close

Вход

Забыли?

вход по аккаунту

?

Комплекс криптических видов литоральных гастропод подрода Neritrema (Littorinidae: Littorina) Северной Атлантики: сравнительная морфология, филогения, эволюция

код для вставкиСкачать
ФИО соискателя: МИХАЙЛОВА Наталья Аркадьевна Шифр научной специальности: 03.02.04 - зоология Шифр диссертационного совета: Д 002.223.02 Название организации: Зоологический институт РАН Адрес организации: 199034, г.Санкт-Петербург, Университетская на

На правах рукописи
МИХАЙЛОВА Наталья Аркадьевна
Комплекс криптических видов литоральных гастропод подрода Neritrema (Littorinidae: Littorina) Северной Атлантики:
сравнительная морфология, филогения, эволюция 03.02.04 - зоология
Автореферат
диссертации на соискание ученой степени
доктора биологических наук
Санкт-Петербург
2012
Работа выполнена в Федеральном государственном бюджетном учреждении науки Институте цитологии РАН (Санкт-Петербург)
Официальные оппоненты:
Захаров-Гезехус Илья Артемьевич,
д.б.н., профессор, чл.-корр. РАН
Институт общей генетики им. Н.И.Вавилова РАН, Советник РАН
Сиренко Борис Иванович, д.б.н.
Зоологический институт РАН, главный научный сотрудник
Борхсениус Сергей Николаевич,
д.б.н., профессор
Институт цитологии РАН, заведующий лабораторией
Ведущая организация: Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Российский государственный педагогический университет им. А.И. Герцена"
Защита диссертации состоится "10" октября 2012 года в 14 часов на заседании диссертационного совета Д 002.223.02 при Федеральном государственном бюджетном учреждении науки Зоологическом институте РАН по адресу: 199034, Санкт-Петербург, Университетская наб., д. 1. Факс (812) 328-2941.
С диссертацией можно ознакомиться в научной библиотеке Зоологического института РАН.
Автореферат разослан "____" сентября 2012 года.
Ученый секретарь Диссертационного совета,
доктор биологических наук В.Г. Сиделева
ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ
Актуальность исследования. Проблемы видообразования, микроэволюции, филогеографии и структуры вида всегда остаются в ряду наиболее дискутируемых вопросов общей биологии, поскольку касаются основных принципов становления биологического разнообразия (Dobzhansky, 1937; Майр, 1968; Тимофеев-Ресовский и др., 1977; Захаров, 2003; Coyne, Orr, 2004; Smadja, Butlin, 2011). В последнее время интерес к этой проблематике еще более возрос, в связи с возможностями применения новых методических подходов. Вслед за развитием базовых молекулярных методов, в исследования зоологов и эволюционистов, широко вовлекаются быстро совершенствующиеся методы молекулярно-генетического анализа геномов, что существенно расширяет наши представления о структуре биологических видов, их происхождении, путях географического расселения и эволюции в целом. Кроме того, динамично развивается математический аппарат для обработки больших массивов разнообразных молекулярных данных (Hudson, Coyne, 2002; Butlin, 2010; Galindo et al., 2010).
Успех в получении новых знаний связан не только с применением арсенала современных методов, но, также, с выбором адекватных моделей для исследований. Не случаен, в этом смысле, повышенный интерес к комплексам близкородственных видов, формирующих симпатрические поселения и характеризующиеся, как правило, недавней эволюционной историей (Coyne et al., 2004; Лухтанов, 2010). Именно на примере таких комплексов близких, часто криптических видов, можно продуктивно тестировать гипотезы о модусах микроэволюционных процессов, обсуждать механизмы видообразования. С использованием этих модельных систем могут быть получены сведения о характере и роли межвидовых барьеров, включая механизмы экологической и репродуктивной изоляции близких видов. В макрогеографическом масштабе такие модели позволяют исследовать проблемы внутривидовой структуры и изменчивости, а также анализировать филогеографическую историю видов, в связи с их расселением и микроэволюционными событиями.
Морские брюхоногие моллюски рода Littorina - массовый и хорошо известный компонент литоральных сообществ побережий мирового океана. Два основных качества - широкое географическое распространение и высокая плотность поселений - позволили использовать виды рода в качестве объектов и моделей для проведения самых разнообразных биологических исследований (обзоры: McQuaid, 1996; Reid, 1996; Johannesson, 2003; Rolán-Alvarez, 2007). Наличие в составе рода Littorina сестринских таксонов стало причиной для детального изучения морфологических особенностей, систематики видов и проведению филогенетических исследований (Williams et al., 2003; Reid et al. 2010, 2012; Krug, 2011). Виды подрода Neritrema российских северных морей остаются наименее изученными представителями рода Littorina. Вплоть до последнего времени, в сводках по фауне литорали российских северных морей, подрод был представлен двумя видами - L. saxatilis и L. obtusata и только в 2006 году появилось первое упоминание о видах L. arcana и L. compressa (Кантор, 2006). В действительности, подрод состоит из комплекса пяти, морфологически сходных, криптических видов (Гранович и др., 2004). Наиболее интригующими, в изучении видов подрода Neritrema, являются противоречивые данные молекулярно-генетического анализа криптических видов группы "saxatilis" (Ward, Warwick, 1980; Knight, Ward, 1991; Crossland et al, 1993, 1996; Rumbak et al., 1994; Reid et al., 1996; Grahame et al, 1997; Small, Gosling, 2000; Wilding et al, 1999; Wilding et al, 2000 и др.). Филогенетические отношения в этой группе из трёх видов окончательно не могут быть определены на протяжении более чем 30 лет. Полученные ранее данные по анализу аллозимов, митохондриальных и ядерных генов противоречивы и комбинируют все возможные варианты филогенетической близости двух видов по отношению к третьему. Комплекс североатлантических видов подрода Neritrema - эволюционно самый молодой, из всех ныне живущих литторинид (Reid et al., 2012), их изучение крайне актуально для понимания эволюции рода Littorina в целом, учитывая, что детальный анализ видов подрода Neritrema в российских северных морях ранее не проводился. Важно отметить, что существование популяций видов подрода Neritrema на северном краю ареала подчеркивает основные аспекты разделения экологических ниш, дает дополнительные сведения относительно эволюционной пластичности видов. Всё перечисленное выше определяет актуальность работы.
Цель работы: оценить пути эволюционного формирования комплекса криптических видов литоральных гастропод подрода Neritrema в морях Северной Атлантики на основе морфологических, экологических и молекулярно-генетических данных.
Задачи исследования:
1. Провести морфологическую ревизию видов рода Littorina подрода Neritrema на побережьях Баренцева и Белого морей, дать описание диагностических морфологических признаков.
