close

Вход

Забыли?

вход по аккаунту

?

j.ijbiomac.2017.10.110

код для вставкиСкачать
G Model
ARTICLE IN PRESS
BIOMAC-8405; No. of Pages 6
International Journal of Biological Macromolecules xxx (2017) xxx–xxx
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules
journal homepage: www.elsevier.com/locate/ijbiomac
Polyoma small T upregulates the expression of cytoskeletal proteins
in mammalian cells during mitosis
Irfana Reshi a,1,2 , Zarka Sarwar b,1,2 , Sameer Ahmed Bhat a , Syed Qaaifah Gillani b ,
Misbah Shah b , Khalid Majid Fazili a,∗ , Shaida Andrabi b,∗
a
b
Department of Biotechnology, University of Kashmir, India
Department of Biochemistry, University of Kashmir, India
a r t i c l e
i n f o
Article history:
Received 10 May 2017
Accepted 16 October 2017
Available online xxx
Keywords:
Polyoma small T
Mitotic arrest
Cytoskeletal elements
Mitosis
Nocadazole
a b s t r a c t
Mammalian cells expressing murine polyoma small T antigen are known to undergo prolonged mitotic
arrest followed by extensive cell death. However, the detailed mechanism of this process is not fully
understood. While studying the mechanism related to small T induced mitotic arrest in mammalian
cells, we observed that the expression of various cytoskeletal proteins was unusually altered in polyoma
small T expressing cell line. Since most of the cytoskeletal proteins are reoriented during mitosis and are
involved in spindle formation, so it was pertinent to investigate the expression of these genes in PyST
expressing cell line. In this study, we evaluated the expression of tubulin, vinculin and actin. We report
that polyoma small T antigen leads to upregulation of tubulin and vinculin in a time dependent manner
with tubulin expression being most significantly affected. Intriguingly, we demonstrate that dividing
cells normally change the expression of these proteins during mitotic progression. The alteration in
cytoskeletal elements specifically occurs during mitosis as cells arrested in replicative phase did not
show any change. Together these results reveal that the protein levels of tubulin and vinculin do not
remain constant throughout cell cycle but change during mitosis and in polyoma small T expressing
cells.
© 2017 Elsevier B.V. All rights reserved.
1. Introduction
Polyoma small T antigen (PyST) is a 22 kDa protein and is one of
the three early antigens of polyoma virus. Polyoma virus belongs to
the family of DNA tumor viruses known as “polyomavirdae”. These
are named so because of their ability to induce tumors in wide variety of animal species. The genome of polyoma virus encodes two
sets of genes: “early” and “late”. The early genes, called as “T antigens”, consist of large T, middle T and small T, which are mainly
involved in virus mediated pathogenesis. On the other hand, the
late genes VP1, VP2 and VP3 code for structural proteins which
make the capsid of the viral particles [1,2]. The T antigens of polyoma virus are known to interact with a number of host cellular
proteins that are essential for the proliferation of these virions
∗ Corresponding authors.
E-mail addresses: fazili@kashmiruniversity.ac.in (K.M. Fazili),
shaida.andrabi@uok.edu.in (S. Andrabi).
1
Co-authors.
2
These authors equally contributed to this work.
[3]. Large T of polyoma virus binds to and inactivates Retinoblastoma protein (pRb), leading to the abrogation of G1 /S checkpoint
and promotion of cell cycle [4]. Polyoma middle T binds to phosphatidylinositol kinase (PI3 Kinase) and protein phosphatase 2A
(PP2A) to promote cellular transformation [5–7]. Similarly, polyoma small T (PyST) antigen is known to interact with a number of
cellular proteins like heat shock proteins (HSPs), PP2A and some
elements of cytoskeleton. When overexpressed, it induces severe
mitotic arrest followed by apoptosis in both mouse (e.g. NIH3T3) as
well as human (e.g. U2OS) cell lines, a phenomenon called “mitotic
catastrophe”. This property of PyST depends upon its interaction
with Protein Phosphatase 2A (PP2A) [8]. PP2A is a cellular serine
threonine phosphatase and its inactivation is essential for dividing
cells to enter into mitosis [9]. However, the detailed mechanism of
polyoma small T induced mitotic arrest and apoptosis is not well
understood.
In an attempt to explore the mechanism of PyST induced mitotic
arrest and apoptosis in mammalian cells, we observed that the
expression of some cytoskeletal proteins increased considerably
during mitosis. Our studies show that protein expression of tubu-
https://doi.org/10.1016/j.ijbiomac.2017.10.110
0141-8130/© 2017 Elsevier B.V. All rights reserved.
