 0001-5458 (Print) (Online) Journal homepage: http://www.tandfonline.com/loi/tacb20
Upregulation of VEGFR1 in a rat model of
esophagogastric anastomotic healing
Laura Christina Landes, Daniel Drescher, Evangelos Tagkalos, Peter P.
Grimminger, René Thieme, Boris Jansen-Winkeln, Hauke Lang & Ines Gockel
To cite this article: Laura Christina Landes, Daniel Drescher, Evangelos Tagkalos, Peter P.
Grimminger, René Thieme, Boris Jansen-Winkeln, Hauke Lang & Ines Gockel (2017): Upregulation
of VEGFR1 in a rat model of esophagogastric anastomotic healing, Acta Chirurgica Belgica, DOI:
10.1080/00015458.2017.1394673
To link to this article: http://dx.doi.org/10.1080/00015458.2017.1394673
Published online: 25 Oct 2017.
Submit your article to this journal
Article views: 2
View related articles
View Crossmark data
Full Terms & Conditions of access and use can be found at
http://www.tandfonline.com/action/journalInformation?journalCode=tacb20
Download by: [University of Florida]
Date: 28 October 2017, At: 20:45
ACTA CHIRURGICA BELGICA, 2017
https://doi.org/10.1080/00015458.2017.1394673
ORIGINAL PAPER
Upregulation of VEGFR1 in a rat model of esophagogastric anastomotic
healing
Laura Christina Landesa, Daniel Dreschera,b, Evangelos Tagkalosa, Peter P. Grimmingera
Rene Thiemec , Boris Jansen-Winkelna,c , Hauke Langa
and Ines Gockela,c
,
Downloaded by [University of Florida] at 20:45 28 October 2017
a
Department of General, Visceral and Transplantation Surgery, University Medical Center of Mainz, Mainz, Germany; bDepartment
of General and Visceral Surgery, St. Juliusspital, W€urzburg, Germany; cDepartment of Visceral, Transplant, Thoracic and Vascular
Surgery, University Medical Center of Leipzig, Leipzig, Germany
ABSTRACT
ARTICLE HISTORY
Introduction: Anastomotic leakage after gastrointestinal surgery is a significant cause of
morbidity and mortality. Esophagogastric and colorectal anastomoses are vulnerable to leakage. Extended knowledge of growth factors and their receptors is needed to understand
anatomic healing.
Methods: The expression pattern of vascular growth factor receptor (VEGFR1-3), epidermal
growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFRa/b) and keratinocyte growth factor receptor (KGFR) were analyzed by semiquantitative-PCR in the rat
intestinal tract and in esophagogastric anastomosis 5d after surgery.
Results: VEGFR1, VEGFR2, EGFR, KGFR and PDGFRa expression was observed throughout the
intestinal tract including esophagus, stomach, small bowl and colon. VEGFR3 was not found
in gastric samples and PDGFRb expression was not detected in the small bowl.
Semiquantitative analyses of the VEGFR1, PDGFRa and EGFR expression in esophagogastric
anastomotic tissues revealed a 2-fold upregulation of the VEGFR1 in gastric samples, while
no change was observed in the esophageal anastomotic side.
Conclusion: Our results revealed a distinct expression pattern of the investigated growth factor receptors in rat intestinal tract. Showing higher expression levels of growth factor receptors at the gastric anastomotic tissue at the fifth postoperative day suggests a different
contribution of the gastric and the esophageal side to the anastomotic healing.
Received 20 September 2017
Accepted 9 October 2017
Introduction
Anastomotic leakage after gastrointestinal surgery
is a significant cause of morbidity and mortality
[1–3]. Compared to small bowel or colon anastomoses, leakage of colorectal and esophagogastric
anastomoses are more frequent and have been
reported in up to 30% [1–6]. Anastomotic complications increase the risk of reoperation, prolonged
interventional treatment, subsequent anastomotic
stenosis formation and fistula [7–9]. The major factors influencing the healing of intestinal anastomoses are neoangiogenesis and collagen deposition
[8,10]. Growth factors, in particular VEGFs, play a
crucial role in stimulating angiogenesis, which
involves multiple processes including vasodilatation, endothelial cell migration and proliferation, as
well as basement membrane degradation [11].