2. Провести экологический анализ распределения видов на литорали в аллопатрических и симпатрических популяциях. 3. Использовать геномную ДНК литторин для поиска видоспецифичных генетических маркеров криптических видов группы "saxatilis". 4. Провести тестирование молекулярных маркеров, используя массовой материал моллюсков группы "saxatilis" из разных географических популяций, и выявить видоспецифичные маркеры, пригодные для диагностики криптических видов группы.
5. Провести генетический анализ криптических видов литторин, на основе сравнения частот гаплотипов микросателлитной ДНК.
6. Провести генетический анализ видов литторин из разных географических популяций, на основе сравнения частот гаплотипов митохондриального гена цитохрома оксидазы b (cyt b) и ядерной ДНК.
7. Оценить эволюционный статус криптических видов на основе их морфо-биологических характеристик и сравнительного анализа геномной ДНК.
Основные положения, выносимые на защиту: 1. Моллюски рода Littorina подрода Neritrema на северо-восточной границе обитания представлены двумя группами криптических видов, а именно: группой "saxatilis" (Littorina saxatilis (Olivi 1792), L. compressa Jeffreys 1865, L. arcana Hannaford Ellis 1978) и группой "obtusata" (L. obtusata (Linnaeus 1758), L. fabalis (W.Turton 1825)). 2. Список видов подрода Neritrema для побережья Баренцева моря, включает пять видов: L. saxatilis, L. compressa, L. arcana, L. obtusata, L. fabalis; для побережий Белого моря - только три вида - L. saxatilis, L. obtusata, L. fabalis.
3. Видовой статус самок L. saxatilis и L. arcana подтвержден морфологическим описанием, анализом митохондриального и ядерного геномов и наличием фрагмента некодирующей ДНК А2.8 (клонированный нами RAPD фрагмент).
4. Самцы пары видов-двойников L. saxatilis и L. arcana характеризуются отсутствием морфологически дискретных признаков. Их видовая принадлежность определена амплификацией геномной ДНК, с праймерами к клонированному видоспецифическому RAPD фрагменту А2.8 самок L. arcana.
5. Существует межвидовое спаривание L. saxatilis и L. arcana в симпатрических природных популяциях, что показано на основе анализа партнеров в копулирующих парах видов группы "saxatilis". Особи L. compressa в межвидовых спариваниях не участвуют. 6. Имеется межвидовая гибридизация видов-двойников L. saxatilis и L. arcana в симпатрических популяциях Баренцева и Норвежского морей. Частота распределения гибридных особей прямо пропорциональна частоте распределения родительских видов на литорали. В аллопатрических популяциях L. saxatilis межвидовые гибриды отсутствуют. 7. Среди криптических видов подрода Neritrema Северной Атлантики, виды группы "saxatilis" (L. saxatilis, L. compressa и L. arcana) представляют собой комплекс эволюционно молодых видов, L. saxatilis и L. arcana - виды с неполной репродуктивной изоляцией. Научная новизна:
Впервые сделано детальное морфологическое описание самцов криптических видов L. saxatilis, L. compressa и L. arcana из симпатрических популяций Баренцева моря и самцов L. saxatilis из аллопатрических популяций Белого моря.
Впервые описаны популяционная структура и микропространственное распределение на литорали пяти симпатрических видов подрода Neritrema, показана приуроченность видов к разным горизонтам литорали, что может снижать конкуренцию видов за места обитания и пищевые ресурсы.
Впервые обнаружен видоспецифичный для L. arcana ДНК-маркер в составе геномной ДНК, пригодный для идентификации вида.
Впервые, на основе молекулярно-генетического анализа и морфологической идентификации видов, доказана возможность межвидовой гибридизации в паре видов-двойников L. saxatilis и L. arcana и наличие потока генов между ними. Новые данные объясняют противоречия в опубликованных ранее результатах молекулярно-генетических исследований этих видов. Впервые получены данные по филогеографии криптических видов L. saxatilis, L. compressa и L. arcana из северо-восточных краевых популяций; прослежены филогенетические связи видов на основе ядерного и митохондриального геномов.
Теоретическая и практическая значимость. Научно-практическое значение полученных результатов состоит в ревизии видового состава моллюсков рода Littorina Белого и Баренцева морей, представители которого являются одним из наиболее массовых компонентов литоральной фауны. Проведенная работа закладывает надежный фундамент для практически ориентированных исследований, связанных с оценкой состояния окружающей среды, основанной на анализе литоральных сообществ; для проведения паразитологических исследований по изучению путей циркуляции паразитов морских птиц в сообществах арктических морей; для проведения мониторинговых исследований, направленных на выявление климатических флуктуаций в арктическом регионе. Описание комплекса из пяти видов подрода Neritrema имеет важное методическое значение, поскольку позволит активно использовать эти виды как модельные объекты для фундаментальных популяционных, паразитологических, физиологических и экологических исследований. Полученные результаты открывают перспективу для уточнения определения "биологического вида" в целом, а также углубляют знания о механизмах видообразования и являются перспективными для исследования механизмов эволюции геномов. Филогеографические данные могут быть использованы для реконструкции представлений об истории формирования фауны северных морей России.
Полученные результаты используются в курсах лекций для бакалавров и магистров Санкт-Петербургского государственного университета и при проведении практических занятий в курсе "Молекулярные методы в зоологии".
Апробация работы. Результаты работы были представлены и обсуждены на следующих научных мероприятиях: конференции "Проблемы изучения, рационального использования и охраны природных ресурсов Белого моря" (Архангельск, 1985), III Всесоюзном совещании "Фенетика популяций" (Москва, 1985), IV Всесоюзный симпозиум "Паразиты и болезни водных беспозвоночных" (Москва, 1986), Firth International Symposium on Littorinid Biology (Cork, Ireland, 1996), на семинарах Royal Belgian Institute of Natural Sciences (Brussels, Belgium, 1998, 2002), International Symposium on "Ecological Genetics" (Antwerp, Belgium, 2001), Второй Всероссийской школе по морской биологии "Морская флора и фауна северных широт: механизмы адаптации и регуляции роста организмов" (Мурманск, 2003), заседании Ученого Совета Института цитологии РАН (С.-Петербург, 2004), международной конференции "Сохранение генетических ресурсов" (Санкт-Петербург, 2004), научных сессиях Морской биологической станции СПбГУ (Санкт-Петербург, 2003, 2004, 2005, 2008, 2010), World Congress of Malacology "Mollucan Megadiversity: Sea, Land and Freshwater" (Perth, Australia, 2004), Eighth International meeting on Littorinid biology (Slapton, UK, 2005), Малакологическом совещании "Моллюски: морфология, таксономия, филогения, биогеография и экология" (Санкт-Петербург, 2006), Establishment of Russian-Norwegian Benthos Net-Work (Tromsø, Norway, 2007), Ninth International Symposium on Littorinid Biology (Oia, Spain, 2008), Workshop in Conservation Genetics of Baltic Sea organisms (приглашенная лекция "Hybridization and Introgression" (Tjarno, Sweden, 2008), Международной российско-норвежской конференции "Taxonomic research and biodiversity assessment of zoobenthos in the seas of European sector of the Arctic (the Barents and the White Seas): results and perspectives of Russian Norwegian collaboration" (St.Petersburg, 2008), "Arctic biology/Ecology - network creation" Meeting (Tromso, Norway, 2009), (Tjarno, Sweden, 2010), CONOR Symposium "Coordination and Integration of Norwegian, Polish and Russian research activities on Svalbard" (Svalbard, Norway, 2011), Tenth International Symposium on Littorinid Biology and Evolution (St.Petersburg, 2011), 57 Чтения, посвященные памяти В.А.Догеля (Зоологический институт РАН, С.-Петербург, 2012).