Please cite this article in press as: I. Reshi, et al., Int. J. Biol. Macromol. (2017), https://doi.org/10.1016/j.ijbiomac.2017.10.110
G Model
BIOMAC-8405; No. of Pages 6
ARTICLE IN PRESS
I. Reshi et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx
2
lin and vinculin was significantly upregulated in stably expressing
PyST U2OS cells. Among them, tubulin was most prominently
affected showing several fold increase in its protein expression.
Moreover, arresting PyST expressing cells in G1 /S phase profoundly
decreased the PyST induced mitotic phenotype and also stabilized
the expression of these target proteins in the host cells. We therefore report that polyoma small T upregulates the expression of
some cytoskeletal proteins specifically during mitosis.
was followed by real time PCR using ‘BioRad Advanced Universal
SYBR Green mix’. The PCR was performed with the following primer
pairs: Tubulin: forward, 5 -TTGGCCAGATCTTTAGACCAGACAACreverse,
5 CCGTACCACATCCAGGACAGAATC3 ;
Vin3 ,
culin:
forward,
5 -TCAGATGAGGTGACTCGGTTGG3 ,
reverse,
5 -GGGTGCTTATGGTTGGGATTCG3 ;
Actin:
5 -TTAGTTGCGTTACACCCTTTC3 ,
reverse,
5 forward,
ACCTTCACCGTTCCAGTTT- 3 . The reactions and protocols were set
according to the manufacturer’s instructions.
2. Materials and methods
3. Results
2.1. Materials
Stably expressing inducible PyST cell line in U2OS (human
osteosarcoma) designated as pTREX/PyST was already available in
our laboratory and has been previously described [10]. Doxycycline,
rabbit monoclonal anti-HA and mouse monoclonal anti-tubulin
antibodies, protease and phosphatase inhibitors were purchased
from Sigma-Aldrich. Anti-actin, anti-vinculin and secondary antibodies (DyLight 680 and DyLight 800) for LICOR imaging system
were obtained from Cell Signaling Technology (CST). cDNA synthesis kit ‘iScriptTM ’, “Sso AdvancedTM Universal SYBR Green
Supermix” and Bradford reagent were purchased from BioRad.
Drugs (nocodazole, aphidicolin, etoposide, hydroxyurea) were
purchased from Calbiochem (now Merck Millipore). Dulbecco’s
Modified Eagle’s Medium (DMEM), fetal bovine serum, penicillin/streptomycin and trypsin were obtained from Invitrogen
(now Thermo Fisher Scientific).
2.2. Methods
2.2.1. Western blotting
Expression of PyST in U2OS stable cell line was induced for different time periods by adding 20 ␮g/ml doxycycline to the cell
culture medium. After induction, cells were harvested and lysed
using RIPA lysis buffer (50 mM Tris chloride, NaCl 150 mM, 10%
Glycerol, NP40 1%, EDTA 2 mM and 0.5% Sodium deoxycholate)
containing protease and phosphatase inhibitors. Following centrifugation at 12000 × g, 6xSDS-sample buffer was added to the
supernatants of these cell lysates followed by denaturation at
100◦ C for 5 min. Protein amounts were estimated by Bradford assay
and equal amounts of proteins were loaded on SDS-PAGE. The
resolved proteins were transferred onto nitrocellulose membranes.
The blots were blocked with 5% non-fat dry milk for 1 h and incubated with corresponding primary antibodies. This was followed
by washing the blots three times using 1x TBS-T (NaCl 13.7 mM,
Tris 20 mM, pH 7.4, Tween-20 0.05%) before and after adding the
secondary antibodies. Finally, the blots were subjected to detection using LICOR imaging system. The quantification of bands was
done by using Image J software and analysis was done by student’s
paired t-test.
2.2.2. Cell culture
Cells were grown and maintained in standard cell culture
conditions in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FBS and 1% penicillin/streptomycin. Whenever
desired, induction of protein expression was done by adding doxycycline at 20 ␮g/ml concentration to the pTREX/PyST cell culture
medium.