Studies in well-established experimental rodent
models had shown a positive impact of administrated growth factors on anastomotic healing
CONTACT Ines Gockel
ines.gockel@medizin.uni-leipzig.de
Vascular Surgery, Liebigstraße 20, D-04103 Leipzig, Germany
These authors supervised this manuscript jointly.
ß 2017 The Royal Belgian Society for Surgery
KEYWORDS
Gastrointestinal anastomosis; growth factor
receptors; anastomotic
leakage; wound healing;
experimental surgery;
stomach
[12–15]. To our knowledge, no methodic investigations on the expression profile of a brought range
of growth factor receptors in the gastrointestinal
tract of the rat is available. Our aim was to investigate the expression pattern of growth factor receptors and its postoperative alteration in an
established rat model for esophagogastric anastomosis [16].
Material and methods
Tissue source and storage
Tissue samples of 12 Brown-Norway rats (mean
weight: 320 g; Charles River, Sulzfeld, Germany)
were obtained from preliminary studies on esophagogastric anastomosis in rats and used for methodic investigations on the expression profile of
growth factor receptors in esophageal, gastric,
small bowel and colonic samples prior to surgery
[16]. Specimen consisted of a 2 cm segment of
University Medical Center Leipzig, Department of Visceral, Transplant, Thoracic and
Downloaded by [University of Florida] at 20:45 28 October 2017
2
L. C. LANDES ET AL.
esophageal, gastric, small bowel or colonic tissues
have been used. Samples were shock-frozen in
liquid nitrogen and then stored at 80 C in cryovials for consecutive RNA-isolation as well as for
RT- and PCR-analysis.
Further, tissue samples of 18 animals, undergoing standardized operative procedures for
esophagogastric anastomosis as reported before
[16], were gained for the analyses of the postoperative expression pattern of growth factor receptors. An upper median laparotomy was done and
the peritoneal cavity was opened. Gastrolysis was
carried out by dissection of the stomach greater
curvature. Short gastric vessels and the left gastric artery and vein were clipped, whereas the
right gastric and gastroepiploic arteries and veins
were preserved. Gastric tube formation was performed after resection of the proximal lesser
curvature, forestomach and the esophagogastric
junction. End-to-end intra-abdominal esophagogastric anastomosis was performed and the abdomen was closed. At the fifth postoperative day, a
relaparotomy was performed and the intraabdominal aspects related to the preoperative
surgical procedure were assessed, including the
esophagogastric anastomosis and the gastric
tube. Specimen consisted of a 5 mm peri-anastomotic segment of esophageal and gastric tissue.
Samples were shock-frozen in liquid nitrogen and
then stored at 80 C in cryovials for consecutive
semiquantitative PCR analysis. The postoperative
growth
factor
receptor expression
levels
were compared with the previous taken
tissue samples (preoperative). Thereby, we took
attention to sample the esophageal and gastric
tissue from the same anatomical location in both
trials.
All animal studies were carried out in strict
accordance with the recommendations for the care
and use of animals and were approved by the local
ethics committee of the ‘Landesuntersuchungsamt
Rheinland-Pfalz’, Koblenz, Germany (reference
number: G 10-1-002).
Qualitative RT and PCR analysis
Total RNA was isolated from specimen using a single-step extraction method (RNeasy Mini Kit,
Qiagen, Hilden, Germany) according to the manufacturer’s protocol. RNA integrity was assessed by
electrophoresis on 1.8% agarose gels. RNA concentrations were determined by spectrophotometry at
A260 and purity was assessed by measuring the
RNA to DNA ratio at A260/280.