Благодарности. В работе, на разных ее этапах, принимали участие студенты и аспиранты Санкт-Петербургского государственного университета, за что автор выражает им самую искреннюю благодарность: Юлии Грачевой (Петровой), Зинаиде Старуновой (Лоскутовой), Алексею Максимовичу, Антонине Чернецкой, Елене Ганже, Владиславу Грабовому, Ольге Котенко. Особую благодарность я хочу выразить Юлии Грачевой - вместе мы получали первые трудоемкие данные по молекулярно-генетической идентификации видов-двойников, а также заведующему кафедрой зоологии беспозвоночных СПбГУ, д.б.н. Андрею Грановичу, моему коллеге и соавтору, вместе с которым мы начинали работать с видами литторин, будучи еще студентами и продолжаем работать по настоящее время. Я искренне признательна моему первому научному руководителю Сергиевскому Сергею Олеговичу, благодаря которому я познакомилась с объектом исследований и, который открыл для меня мир их удивительного полиморфизма. Выражаю большую благодарность Дэвиду Риду (Dr. David Reid, Museum of Natural History, London, UK), Тьерри Беккелью (Prof. Thierry Backeljau, Royal Belgian Institute of Natural Sciences, Brussels, Belgium); шведским коллегам Шештин Йоханнессон (Prof. Kerstin Johannesson) и Марине Пановой (Dr. Marina Panova) (University of Gothenburg, Sweden) - за неизменный интерес к работе, плодотворное обсуждение результатов и всестороннюю помощь. Марине я особенно благодарна за методическую помощь при выполнении микросателлитного анализа в лаборатории на морской станции Tjarno (Sweden). Искреннюю благодарность за поддержку на всех этапах работы выражаю заведующему Отделом клеточных культур, д.б.н., профессору Пинаеву Георгию Петровичу, директору Института цитологии РАН, чл.-корр. РАН, профессору Парфенову Владимиру Николаевичу и всем сотрудникам института. Работа поддержана грантами РФФИ (02-04-48725-а., 05-04-58892-з, 07-04-01376-а, 07-04-10164-к, 08-04-08427-з, 08-04-10090-к, 09-04-01728-а, грантами Научной Программы Президиума Санкт-Петербургского Научного центра РАН (2007, 2008), грантами РФФИ 10-04-10039-к, 11-04-06047-г, 11-04-10040-к, 12-04-00312-а.
Публикации: по теме диссертации опубликована 41 работа, из них 17 в рецензируемых международных и отечественных периодических изданиях, рекомендованных ВАК, 5 статей в коллективных монографиях и сборниках трудов.
Структура и объем диссертации. Диссертация состоит из введения, 8 глав, выводов, списка литературы и приложения. Диссертация изложена на 265 страницах, включающих 15 таблиц и 36 рисунков.
СОДЕРЖАНИЕ РАБОТЫ
Глава 1. МОЛЛЮСКИ РОДА LITTORINA - МОДЕЛЬ ДЛЯ ЭВОЛЮЦИОННЫХ ИССЛЕДОВАНИЙ. В главе приведены и обобщены литературные данные по морфологии, биологии и распространению видов рода Littorina. Проведен анализ опубликованных данных, особое внимание уделено морфологии и филогении видов, в частности результатам, полученных с использованием различных молекулярно-генетических методов и генетических маркеров (аллозимы, митохондриальные и ядерные гены, рестриктный анализ геномной ДНК и др.) для идентификации и характеристики видов. В главе обсуждены проблемы, возникающие при изучении эволюционно близких видов, и представлены преимущества комплекса криптических видов Littorina подрода Neritrema, позволяющие использовать его в качестве модели для изучения механизмов видообразования в природных популяциях. Глава 2. МАТЕРИАЛ И МЕТОДЫ ИССЛЕДОВАНИЙ
Общая характеристика материала.
В работе использованы моллюски подрода Neritrema из 24 популяций побережий морей пяти европейских стран - России, Норвегии, Франции, Швеции и Англии. Многолетние сборы и анализ данных проведен для 19 популяций литторинид Баренцева, Белого и Норвежского морей, для 5 популяций (Швеция, Англия, Россия) использованы одноразовые сборы моллюсков. Для морфологического описания криптических видов и описания их популяционной структуры в работе использовано около 20 тысяч моллюсков; в молекулярно-генетическом анализе использована ДНК более 3 тысяч особей, проведено около 8 тысяч амплификаций ДНК с праймерами для различных молекулярных маркеров (см. ниже) и получено около 4 тысяч сиквенсов ДНК фрагментов.
2.1 Места сбора материала.
Материал для работы был собран в четырёх географических районах Северной Атлантики. Основные исследования проведены на побережье Баренцева моря (пос. Дальние Зеленцы, Мурманская область), побережье Норвежского моря (г. Тромсё, Норвегия) и побережье Белого моря (МБС СПбГУ, о. Средний, Кандалакшский залив) (Рис.1). Кроме того, в работе использован материал, дополнительно собранный непосредственно автором, либо представленный коллегами, из разных географических мест: сотрудником кафедры ЗБП СПбГУ Ольгой Котенко (морская станция в Роскоффе, Франция), сотрудниками ЗИН РАН к.б.н. Евгением Козминским (побережье о. Новая Земля) и Михаилом Фокиным (Тюва губа, Восточный Мурман), сотрудниками Гётеборгского Университета - профессором Kerstin Johannesson и к.б.н. Мариной Пановой (западное побережье Швеции), сотрудником Университета г. Лидс Dr. John Grahame (побережье Англии). Всем коллегам, предоставившим материал, автор выражает самую искреннюю благодарность. Рис. 1. Места сбора материала: морская станция Роскофф, Франция (слева); 1 - г. Тромсе, Норвегия (Telegraphen Bukta, литораль у Akvaplan Niva, остров Somaroe); 2 - Тюва-губа, Кольский залив; 3 -7 - популяции в районе пос. Дальние Зеленцы, Мурманская область: 3 - губа Ярнышная; 4 - мыс Дернистый; 5 - мыс Аварийный; 6 - бухта Оскара; 7 - бухта Плохие Чевры; 8 - о. Средний, Кандалакшкий залив, Белое море (справа). 2.2 Методы полевых сборов материала.