2.2.3. Real time quantitative PCR
RNA extraction was done by phenol/chloroform method as
per the instructions of the manufacturer (Trizol solution, Invitrogen/Thermo Fisher Scientific). RNA was quantified by using
NanodropTM and equal amounts of RNA were used for cDNA synthesis. iScriptTM cDNA synthesis kit was used to amplify cDNAs. This
3.1. Polyoma small T expression upregulates protein levels of
tubulin and vinculin in time dependent manner
Stably expressing polyoma small T antigen kept under
inducible promoter system (Tet ON) in osteosarcoma (U2OS) cells
(pTREX/PyST) was already present in lab [8]. While studying the
mechanism related to polyoma small T antigen induced mitotic
arrest in these cells, we observed frequent discrepancies in the protein levels of the some cytoskeletal proteins. We were keen to see
whether this alteration in expression of these proteins was related
to polyoma small T expression. For this purpose, stably expressing polyoma small T U2OS cells (pTREX/PyST) were seeded in 6 cm
culture dishes. Doxycycline (20 ␮g/ml) was used to induce the
expression of PyST for different time periods: 16, 32 and 48 hours.
Results showed that following doxycycline addition, expression
of PyST led to the concomitant increase in the protein levels of
some cytoskeletal proteins in a time dependent manner (Fig. 1A–F).
Among these target proteins, tubulin expression was most prominently affected by PyST expression (p < 0.001) followed by vinculin
(p < 0.001), while as actin was modestly affected if at all (N.S indicating non-significant). To confirm equal loading, blots were stained
with Ponceau S and quantified by using Image J software.
3.2. Change in expression of cytoskeletal proteins is not at
transcriptional level
Since PyST cell line showed a maximum increase in the expression of these proteins at 48 h of induction, so we were interested
to see whether this alteration was at the transcriptional or translational level. To confirm this, PyST expression was induced for 48 h
by the addition of doxycycline, while non-induced cells were taken
as controls. RNA was isolated from these two cell lines and used
for real time quantitative PCR. The results clearly indicated that the
expression of cytoskeletal proteins tubulin, actin and vinculin was
not changed at RNA level (Fig. 2). Therefore, it can be concluded
that PyST increases the expression of these target genes at protein
levels only. This might be most likely due to enhanced translation
and/or post-translational stabilization of these proteins.
3.3. Increase in the levels of cytoskeletal proteins was reversed by
arresting PyST expressing cells at G1 /S checkpoint
We were eager to see if PyST induced change in the protein
levels of cytoskeletal proteins is specifically because of the entry
and/or arrest of PyST expressing cells in mitosis. If it is so, then
preventing these cells from entering into mitotic phase should
reverse the increase of cytoskeletal protein levels in these cells. To
test that, we used different cell cycle inhibitors in PyST expressing
cells. DNA replication inhibitors like etoposide (1.25 ␮M), aphidicolin (5 ␮M) and hydroxyurea (1 mM) were added for about 40 h to
arrest PyST expressing cells in replicative (S) phase. PyST expression was concomitantly induced for 40 h by doxycycline addition
while as non-induced PyST cells were used as controls. Cells were
visualized by microscopy and the absence of cell rounding, which
Please cite this article in press as: I. Reshi, et al., Int. J. Biol. Macromol. (2017), https://doi.org/10.1016/j.ijbiomac.2017.10.110
G Model
BIOMAC-8405; No. of Pages 6
ARTICLE IN PRESS
I. Reshi et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx
3
Fig. 1. Polyoma small T (PyST) expression significantly enhances the expression of tubulin and vinculin: U2OS cells stably expressing polyoma small T were induced for PyST
expression with doxycycline (20 ␮g/ml) for different time points (16–48 h). Cells were harvested at indicated time points and cell lysates were run on 10% SDS PAGE and
subjected to Western blotting using specific antibodies as shown. Western blots showing increasing expression of: (A) tubulin p < 0.001 and (C) vinculin p < 0.001 whereas
actin showed non-significant change in its protein expression (E) actin p = N.S, non-significant. Ponceau S was used for staining the nitrocellulose membrane to confirm
equal loading of all samples. (B, D, F) Quantification of the intensity of bands for polyoma small T and the cytoskeletal proteins is represented graphically against each figure.
Results are shown as the mean ± SD (standard deviation) of band intensities quantified from three different experiments using Image J software. Student’s paired t-test was
performed for statistical relevance.
is an indication of cells undergoing mitosis, in drug treated cells
confirmed that PyST expressing cells were prevented from entering into mitosis by arresting them in S phase (Fig. 3). Interestingly,
in contrast to the PyST expressing but untreated cells, the increase
in protein levels of tubulin and vinculin expressions was reversed
when cells were treated with inhibitors and hence prevented from
entering into mitosis (p < 0.001) (Fig. 3B-C). This observation led us
to the conclusion that PyST induced expressional change of these
cytoskeletal proteins is dependent on its ability to arrest cells in
mitosis.