The oligonucleotide sequences used for amplification of growth factor receptors are shown in
Table 1. Aliquots of 1.0 mg total RNA were reverse
transcribed for 1 h at 37 C, using oligo-dt-nucleotides and the Omniscript RT kit (Qiagen, Hilden,
Germany). For the amplification of target genes,
1 ml cDNA was used for amplification by the Taq
PCR Core Kit (Qiagen, Hilden, Germany). PCRs were
subjected to defined cycles of denaturation,
annealing and extension (Table 2). PCR products
were separated by gel electrophoresis, visualized
under UV light (Gel Doc EZ Imager, Bio-Rad,
Munich, Germany) and quantified by densitometry
using Image Lab 3.0.1 (Bio-Rad, Munich, Germany).
Semiquantitative PCR analysis
For semiquantitative analysis, relative expression of
VEGFR1, EGFR and PDGFRa were normalized by
referring to the density of the respective beta-actin
band. Results are shown as target gene/beta-actin
ratios.
Hematoxylin-eosin staining
Esophageal and gastric specimens were fixed using
4% paraformaldehyde at day 5. After dehydration
and embedding in paraffin, 5 mm slides were
trimmed and a conventional hematoxylin–eosin
staining was performed.
Statistical analysis
VEGFR1, EGFR and PDGFRa/beta-actin densitometric ratio values in preoperative and 5d postoperative tissue samples from esophagic and gastric
Table 1. Oligonucleotide sequences used for the amplification of growth factor receptors.
Sequence 50 ! 30
Primer
sz-actin 400
VEGFR1
VEGFR2
VEGFR3
PDGFRa
PDGFRb
EGFR
KGFR
Sense
Antisense
atcgtgggccgcctaggcac
caagggactctacacttgtc
actcagacgacacagatacc
ctgaggcagaatatcagtctggag
atccattgtctctgtccccc
tcaacagcctctacaccacc
gtactgcactgccatcagtg
tccatcaaccacacctacc
ctcatagatgggcacagtgtg
ccgaatagcgagcagatttc
acatctcacccatcccaac
agatgctcatacgtgtagttgtcc
gctctcacacatttaccacacc
actcctcagaaactcctcatcc
ccgaggagcataaaggatta
cgaaactgttacctgtctcc
Table 2. Number of cycles for semiquantitative PCR analysis
for VEGFR1, EGFR and PDGFRa in esophageal and gastric
samples.
Number of cycles
Primer
VEGFR-1
PDGFR-a
EGFR
Temperature ( C)
Esophagus
Stomach
55,5
60,5
56
31
31
33
35
35
38
ACTA CHIRURGICA BELGICA
ansastomotic tissues was performed by an analysis
of variance (two-way ANOVA corrected for multiple
comparisons by Bonferroni) to assess whether is an
statistical significant difference between the
growth factor receptor expression levels in esophageal an gastric tissue samples at both investigated
time points (preoperative and 5-d postoperative).
All analyses were done using GraphPad Prism 6.0
(GraphPad Software Inc. San Diego, CA). All data
are expressed as mean ± SEM.
Results
Downloaded by [University of Florida] at 20:45 28 October 2017
Qualitative mRNA expression of growth factors
receptors
VEGFR1-3, EGFR, PDGFRa/b and KGFR expression in
rat esophageal, gastric, small bowel or colonic tissue samples revealed varying occurrence (Table 3).
VEGFR1, VEGFR2, EGFR, PDGFRa and KGFR
expression was observed in esophageal, gastric,
small bowel and colonic samples. VEGFR3 only
showed an expression in esophageal, small bowel
and colonic samples, not in gastric samples.
PDGFRb expression was seen in esophageal and
gastric samples.
3
trend toward upregulation of all three growth factor receptors in the gastric samples at the 5th postoperative day (Figure 1). The mRNA levels of the
VEGFR1 in gastric anastomotic tissue was significantly higher compared to its preoperative gastric
tissue (gastric tissue: 0.19 ± 0.043 vs. 0.39 ± 0.061
and esophageal tissue: 0.16 ± 0.013 vs. 0.13 ± 0.039)
(p ¼ .014) and to postoperative esophageal anastomotic tissue (p ¼ .031) (Figure 1(a)). However, not
significant the expression of PDGFRa and EGFR
tend to be increased in gastric anastomotic tissue
(Figure 1(b,c)).