Для сбора материала использовали качественные и количественные методы, в зависимости от поставленных задач. Качественные сборы моллюсков были сделаны на побережье морей четырёх европейских стран (Россия, Норвегия, Франция и Англия). Этот материал был необходим для проведения морфологического описания криптических видов и их молекулярно-генетического типирования. Количественные сборы моллюсков были выполнены на четырех участках литорали: трёх - в районе морской станции Мурманского морского биологического института КНЦ РАН (пос. Дальние Зеленцы) - в бухте Оскара и губе Ярнышная; а также на участке литорали бухты Телеграфная (Telegraphen Bukta) в городе Тромсё, Норвегия. Количественные сборы проводили по стандартной методике гидробиологического разреза, с площадками 1/40 м2, вдоль проложенных трансект, которые располагались от нижней части (ноль глубин) до верхней (зона заплеска) литорали. Для каждой площадки учитывали количество собранных моллюсков и фиксировали биоценотические показатели. Площадки располагались вдоль трансекты, от нуля глубин, через пояс макрофитов, до верхней зоны литорали (зоны заплеска). Метод позволяет количественно оценить зональное распределение разных видов литторин и соотношение плотности их поселения. Применение количественной системы сборов материала невозможно на прибойных участках литорали, основная площадь которых представляет собой нагромождение крупных валунов, в нижней и средней литорали покрытых макрофитами (Fucus vesiculosus, Ascophyllum nodosum, реже F. serratus, F. distichus). В таких местах проводили качественные сборы литторин с поверхности и толщи талломов конкретного вида бурых водорослей и поверхности валунов в нижнем, среднем и верхнем горизонтах литорали.
2.3 Морфологический анализ самок и самцов криптических видов. Для каждого моллюска штангенциркулем измеряли высоту и ширину раковины, определяли фенотип особи. Моллюсков вскрывали под бинокулярным микроскопом, определяли пол, зараженность трематодами. Самок определяли по строению паллиального комплекса желез яйцевода и расположению копулятивной бурсы (Reid, 1996). Морфометрию копулятивного органа проводили по разработанной нами стандартной методике: препарат копулятивного органа измеряли в капле дистиллированной воды между препаровальными стеклами под бинокуляром, с использованием окуляр-микрометра. Для каждого самца отмечали характер расположения пениальных желез, их число, отмечали самцов с утраченным копулятивным органом (потеря пениса после сезона размножения) по небольшому фрагменту его базальной части в основании головы моллюска и состоянию семенников, предстательной железы и другим деталям строения половой системы. После измерения особи и определения вида, ткани половозрелых незараженных особей фиксировали в 70% этаноле, каждого в индивидуальной пробирке Эппендорф. Фиксированные ткани хранили при +4°С до момента выделения геномной ДНК. 2.4 Методы амплификации геномной ДНК и анализ видоспецифических молекулярных маркеров.
2.4.1 Экстракция тотальной ДНК. Экстракцию ДНК проводили индивидуально из каждой особи, фиксированной в 70% этаноле. Использовали ткани головы и ноги моллюсков, чтобы исключить попадание в образцы ДНК ранних стадий паразитов, преимущественно локализованных в печени и половой системе моллюсков. Экстракцию ДНК проводили методом CTAB (Mikhailova, Johannesson, 1998). 2.4.2 Амплификация ДНК со случайными праймерами методом RAPD (Random Amplified Polymorphic DNA). RAPD анализ проводили методом амплификации геномной ДНК моллюсков всех пяти видов со случайными праймерами. Всего протестировано 18 коммерческих 10-ти нуклеотидных случайных праймеров (Operon Tech. Inc.). Продукты амплификации разделяли в 12% вертикальном или 15% горизонтальном полиакриламидном геле (CleanGel, ETC-Electrophorese Technik). Гели импрегнировали серебром. Статистическая обработка RAPD паттернов базировалась на подсчете общего числа амплифицированных фрагментов и числа видоспецифических фрагментов. Обработка данных проведена при помощи программы Статистика 6.0. Результирующие дендрограммы построены методом кластерного анализа. Фрагменты ДНК, характерные для конкретного вида литторин использовали для дальнейшего клонирования и секвенирования.
2.4.3 Клонирование и секвенирование видоспецифичных ДНК фрагментов. Видоспецифичные фрагменты вырезали из геля, ДНК выделяли, используя смолу Chelex 100 (Sigma). Выделенные фрагменты реамплифицировали, убедиться, что размер реамплифицированных фрагментов соответствует размерам фрагментов, вырезанных из геля. Фрагменты лигировали в вектор pGEM-T Easy Vector (Promega Systems). Плазмиды трансформировали в электрокомпетентные клетки E. coli (линия XL1-blue) методом электропорации. Для определения размера лигированных фрагментов была проведена серия ПЦР-тестов с праймерами SP6 и T7. Выделение плазмид проводили, используя набор High Pure Plasmid Isolation Kit (Roche). Секвенирование полученных клонов проводили с использованием набора для секвенирования (Pharmacia-Biotech T7 sequencing kit). К концевым последовательностям секвенированных фрагментов были синтезированы праймеры (MWG Oligo Synthese). Секвенирование видоспецифичных фрагментов проводили на базе центра коллективного пользования (ЦКП) "ВНИИСБ" "Синтол" (Syntol Co., Москва), на модели капиллярного секвенатора ABIPrizm3130xl (AppliedBiosystems, USA).
2.4.4 Амплификация видоспецифичных для L. arcana фрагментов А2.8 на матрице геномной ДНК криптических видов. Тестирование видоспецифичных для L. arcana праймеров А2.8 (F+R) проводили методом полимерзной цепной реакции (ПЦР), используя в качестве матрицы индивидуальную геномную ДНК особей трёх видов моллюсков группы "saxatilis". Амплификацию проводили с использованием следующей программы: начальная денатурация ДНК 950С - 5 мин, далее 30 циклов - денатурация при 950С - 30 сек; отжиг при 570С - 30 сек; элонгация при 720С - 45 сек; конечная элонгация 720С - 5 мин. Продукты амплификации разделяли в 1.5% агарозном геле, окрашенном бромистым этидием, а также в 6% и 12% полиакриламидных гелях, окрашенных серебром.