3.4. Cells normally increase the levels of cytoskeletal proteins
during mitosis
Fig. 2. Relative quantification of vinculin, tubulin and actin by real time q-PCR:
Total cellular RNA was isolated from control (-Dox) and PyST expressing (+Dox) cells
by Trizol method and used for quantitative real time PCR for vinculin, tubulin and
actin using specific primers against each gene. Stably expressing PyST cells showed
non-significant (N.S) change in expression of these three target genes at RNA level
even after 48 h of PyST expression following doxycycline addition. Statistical bars
represent mean ± SD of three different experiments (SD, standard deviation).
We also inquired whether increased expression of these reference proteins is specific to PyST mediated mitotic induction/arrest
or is a general phenomenon that occurs during mitosis. To answer
this question, we arrested control U2OS cells with nocodazole
(50 nM), a microtubule destabilizing agent that is often used to
arrest cells in mitosis. This treatment was done for different time
periods in the same manner as we did with PyST expression by the
addition of doxycycline. Consistent with the PyST expressing cell
line, the results showed time dependent increase in the protein levels of tubulin and vinculin in nocodazole arrested cells (p < 0.05),
while actin levels were again not affected much. The increase in
Please cite this article in press as: I. Reshi, et al., Int. J. Biol. Macromol. (2017), https://doi.org/10.1016/j.ijbiomac.2017.10.110
G Model
BIOMAC-8405; No. of Pages 6
ARTICLE IN PRESS
I. Reshi et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx
4
Fig. 3. Arresting cells in G1 /S phase prevents increase in protein levels of cytoskeletal elements by PyST: pTREX/PyST cell line was induced by doxycycline addition for
40 h in presence of different replication inhibiting drugs (etoposide 1.25 ␮M, aphidicolin 5 ␮M and hydroxyurea 1 mM). (A) Microscopy showing rounding up of cells was
prevented when PyST expressing cells were treated with different G1 /S phase inhibitors as indicated (bottom panel) as compared to control (top panel). (B) Western blot
showing increased expression of cytoskeletal proteins; vinculin (p > 0.001) and tubulin (p > 0.001) after induction of PyST expression at 40 h time point (+Dox) as compared to
control/uninduced cells (-Dox). Increase in the expression of these proteins in presence of PyST expression (+Dox) was not seen when these cells were treated with inhibitors
like etoposide, aphidicolin and hydroxyurea as indicated in the figure. Ponceau S staining was used to confirm equal loading of proteins in different lanes. (C) Graphical
representation of the results showing the mean ± SD of band intensities from three different experiments estimated by Image J software. Student’s paired t-test was used to
perform statistical relevance.
protein levels of tubulin and vinculin was seen upto 32 h in these
experiments after which the overall cellular protein levels were
decreased. This was probably due to inhibitor induced toxicity that
resulted in cell death, which was also apparent by microscopy
(Fig. 4).
4. Discussion
The pathogenesis of viruses in the host cells/organisms is generally attributed to the interaction between viral antigens and host
proteins due to which the physiology of the host cell or organism gets changed [11,12]. Small T antigen of polyoma virus is also
known to interact with a number of host cellular proteins leading to
prolonged mitotic arrest followed by cell death. Herein, we report
that small T antigen of polyomavirus leads to alteration in expression of some cytoskeletal proteins. To our knowledge this is the
first study to report the impact of polyoma small T expression on
cytoskeletal protein levels. In this study, we evaluated the expression of three candidates; actin, tubulin and vinculin in polyoma
small T expressing cell line (pTREX/PyST). Our findings revealed
that the expression of tubulin and vinculin was upregulated in
PyST expressing cells. The change in expression of these proteins
was mainly due to PyST expression as there was no alteration in
the expression of these proteins in non-induced cells. The change
in protein expression was time dependent and increased with
time. Our results also suggest that variation in expression of these
cytoskeletal elements was restricted to mitotic phase only as blocking PyST expressing cells in G1 /S phase using inhibitors, etoposide,
aphidicolin and hydroxyurea, largely reversed the altered expression of these genes. We also monitored the expression of tubulin,
vinculin and actin at RNA levels in polyoma small T expressing cell
line. It was apparent that there was almost no change in expression of these target genes at transcriptional levels. This shows that
polyoma small T alters the expression of its target genes only at
protein levels, indicating that this change might be at translational
and/or post-translational levels. The effect on cytoskeletal proteins
in presence of small T expression is not entirely surprising because T