HE-staining of esophageal and gastric
anastomotic sides
To determine tissue integrity the esophageal
(Figure 2(a–c)) and gastric part of the anastomotic
sides were stained with hematoxylin–eosin. No disturbances in tissue morphology could be observed,
suggesting functional anastomoses and no signs
of apoptosis or neuroses could be determined
(Figure 2(b–d)).
Discussion
Semiquantitative mRNA expression of VEGFR1,
EGFR and PDGFRa in rat model of
esophagogastric anastomotic tissue
Semiquantitative analyses of the expression profile
of VEGFR1, EGFR and PDGFRa showed a distinct
Table 3. Qualitative expression of growth factor receptors
in gastrointestinal tract.
Growth Factor Receptor
VEGFR-1
VEGFR-2
VEGFR-3
PDGFR-a
PDGFR-b
EGFR
KGFR
Esophagus
Stomach
Small bowel
Colon
þ
þ
þ
þ
þ
þ
þ
þ
þ
n.d.
þ
þ
þ
þ
þ
þ
þ
þ
n.d.
þ
þ
þ
þ
þ
þ
n.d.
þ
þ
þ ¼ expression; n.d.¼ no expression detected.
This is the first study analyzing the expression profile of a series of growth factor receptors in the
intestinal tract of the rat (Table 2).
Vascular endothelial growth factor receptors
(VEGFR1-3)
Vascular endothelial growth factors (VEGF-A,
VEGF-B, VEGF-C, VEGF -D and VEGF-E) are secreted
by many cell types that are involved in anastomotic
healing, for example, macrophages, endothelial
cells, fibroblasts or smooth muscle cells [10,11,17].
Their high-affinity receptors VEGFR1 (Flt-1) and
VEGFR2 (KDR) are members of the receptor tyrosine
Figure 1. VEGFR1, PDGFa and EGFR mRNA expression in the gastroesophageal anastomoses. An esophagogastric anastomosis
had been performed in Brown-Norway rats and esophageal (eso) and gastric anastomotic samples had been recovered at the
5th postoperative day. The expression pattern of VEGFR1 (a), PDGFRa (b) and EGFR (c) was analyzed by semiquantitative RTPCR. The expression of VEGFR1 was significant increased in postoperative gastric anastomotic tissue compared to post-operative
esophageal anastomotic tissue (a, p ¼ .014) and to preoperative gastric tissue (b, p ¼ .031). All data are shown as mean ± SEM.
(neso ¼ 4; ngastric ¼ 7; two-way ANOVA corrected for multiple comparisons by Bonferroni).
Downloaded by [University of Florida] at 20:45 28 October 2017
4
L. C. LANDES ET AL.
kinase (RTK) family, containing extracellular ligandbinding and intracellular catalytic domains [11,17].
Receptor binding of VEGF results in RTK-autophosphorylation and a consecutive Mek1/2 and Erk1/2
activation via Raf or Ras [11,17]. VEGF induces
chemotaxis, angiogenesis and the expression of
matrix metalloproteinases [10,11,17]. VEGFR3 mediates primarily lymphangiogenesis [11].
In this study, we reveal VEGFR1-3 expression in
rat’s esophagus and VEGFR2 in the stomach of the
rat. VEGFR1 and 2 expressions were detected in
colonic samples confirming previously reported
data [18,19]. Furthermore, we detected an expression of VEGFR1 and 2 in the rat’s small bowel.
Investigations in animal anastomotic healing
models using localized VEGF gene therapy or local
administrated VEGF showed increased angiogenesis with subsequently improved anastomotic healing [10,14,20]. These findings encourage the
application of VEGF in rats to enhance anastomotic
healing promoting angiogenesis and the expression of matrix metalloproteinases.