2.4.5 Микросателлитный анализ криптических видов группы "saxatilis". Микросателлитный анализ был проведен для трех видов литторин из популяций Баренцева и Норвежского морей, всего в анализе использовано 390 моллюсков, по 130 особей каждого вида - L. arcana, L. saxatilis, L. compressa. Моллюски были определены морфологически и типированы при помощи амплификации с праймерами к фрагменту А2.8.
Для анализа моллюсков из популяций Баренцева моря были использованы микросателлитные маркеры пяти локусов Lsub8, Lsub16, Lsub32, Lsub62, Lsax6, для моллюсков из норвежских популяций - шесть локусов (включая Lsax20). ДНК амплифицировали методом ПЦР, используя праймеры, разработанные для указанных локусов для видов L. saxatilis или L. subrotundata (Tie et al., 2000; Sokolov et al., 2002; Panova et al., 2008). Были использованы три протокола амплификации, в зависимости от используемого микросателлитного локуса. Анализ микросателлитных ДНК фрагментов проведен при помощи Beckman Coulter CEQ800 Genetic Analysis, используя программное обеспечение CEQ Fragment Analysis. Анализ проводился методом капиллярного гель--электрофореза. Статистическую обработку данных микросателлитного анализа проводили как для каждого географического региона, так и для суммарных данным. В совокупном статистическом анализе были использованы результаты по пяти микросателлитным локусам.
Тестирование распределения генотипов на равновесие Харди-Вайнберга проводили с помощью программы Genepop. В случае неравновесной популяции, отклонение от равновесного распределения Харди-Вайнберга измеряли методом вычисления значения коэффициента инбридинга особей относительно популяции FIS. Степень генетических различий между популяциями рассчитывали при помощи программы Genepop, для проверки различий между популяциями применяли непараметрический статистический тест рандомизации. Для оценки вероятности соответствия каждого моллюска конкретному виду был проведен тест соответствия, исходя из видоспецифичных частот аллелей (Paetkau et al. 1995). Была использована программа Geneclass 2 version 2.0. При помощи данного теста оценивали правильность морфологического определения вида особей, а также наличие в популяции гибридов. Наличие нулевых аллелей в популяциях проверяли при помощи программы Microcheсker, программу FreeNA использовали для корректировки значений Fst при условии вероятности существования нулевых аллелей в популяциях. Взаимоотношения между видами проиллюстрировано в виде иерархического дерева, полученного кластерным анализом данных по популяциям и отдельным видам. Итоговое иерархическое дерево, с оценкой бутстреп поддержки узлов ветвления, построено при помощи пакета программ PHYLIP (Felsenstein, 1997). Для оценки достоверности построенных деревьев проводили бутстреп анализ для 100 повторностей, с помощью программы Seqboot.
Программу Gendist использовали для определения генетических расстояний для каждой пары образцов по Нею (Nei, 1978). Генетические расстояния были рассчитаны между сравниваемыми видами и популяциями, исходя из частот аллелей всех проанализированных локусов для 100 повторностей. Полученные матрицы попарных расстояний были использованы в программе Neighbor для построения 100 деревьев (реконструкция деревьев по матрице расстояний), которые, в свою очередь, были обработаны в программе Consense (сравнение деревьев). Конечный результат был выражен в усредненном иерархическом дереве. Графическое изображение дерева получили при помощи программы Treeview. В данном исследовании генетические расстояния были использованы в двух различных эвристических алгоритмах кластеризации - Neighbor-joining (метод объединения соседних пар, не предполагает молекулярных часов и не укореняет деревья) и UPGMA (Метод попарного невзвешенного кластирования с арифметическим усреднением - расстояние между кластерами вычисляется как среднее арифметическое расстояний между всеми парами объектов в них; полученное укорененное ультраметрическое дерево, предполагает молекулярные часы) (Sneath, Sokal, 1973).
Проведен MDS-анализ (многомерное шкалирование), для которого использовали матрицы значений различий между популяциями Fst, полученные как при помощи программы Genepop, так и при помощи программы FreeNA).
2.4.6 Филогеографический анализ видов на основе частот гаплотипов митохондриального гена цитохром b (cyt b). Для филогеографического анализа гаплотипов трех видов литторин группы "saxatilis" были использованы моллюски из трех географических мест - популяций Баренцева, Норвежского морей и побережья Англии. Суммарное число особей составило 213 штук, из них: L. saxatilis, n=71, L. arcana, n=71, L. compressa, n=71. Моллюски были определены морфологически, затем типированы при помощи амплификации с праймерами к фрагменту А2.8. Геномная ДНК этих же особей была использована для амплификации фрагмента митохондриального гена сyt b (праймеры сyt b FOR - 5'- ttc ccg cac ctt caa atc tt -3' и сyt b Small 4R - 5'- gga cta ggg ccg aaa gta taa ata -3' (Small, Gosling, 2000). Для очистки амплифицированных фрагментов использовали колонки с мембранами HiBind(r) ДНК Minicolumns (Omega Bio-tek). Секвенирование фрагментов генов проводили на базе центра коллективного пользования (ЦКП) "ВНИИСБ" "Синтол" (Syntol Co., Москва), на модели капиллярного секвенатора ABIPrizm3130xl (AppliedBiosystems, USA). Чтение и выравнивание секвенированных последовательностей проводили при помощи программы CodoneCode Aligner V.3.0.3 и BioEdit V.7.0.3 (Hall, 1999), анализ нуклеотидного состава - с использованием пакета программ Mega 4.1 (Tamura et al., 2007). Для реконструкции филогеографии использованы методы объединения ближайших соседей (Neighbor Joining, NJ), минимальной эволюции (Minimum Evolution, ME), максимального правдоподобия (Maximum Likelihood, ML), кластерного анализа (UPGMA). Филогенетические деревья построены в программе Mega 4.1. Для филогеографического анализа методом NJ и ME использовали двухпараметрическую модель молекулярной эволюции Кимуры, кластерный анализ проводили в сочетании с методом максимального правдоподобия (ML). Анализ гаплотипов проводили с использованием Haplotype network - software TCS. Филогенетическое древо гаплотипов (Bayesian tree) построено с использованием software MrBayes (вид L.obtusata использован в качестве outgroup).
2.5 Морфометрический и молекулярный метод определения самцов видов-двойников L. saxatilis и L. arcana.