antigens are known to interact with and affect the organization and
dynamics of cytoskeletal elements in host cells. It has been already
reported that small T antigen of Merkel cell polyomavirus promotes destabilization of microtubules in association with stathmin
(a microtubule associated protein) [13]. Similarly, the association
Please cite this article in press as: I. Reshi, et al., Int. J. Biol. Macromol. (2017), https://doi.org/10.1016/j.ijbiomac.2017.10.110
G Model
BIOMAC-8405; No. of Pages 6
ARTICLE IN PRESS
I. Reshi et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx
5
Fig. 4. Change in expression of cytoskeletal elements during mitosis: U2OS cells were arrested in mitosis with nocadazole (50 nM) treatment for 16–48 h. Cells were harvested
at indicated time points after nocodazole treatment. Cell lysates were run on SDS-PAGE and used for Western blotting, using antibodies against each protein as indicated
in Fig. 4. (A) Western blotting showing a significant increase in the expression of vinculin and tubulin. Ponceau S staining of nitrocellulose membrane was used to confirm
equal protein loading. (B) Graph showing fold increase in cytoskeletal protein expression (p < 0.05) following treatment of cells with inhibitor as shown in panel A. Bands
were quantified using Image J software. Results are shown as the mean ± SD of band intensities of three different experiments. Student’s paired t-test was used to perform
statistical analysis.
of polyoma middle T with cytoskeletal proteins like actin, tubulin
and vimentin has already been reported [14]. While these studies
point out towards the importance of interaction of these viral proteins with cellular cytoskeleton, our studies with small T antigen
indicate that this viral protein influences the expression of these
proteins as well. Several viral proteins of tumor viruses lead to the
tumorigenesis of their host cells, which involve transformation,
invasion and metastasis [15,16]. These processes require extensive rearrangement of the cytoskeletal proteins in the host cells
[13]. Polyoma small T on the other hand causes mitotic arrest of
mammalian cells. Entry into mitosis also requires extensive reorientation of the cytoskeletal proteins which is needed for spindle
formation and mitotic progression [17,18]. Probably for these reasons, polyoma small T expressing cells might need to enhance the
expression of cytoskeletal proteins, and it does so by increasing
translation or stabilization of these proteins.
It is already known that cytoskeletal elements are expressed
constitutively in cells and their expression remains constant
throughout cell cycle [19,20]. Our results however suggest that
expression of some cytoskeletal proteins is upregulated when
cells undergo mitosis. Arresting U2OS cells in mitosis using
nocadazole also indicated that there was an alteration in expression of cytoskeletal proteins in nocadazole arrested cells. Among
these candidates tubulin and vinculin were comparatively more
affected. These findings led to the conclusion that the expression of cytoskeletal proteins does not remain constant throughout
cell cycle but changes during mitosis. It might be probably for
this reason that PyST expression leads to increased expression of
microtubules and other cytoskeletal elements in the mammalian
host cells. These alterations in cytoskeletal proteins probably
enable PyST expressing cells to sustain the demands and dynamics of mitotic regulation. Our results therefore indicate that the
cytoskeletal proteins may not be universally suited to be used as
loading controls in Western blotting. This is more important for
investigators studying mitotic regulation, as the results may be
subjected to misinterpretation while using these proteins as loading controls. For such experiments, alternative methods for loading
controls (e,g Ponceu S or any other protein that may not change
during these events) should be explored.
Funding
This study was supported by grants from the Department of
Biotechnology, Government of India through Ramalingaswami Fellowship, CREST Fellowship, Project BT/PR2283/AGR/36/692/2011,
Project
BT/PR5743/BRB/10/1100/2012,
Project
BT/PR13605/MED/30/1525/2015 to Dr Shaida Andrabi, and
DST-FIST grant to the Department of Biochemistry, University of
Kashmir. Fellowships to Irfana Reshi and Misbah Shah by UGC-CSIR
and INSPIRE Fellowships to Sameer A Bhat, Zarka Sarwar and Syed
Qaaifah Gillani by the Department of Science and Technology,
Government of India, are gratefully acknowledged
Author contribution
Irfana Reshi and Zarka Sarwar contributed in designing the
experiments, data interpretation and manuscript writing. Sameer
Ahmad Bhat helped in performing experiments and manuscript
revision. Syed Qaaifah Geelani and Misbah Shah helped in performing some experiments as well as in data analysis. Dr Khalid
Majid Fazili helped in designing experiments, data analysis and
manuscript revisions. Dr Shaida Andrabi helped in experimental design, data interpretation, manuscript writing and providing
resources for the study.