Platelet-derived growth factor receptors
(PDGFRa/b)
Platelet-derived growth factor homo or heterodimeric isoforms (PDGF-AA, PDGF-AB, PDGF-BB,
PDGF-CC and PDGF-DD) are major paracrine and
autocrine growth factors for certain cells including
smooth muscle cells, fibroblasts and endothelial
cells [17,21]. External stimuli, such as low oxygen
tension, increase synthesis. Classical target cells
express both a- and b-receptors. Activation of
PDGF receptors by ligand-binding leads to stimulation of cell growth, chemoattraction and to
changes in cell shape and synthesis of matrix constituents [17,21]. Semiquantitative PCR analyses
confirmed temporal expression of PDGF-BB in a
colonic wound-healing model in rats from the 3rd
to the 7th, reaching a basal levels 2 weeks postoperative [22].
We detected expression of PDGFRa in the stomach, small bowel and colon as described before
[22–24]. PDGFRb was found in esophageal and gastric samples. As to the best of our knowledge, no
data were available describing PDGFRa/b expression in the rat esophagus before.
Epidermal growth factor receptor (EGFR)
EGFR, a tyrosine kinase transmembrane protein, is
particularly expressed on epithelial and mesenchymal cells [17,25]. Intrinsic kinase activation is mediated by related ligands, including EGF,
transforming growth factor-a (TGFa) and heparinbinding growth factor (HB-EGF) [17]. The integrated biological responses to EGFR signaling
include mitogenesis, cell motility, maintenance and
repair [25]. We could confirm EGFR expression in
Figure 2. Histology of the esophageal and gastric side of gastroesophageal anastomoses in rats. Hematoxylin–eosin staining
has been performed at esophageal (a and c) and gastric (b and d) specimens at the 5th postoperative day. Two representative
animals are shown (animal 1 (a and b) animal 2 (c and d). Both show a normal tissue pattern without any signs of apoptosis or
necrosis as well in the esophageal as in the gastric part of the gastroesophageal anastomoses. (Bars – 100 mm).
ACTA CHIRURGICA BELGICA
esophageal, gastric and colonic samples in accordance to prior reports [15,26,27]. But we also
detected EGFR expression in small bowel tissue of
the rat.
5
future trials and to investigate pharmaceuticals to
improve esophagogastric anastomotic healing to
overcome the frequent anastomotic leakage in
esophagogastric surgery to reduce morbidity and
mortality [3,4,6].
Downloaded by [University of Florida] at 20:45 28 October 2017
Keratinocyte growth factor receptor (KGFR)
KGFR (FGFR2 IIIb), a splicing transcript variant of
fibroblast growth factor receptor 2 (FGFR2), is
expressed by many types of epithelial cells and
activated by its respective ligands (FGF-1, FGF-3,
FGF-7 (KGF) and FGF-10 that are predominantly
synthesized by mesenchymal cells [13,17,28].
Activation leads to receptor endocytosis and intracellular accumulation of receptor–ligand complexes [28]. KGFR-mediated processes include
reparative mechanisms, such as mucosal repair
improved wound closure and increased matrix
deposition [13,26].
We detected KGFR expression in rat small intestine. Previously, KGFR expression was described in
the esophagus and stomach [12] and in the
colon, analyzing the influence of keratinocyte
growth factor on the healing of left-sided colon
anastomoses. [13]
Semiquantitative expression of VEGFR1, EGFR
and PDGFRa mRNA in rat model of
esophagogastric anastomotic healing
Previously reported data showed a positive impact
of VEGF, PDGF and EGF expression on anastomotic
healing in animal models, promoting angiogenesis,
cell repair mechanisms and synthesis of matrix
constituents [14,15,23]. The usage of localized
over-expression models for anastomotic healing,
resulting in improved angiogenesis, tissue blood
flow and anastomotic strength, will prevent systemic admiration of recombinant VEGF, but ethical
and safety issues need to be resolved before translation in humans [29]. In our study, the corresponding receptors VEGFR1, EGFR and PDGFRa,
respectively, revealed distinct expression in
esophageal and gastric samples. Our findings had
shown an upregulation of VEGFR1 in gastric anastomotic tissues confirming experimental investigations that revealed increased VEGFR1. However,
there was no change in receptor expression at all
in esophagic anastomotic tissue in pre- and postoperative samples.