Для анализа использовали половозрелых самцов, не зараженных трематодами. Морфометрию копулятивного органа проводили по разработанной методике (см. выше), схема измерений включала 4 линейных параметра - длина, ширина пениса, ширина ряда пениальных желез, длина филамента. Рядность расположения пениальных желез оценивали по бальной шкале (от 1 до 3-х рядов). Для всех анонимных самцов L. saxatilis-L. arcana, получены данные морфометрического анализа копулятивного органа и амплификации фрагмента ДНК А2.8 (Mikhailova et al., 2009). При проведении статистических сравнений использовали линейные параметры и их отношения. Для комплексного сравнения морфометрических данных использовали анализ главных компонент. Для L. saxatilis - L. arcana проведен дисперсионный анализ, в котором в качестве переменных выступали значения факторных нагрузок компонентного анализа, а фактором служило наличие или отсутствие амплификации молекулярного маркера. Для исследования межпопуляционных различий по числу пениальных желез использовали однофакторный дисперсионный анализ. Размерно-возрастные особенности распределения количества пениальных желез исследовали с помощью регрессионного анализа. Всю статистическую обработку проводили с использованием пакета Statistica 6.0.
2.6 Морфометрический и молекулярный анализ партнеров в копулирующих парах криптических видов группы "saxatilis". Копулирующие пары литторинид группы "saxatilis" были собраны в сезон размножения (июль 2007 г.) на побережье Баренцева моря (бухта Плохие Чевры). Всего собрано 149 копулирующих пар. Каждую пару содержали отдельно, при вскрытии определяли вид моллюска по морфологическим признакам партнеров (самок в случае видов-двойников L. saxatilis и L. arcana) и анализировали их индивидуальную геномную ДНК. ДНК всех особей амплифицировали со специфическими для L. arcana праймерами А2.8, по наличию амплифицированного фрагмента А2.8, определяли видовую принадлежность самок и самцов - партнеров видов-двойников.
2.7 Анализ микрораспределения криптических видов подрода Neritrema на литорали. В местах многолетнего мониторинга популяций литторин Баренцева и Белого морей, моллюсков собирали количественным методом, со стандартных площадок 1/40 м2, используя серию площадок в пределах гидробиологических разрезов (см. раздел 2.2). Количественный метод сбора позволяет оценить плотность поселения видов литторин в симпатрических популяциях, а также приуроченность видов к микробиотопам и горизонтам литорали. На Белом море многолетние наблюдения проводились в популяциях литторин на корге у Левин-наволока и о. Ряжков (Кандалакшский залив) (более 300 площадок). На Баренцевом море гидробиологические разрезы были сделаны в бухте Оскара (60 площадок) и на двух, удаленных друг от друга, участках литорали губы Ярнышная (23 и 52 площадки соответственно). Все половозрелые, не зараженные трематодами, особи литторин группы "saxatilis" из количественных сборов были генотипированы по наличию/отсутствию фрагмента А2.8 (амплификация геномной ДНК с праймерами к фрагменту А2.8). 2.8 Анализ микрораспределения гибридных особей L. saxatilis и L. arcana по горизонтам литорали.
Моллюски были собраны на сходных по структуре участках пологой литорали побережий Баренцева (Дальние Зеленцы) и Норвежского (Тромсё) морей. В каждом из двух мест, в направлении от зоны заплеска (HWNT) до уровня нуля глубин (LWST), был сделан гидробиологический разрез, длиной 28 м и шириной 3 м. Этот участок литорали был разделен на 7 уровней (4 м каждый), и, в каждом из уровней, сделаны количественные сборы моллюсков, с общей площади 0.2 м2. Все моллюски были определены морфологически и генотипированы, при помощи амплификации фрагмента А2.8. Для самцов оценивали характер расположение пениальных желез. Общее число моллюсков, использованных в анализе, составило 529 особей.
При помощи корреляционного анализа проведена оценка корреляции между количеством гибридов в выборках и наилучших предсказаний, тестированные в трех моделях: а) модель, основанная на морфологическом определении самок; б) модель, основанная на генетически маркированных самках; в) модель, основанная на генетически маркированных самках и самцах. Фракция гибридных особей во всех случаях рассчитывалась следующим образом: (N_самки_L.arc_ПЦР- + N_самки_L.sax_ ПЦР+) / N_самки_total, где N - число, самки_L.arc_ ПЦР- - самки L. arcana (ПЦР-), f_sax_ ПЦР+ - самки L. saxatilis (ПЦР+), самки_total - общее число половозрелых самок в выборке.
Рассчитаны коэффициенты корреляции Спирмена и их доверительные интервалы с использованием z-преобразования Фишера. Корреляции были оценены как отдельно для Баренцева и Норвежского морей, так и для объединенных данных из обоих мест.
Для оценки соответствия распределения частот особей родительских видов L. saxatilis и L. arcana и частоты распределения гибридных особей были построены логистические модели. Логистические модели оценивали соответствия наблюдаемого и ожидаемого частотного распределения гибридных особей. В качестве наблюдаемого значения принималось зональное распределение частоты гибридных особей по уровням литорали. В качестве ожидаемого значения - частота гибридов, рассчитанная в различных вариантах логистических моделей, комбинирующих родительские пары на основе молекулярного А2.8 типирования особей.
Глава 3. РЕВИЗИЯ ВИДОВОГО СОСТАВА МОЛЛЮСКОВ РОДА LITTORINA ПОДРОДА NERITREMA НА ПОБЕРЕЖЬЕ БАРЕНЦЕВА И БЕЛОГО МОРЕЙ. Ревизия видового состава литоральных моллюсков рода Littorina на побережье Баренцева моря (Восточный Мурмана) показала, что на литорали обитают пять видов гастропод подрода Neritrema. Определение видов было сделано на основе качественных сборов моллюсков, используя морфо-анатомические признаки репродуктивной системы особей (Reid, 1996). Обнаружено две группы криптических видов: три вида группы "saxatilis" - L. saxatilis, L. arcana, L. compressa и два вида группы "obtusata" - L. obtusata и L. fabalis (Рис. 2). На побережье Баренцева моря моллюски обитают совместно в симпатрических популяциях. На побережье Белого моря (Кандалакшский залив) обнаружено всего три вида литторин подрода Neritrema - L. saxatilis, L. obtusata и L. fabalis, также, обитающих симпатрично. группа "saxatilis" группа "obtusata"
Рис. 2. Форма раковины типовых образцов половозрелых особей видов литторин подрода Neritrema (губа Ярнышная, Дальние Зеленцы, Баренцево море).
Форма раковины видов литторин подрода Neritrema чрезвычайно изменчива и для представителей двух групп криптических видов различается средними пропорциями. Виды группы "saxatilis" характеризуются овально-конической раковиной, группы "obtusata" - шаровидно-овальной (Рис. 2). Эти различия характеризуются индексом раковины, средние значения которого приближаются к "1" (более "округлая" раковина с низким завитком) у L. fabalis и L. obtusata и значением меньше единицы (более "вытянутая" раковина, с более высоким завитком) у L. saxatilis, L. arcana и L. compressa. Несмотря на различие средних значений индекса раковины, крайние значения вариационного ряда у видов групп "saxatilis" и "obtusata" перекрываются. Размеры раковины моллюсков также не могут быть использованы в качестве диагностического признака, поскольку средние значения высоты и ширины раковины существенно не различаются для видов групп "saxatilis" и "obtusata", наблюдается значительная дисперсия анализируемых показателей.