Author declaration
Authors do not have any conflict of interest.
Acknowledgements
We are thankful to Ms. Raihana Maqbool and Mr. Saif Niaz for
providing technical help. We appreciate the assistance provided
by Mr. Mubashir Ahmad for critical evaluation of manuscript and
figures.
References
[1] J.M. Keller, J.C. Alwine, Cell 36 (1984) 381–389.
[2] J.A. DeCaprio, R.L. Garcea, Nature reviews, Microbiology 11 (2013) 264–276.
[3] D.C. Pallas, V. Cherington, W. Morgan, J. DeAnda, D. Kaplan, B. Schaffhausen,
T.M. Roberts, J. Virol. 62 (1988) 3934–3940.
[4] I. Mudrak, E. Ogris, H. Rotheneder, E. Wintersberger, Mol. Cell. Biol. 14 (1994)
1886–1892.
[5] D.C. Pallas, L.K. Shahrik, B.L. Martin, S. Jaspers, T.B. Miller, D.L. Brautigan, T.M.
Roberts, Cell 60 (1990) 167–176.
[6] E.T. Ulug, A.J. Cartwright, S.A. Courtneidge, J. Virol. 66 (1992) 1458–1467.
[7] K. Ballmer-Hofer, A. Ziegler, M.M. Burger, Oncogene 3 (1988) 365–371.
[8] A.T. Pores Fernando, S. Andrabi, O. Cizmecioglu, C. Zhu, D.M. Livingston, J.M.
Higgins, B.S. Schaffhausen, T.M. Roberts, Oncogene 34 (2015) 2483–2492.
[9] S. Mochida, S. Ikeo, J. Gannon, T. Hunt, EMBO J. 28 (2009) 2777–2785.
[10] S. Andrabi, O.V. Gjoerup, J.A. Kean, T.M. Roberts, B. Schaffhausen, Proc. Natl.
Acad. Sci. U. S. A. 104 (2007) 19011–19016.
[11] M. Gale Jr., C.M. Blakely, B. Kwieciszewski, S.L. Tan, M. Dossett, N.M. Tang, M.J.
Korth, S.J. Polyak, D.R. Gretch, M.G. Katze, Mol. Cell. Biol. 18 (1998)
5208–5218.
[12] D. Walsh, I. Mohr, Nature reviews, Microbiology 9 (2011) 860–875.
[13] L.M. Knight, G. Stakaityte, J.J. Wood, H. Abdul-Sada, D.A. Griffiths, G.J. Howell,
R. Wheat, G.E. Blair, N.M. Steven, A. Macdonald, D.J. Blackbourn, A.
Whitehouse, J. Virol. 89 (2015) 35–47.
[14] D.W. Andrews, J. Gupta, G. Abisdris, Mol. Cell. Biol. 13 (1993) 4703–4713.
Please cite this article in press as: I. Reshi, et al., Int. J. Biol. Macromol. (2017), https://doi.org/10.1016/j.ijbiomac.2017.10.110
G Model
BIOMAC-8405; No. of Pages 6
6
ARTICLE IN PRESS
I. Reshi et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx
[15] M.K. White, J. Gordon, K. Reiss, L. Del Valle, S. Croul, A. Giordano, A.
Darbinyan, K. Khalili, Brain research, Brain Res. Rev. 50 (2005) 69–85.
[16] M. Jiang, J.R. Abend, S.F. Johnson, M.J. Imperiale, Virology 384 (2009) 266–273.
[17] B.A. Lodish H, S.L. Zipursky, et al., Microtubule dynamics and motor proteins
during mitosis, in: Molecular Cell Biology, 4th edition, W. H. Freeman, New
York, 2000.
[18] R. Armas-Portela, N. Paweletz, H.P. Zimmermann, S. Ghosh, 1988. Cell motility
and the cytoskeleton, 9, 254–263.
[19] E. Eisenberg, E.Y. Levanon, Trends Genet. 29 (2013) 569–574.
[20] E. Eisenberg, E.Y. Levanon, Trends Genet. 19 (2003) 362–365.
Please cite this article in press as: I. Reshi, et al., Int. J. Biol. Macromol. (2017), https://doi.org/10.1016/j.ijbiomac.2017.10.110
Документ
Категория
Без категории
Просмотров
15
Размер файла
1 457 Кб
Теги
2017, ijbiomac, 110
1/--страниц
Пожаловаться на содержимое документа