However, as we analyzed growth factor expression in an animal model there are certain limitations for the translation in humans. Nevertheless,
the animal model presented here can be used for
Conclusions
For the first time, we are able to present an expression profile of a series of growth factor receptors
in the rat intestine. Our results reveal an expression
of VEGFR1, VEGFR2, VEGFR3, PDGFRa/sz and KGFR
in the rat intestine. These results describe an
experimental model for gastrointestinal anastomotic healing in rats. In particular, expression of
VEGFR1 in esophageal and gastric tissue and its
post-operative upregulation in gastric anastomotic
tissue suggest a positive impact and a superior
role of the gastric tissue in anastomotic wound
healing.
Disclosure statement
There are no conflicts of interest or research funding concerning this study. All authors disclose any sponsorship or
financial arrangement relating to their research.
ORCID
Peter P. Grimminger
http://orcid.org/0000-0002-18599213
Ren
e Thieme
http://orcid.org/0000-0002-0537-3979
Boris Jansen-Winkeln
http://orcid.org/0000-0002-39969391
Hauke Lang
http://orcid.org/0000-0001-9303-2148
Ines Gockel
http://orcid.org/0000-0001-7423-713X
References
[1]
[2]
[3]
[4]
Bruce J, Krukowski ZH, Al-Khairy G, et al. Systematic
review of the definition and measurement of anastomotic leak after gastrointestinal surgery. Br J Surg.
2001;88:1157–1168.
van't Sant HP, Weidema WF, Hop WCJ, et al.
Evaluation of morbidity and mortality after anastomotic leakage following elective colorectal surgery
in patients treated with or without mechanical
bowel preparation. Am J Surg. 2011;202:321–324.
Walther B, Johansson J, Johnsson F, von HCS, et al.
Cervical or thoracic anastomosis after esophageal
resection and gastric tube reconstruction: a prospective randomized trial comparing sutured neck
anastomosis with stapled intrathoracic anastomosis.
Ann Surg. 2003;238:803–812. discussion 812–814.
Crestanello JA, Deschamps C, Cassivi SD, et al.
Numbers and letters correspond to the affiliation list.
Click to expose these in author workspaceet al.
Selective management of intrathoracic anastomotic
6
L. C. LANDES ET AL.
[5]
[6]
[7]
[8]
[9]
Downloaded by [University of Florida] at 20:45 28 October 2017
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
leak after esophagectomy. J Thorac Cardiovasc Surg.
2005;129:254–260.
Eberl T, Jagoditsch M, Klingler A, et al. Risk factors
for anastomotic leakage after resection for rectal
cancer. Am J Surg. 2008;196:592–598.
van Heijl M, van Wijngaarden AKS, Lagarde SM, et al.
Intrathoracic manifestations of cervical anastomotic
leaks after transhiatal and transthoracic oesophagectomy. Br J Surg. 2010;97:726–731.
Genzini T, D'Albuquerque LA, Miranda MP, de Scafuri
AG, et al. Intestinal anastomoses. Rev Paul Med.
1992;110:183–192.
Stumpf M, Klinge U, Wilms A, et al. Changes of the
extracellular matrix as a risk factor for anastomotic
leakage after large bowel surgery. Surgery.
2005;137:229–234.
van Heijl M, Gooszen JA, Fockens P, et al. Risk factors
for development of benign cervical strictures after
esophagectomy. Ann Surg. 2010;251:1064–1069.
Enestvedt CK, Thompson SK, Chang EY, et al. Clinical
review: Healing in gastrointestinal anastomoses, part
II. Microsurgery. 2006;26:137–143.
Bao P, Kodra A, Tomic-Canic M, et al. The role of vascular endothelial growth factor in wound healing.
J Surg Res. 2009;153:347–358.