Для L. obtusata и L. fabalis характерна мелкая продольная складчатость периостракума, которая выглядит как тонкая параллельная "волосовидная" исчерченность поверхности раковины. На большей части раковины старых моллюсков слой периостракума зачастую отсутствует, что создает сложности для идентификации видов. У L. saxatilis, L. arcana и L. compressa тонкая исчерченность не наблюдается, поверхность раковины либо гладкая, либо имеет скульптуру из продольных ребер. Ребристость раковины видов группы "saxatilis" разнообразна и варьирует как по количеству ребер, степени их выраженности, так и по форме в поперечном сечении. В паре видов L. obtusata - L. fabalis крупные моллюски L. fabalis имеют более низкий завиток и округлое (в отличие от округло-овального у L. obtusata) устье. Среди видов группы "saxatilis", пожалуй лишь L. compressa отличается по конхологическим параметрам - раковины этого вида характеризуются острой вершиной и, как правило, сильно выраженной ребристостью. Нам не удалось выявить никаких конхологических видовых различий в паре видов L. saxatilis - L. arcana.
3.1 Морфологические признаки строения репродуктивной системы самок и самцов криптических видов. Все виды подрода Neritrema характеризуются прямым развитием и не имеют планктонной личинки в жизненном цикле. Четыре вида литторин (L. arcana, L. compressa, L. obtusata и L. fabalis) откладывают бентические кладки на талломах водорослей и поверхности твердых субстратов, и только один из видов - L.saxatilis характеризуется яйцеживорождением. Половозрелые самки литторин подрода Neritrema отличаются по строению паллиального комплекса желез яйцевода и строению копулятивной бурсы (Рис. 3). Рис.3. Строение паллиального комплекса половой системы самок литторин: А - L. arcana; Б - L. compressa; В - L. saxatilis; Г - L. obtusata; Д - L. fabalis (вид с вентральной стороны); кб - копулятивная бурса, сж - слизистая железа, кж - капсульная железа, бж - белковая железа.
По материалам сборов из бухты Оскара и губы Ярнышной, Восточный Мурман.
Самки L. arcana характеризуются копулятивной бурсой, дистальный край которой достигает половины длины хорошо развитой слизистой железы, в то время как слизистая железа самок L. saxatilis преобразована в выводковую сумку, с развивающимися внутри эмбрионами. Самки L. compressa характеризуются особым соотношением размеров желез паллиального комплекса и небольшой копулятивной бурсой, что отличает их от самок двух других криптических видов группы. Самки L. obtusata и L. fabalis хорошо отличаются по строению паллиального комплекса и размеру копулятивной бурсы. Указанные видовые признаки воспроизводятся в популяциях литторин из разных географических мест, параметры их варьируют незначительно и, таким образом, служат надёжными анатомическими определительными признаками. Определительный признак для идентификации самцов криптических видов подрода Neritrema - морфология копулятивного органа (Reid, 1996). Самцы двух видов группы "obtusata" имеют копулятивный орган разного строения, что позволяет безошибочно проводить их видовую идентификацию (Рис. 4 Г,Д). Пениальные железы самцов L. obtusata мелкие, многочисленные и расположены в несколько рядов, в то время как пениальные железы L. fabalis крупные, немногочисленны (5-7 штук), конец пениса вытянут, представляя собой пениальный филамент или "бич". Среди самцов криптических видов группы "saxatilis" можно достоверно определить только самцов L. compressa. Копулятивный орган самцов L. compressa (Рис. 4 Б) характеризуется небольшим числом крупных пениальных желез, расположенных локально в один ряд, близко к его дистальному концу. Копулятивный орган L. saxatilis и L. arcana (Рис. 4, В и А) имеет сходное строение, что затрудняет их идентификацию.
Рис. 4. Строение копулятивного органа литторин:
А - L. arcanа, Б - L.. compressa, В - L. saxatilis, Г - L. obtusata, Д - L. fabalis;
ф - филамент, пж - пениальные железы. По материалам сборов из бухты Оскара и губы Ярнышной, Восточный Мурман.
В процессе вскрытия моллюсков, при использовании только мягких тканей особи, проблематично определить вид моллюска, поскольку самки двух пар видов L. arcana, L. obtusata и L. compressa, L. fabalis сходны по размеру и расположению копулятивной бурсы и характеристикам желез паллиального комплекса яйцевода. В этом случае, очень важно предварительно определить принадлежность особи к группе видов по морфологии раковины. Основные итоги главы. Определен видовой состав гастропод подрода Neritrema приливно-отливной зоны российских северных морей. Состав рода представлен двумя группами криптических видов, а именно: группы "saxatilis" (Littorina saxatilis (Olivi 1792), L. compressa Jeffreys 1865, L. arcana Hannaford Ellis 1978) и группы "obtusata" (L. obtusata (Linnaeus 1758), L. fabalis (W.Turton 1825)). Для популяций побережья Баренцева моря обнаружены все пять видов: L. saxatilis, L. compressa, L. arcana, L. obtusata, L. fabalis, для популяций Белого моря только три - L. saxatilis, L. obtusata, L. fabalis. Наличие перекрывающихся морфологических признаков криптических видов группы "saxatilis" создаёт трудности при их определении, проведении популяционно-генетических исследований и требует поиска и использования дополнительных определительных видоспецифичных маркеров. Основные трудности связаны с идентификацией самцов видов-двойников L. saxatilis и L. arcana, для которых диагностические признаки не обнаружены, самцы морфологически идентичны.