Cui Y, Urschel JD, Petrelli NJ. The effect of keratinocyte growth factor-2 on esophagogastric anastomotic wound healing in rats. Int J Surg Investig.
1999;1:307–309.
Egger B, Tolmos J, Procaccino F, et al. Keratinocyte
growth factor promotes healing of left-sided colon
anastomoses. Am J Surg. 1998;176:18–24.
Ishii M, Tanaka E, Imaizumi T, et al. Local VEGF
administration enhances healing of colonic anastomoses in a rabbit model. Eur Surg Res.
2009;42:249–257.
Sakallioglu AE, Yagmurlu A, Dindar H, et al.
Sustained local application of low-dose epidermal
growth factor on steroid-inhibited colonic wound
healing. J Pediatr Surg. 2004;39:591–595.
Drescher DG, Vogt J, Gabriel M, et al. Model of
wound healing for esophagogastric anastomoses in
rats. Eur Surg Res. 2012;48:194–199.
Barrientos S, Stojadinovic O, Golinko MS, et al.
Growth factors and cytokines in wound healing.
Wound Repair Regen. 2008;16:585–601.
Escribano M, Molero L, Lopez-Farre A, et al. Aspirin
inhibits endothelial nitric oxide synthase (eNOS) and
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
Flk-1 (vascular endothelial growth factor receptor-2)
prior to rat colon tumour development. Clin Sci.
2004;106:83–91.
Fordjour L, D'Souza A, Cai C, et al. Comparative
effects of probiotics, prebiotics, and synbiotics on
growth factors in the large bowel in a rat model of
formula-induced bowel inflammation. J Pediatr
Gastroenterol Nutr. 2010;51:507–513.
Enestvedt CK, Hosack L, Winn SR, et al. VEGF
gene therapy augments localized angiogenesis
and promotes anastomotic wound healing: a pilot
study in a clinically relevant animal model.
J Gastrointest Surg. 2008;12:1762–1770. discussion
1771–1772.
Heldin CH, Westermark B. Mechanism of action and
in vivo role of platelet-derived growth factor. Physiol
Rev. 1999;79:1283–1316.
Buckmire MA, Parquet G, Greenway S, et al.
Temporal expression of TGF-beta1, EGF, and PDGFBB in a model of colonic wound healing. J Surg Res.
1998;80:52–57.
Slomiany BL, Piotrowski J, Czajkowski A, et al. Gastric
mucosal EGF and PDGF receptor expression with
ulcer healing by ebrotidine. Am J Gastroenterol.
1994;89:894–897.
Sukhotnik I, Mogilner JG, Pollak Y, et al. PDGF-alpha
stimulates intestinal epithelial cell turnover after
massive small bowel resection in a rat. Am J Physiol
Gastrointest Liver Physiol. 2012;302:G1274–G1281.
Wells A. EGF receptor. Int J Biochem Cell Biol.
1999;31:637–643.
Wang QS, Sabourin CL, Bijur GN, et al. Alterations in
transforming growth factor-alpha and epidermal
growth factor receptor expression during rat esophageal tumorigenesis. Mol Carcinog. 1996;15:144–153.
Xiao ZQ, Majumdar AP. Increased in vitro activation
of EGFR by membrane-bound TGF-alpha from gastric
and colonic mucosa of aged rats. Am J Physiol
Gastrointest Liver Physiol. 2001;281:G111–G116.
Marchese C, Mancini P, Belleudi F, et al. Receptormediated endocytosis of keratinocyte growth factor.
J Cell Sci. 1998;111:3517–3527.
Enestvedt CK, Hosack L, Hoppo T, et al. Recombinant
vascular endothelial growth factor165 gene therapy
improves anastomotic healing in an animal model of
ischemic esophagogastrostomy. Dis Esophagus.
2012;25:456–464.
Документ
Категория
Без категории
Просмотров
2
Размер файла
1 886 Кб
Теги
2017, 00015458, 1394673
1/--страниц
Пожаловаться на содержимое документа