Глава 4. ПОИСК МОЛЕКУЛЯРНЫХ МАРКЕРОВ ДЛЯ ДИАГНОСТИКИ КРИПТИЧЕСКИХ ВИДОВ
4.1 Амплификация геномной ДНК пяти видов литторин со случайными праймерами (RAPD). Метод RAPD использован для молекулярно-генетического анализа пяти видов литторин (L. saxatilis, L. arcana, L. compressa, L. obtusata и L. fabalis) из четырёх популяций Баренцева моря. Для RAPD генотипирования использованы только самки L. saxatilis и L. arcana, в связи с невозможностью морфологической идентификации самцов этих видов-двойников. В анализе использовано 200 моллюсков, по 40 особей каждого вида. Проведено тестирование 18 случайных праймеров (Operon Tech. Inc.), из которых, только при помощи одного (OPG-17), получены видоспецифичные RAPD паттерны. Восемь видоспецифичных для L. arcana и L. saxatilis RAPD фрагментов были клонированы и секвенированы, к их концевым последовательностям синтезированы праймеры: A2.8 F 5'-ggt gtt tta aca aac aat cag gac-3' и A2.8 R 5'- caa cat gat tca cag cac gat t - 3'. Видоспецифичность фрагментов была протестирована на геномной ДНК видов L. arcana, L. compressa и L. saxatilis амплификацией с праймерами А2.8 (F+R). Обнаружено, что RAPD фрагмент A2.8 - видоспецифичен для L. arcanа. Пара праймеров к фрагменту A2.8 специфично аплифицировала искомый ДНК фрагмент L. arcanа и не амплифицировала его на матрице геномной ДНК L. saxatilis (Рис.5) и L. compressa. Фрагмент А2.8, размером 271 п.н., видоспецифичный для L. arcana, в дальнейшей работе использован для идентификации самцов видов-двойников и типирования самок L. arcanа.
Нуклеотидная последовательность фрагмента А2.8 (271 п.н.): - 5' - acgacgacaaagaatgactggtgttttaacaaacaatcaggacgattcagagtaaaacaacatcagcttgactaaatatactatagatatacgtaaatacaacttttcttactcagaagacaaatgaacaaaagctgtttctgatcactggaaatctttttcgacgacacaaattagttgttttggcaagtgcattcattttgctgactgcaaacccatgccaataaataaatttaatcgtgctgtgaatca tgttgtgtcggtcgt-3'. Результат поиска в GenBank последовательностей, гомологичных фрагменту А2.8, не обнаружил гомологии в составе известных функциональных генов. По-видимому, фрагмент представляет собой некодирующую ДНК. 1 2 3 4 5 6 7 8 9 10 М
250 п.н.
Рис. 5. Продукты амплификации индивидуальной геномной ДНК особей литторин, с использованием пары праймеров к фрагменту А2.8: L. arcana (дорожки 1,3,5,7,9) и L. saxatilis (дорожки 2,4,6,8,10). М - маркер 50 п.н. Основные итоги главы. Впервые, в составе геномной ДНК L. arcana, обнаружен видоспецифичный маркер. Это - клонированный RAPD фрагмент, получивший название А2.8. Праймеры к фрагменту А2.8 можно использовать в качестве инструмента для диагностики самцов и неполовозрелых самок видов-двойников L. saxatilis и L. arcana, морфологическая идентификация которых в симпатрических популяциях моллюсков, невозможна. Применение молекулярного маркера А2.8 позволяет генотипировать особей и проводить популяционный анализ криптических видов.
Показано, что фрагмент А2.8. не амплифицируется на матрице геномной ДНК L. compressa.
Глава 5. МОЛЕКУЛЯРНАЯ ДИАГНОСТИКА КРИПТИЧЕСКИХ ВИДОВ С ИСПОЛЬЗОВАНИЕМ ДНК МАРКЕРОВ
5.1 Идентификация самцов криптических видов группы "saxatilis" методами морфометрии и амплификации фрагмента А2.8.Проведено морфологическое описание самцов L. saxatilis (n=197) из аллопатрических популяций Белого моря. Копулятивный орган 99% особей самцов характеризуется однорядным расположением пениальных желез, число желез варьирует от 3 до 16. Показано, что закладка числа пениальных желез происходит у самцов в возрасте 1-2 года, к моменту достижения половой зрелости (возраст 2-3 года), железы характеризуются дефинитивным размером; рост моллюска с возрастом сопровождается увеличением линейных размеров копулятивного органа, но не изменением величины и количества пениальных желез.
Рис. 6. Схема промеров копулятивного органа литторин, выполненных для L. saxatilis - L. arcana (а) и L. compressa (б) и варианты рядности вент-рального расположения пениальных желез (в). Для а,б: ПД - длина пениса, БД - длина бича, РШ - ширина ряда пениальных желез, ПШ1 - ширина пени-са на уровне границы передней железы, ПШ2 - в середине ряда пениальных желез, ПШ3 - на уровне задней границы последней железы; для в: 1.0 - однорядное расположение желез, 1.5 - железы расположены не строго по одной оси, 2.0 - двурядное расположение, 3.0 - железы расположены в 3-м ряду).
Выполнен морфометрический анализ (Рис. 6а) копулятивного органа самцов (L. saxatilis-L. arcana) и L. compressa из шести популяций побережий Белого и Баренцева морей (n=257), ДНК всех особей была амплифицирована со специфическими для L. arcana А2.8 праймерами. Схема морфометрических промеров представлена на Рис. 6а, для каждого самца отмечен характер расположения пениальных желез (Рис. 6б). Самцов из группы (L. saxatilis-L. arcana), амплифицировавших искомый фрагмент А2.8 (ПЦР+) относили в виду L. arcana, не амплифицировавших фрагмент (ПЦР-) - к виду L. saxatilis. Компонентным анализом подтверждены видоспецифичные особенности строения пениса L. compressa (Рис. 7). С использованием праймеров к видоспецифичному для L. arcana фрагменту ДНК А2.8 проведен поиск различий морфометрических характеристик самцов видов-двойников L. saxatilis и L. arcana. В симпатрических популяциях L. arcana и L. saxatilis Баренцева моря 40% самцов характеризуется "многорядным" (1.5, 2 и более рядов) расположением пениальных желез. Однако, молекулярное маркирование самцов (L. arcana-L. saxatilis) не позволило выявить дополнительные определительные морфологические признаки в строении копулятивного органа видов-двойников (Рис. 7). Рис. 7. Данные анализа главных компонент, выполненного по промерам морфологических параметров копулятивного органа литторин группы "saxatilis" в популяции бухты Плохие Чевры Баренцева моря: ординация признаков особей в пространстве главных компонент - - моллюски ПЦР-; - моллюски ПЦР+; треугольники - L. compressa).
5.2 Анализ межвидовых спариваний на основе морфологической и молекулярно-генетической идентификации партнеров в копулирующих парах видов группы "saxatilis". Для оценки межвидовой гибридизации видов комплекса "saxatilis" проведен анализ состава партнеров в 149 копулирующих парах. Среди них обнаружено 49 пар, в которых обоими партнерами выступали самцы (24.5% от общего числа спариваний), такие пары были исключены из анализа. В 36 парах один или оба партнера были заражены трематодами, такие пары также не анализировались, поскольку паразитирование трематод может вызывать изменение репродуктивного поведения особей. Партнеры в 64 гетеросексуальных, не зараженных трематодами копулирующих парах, были идентифицированы морфологически (самки) и молекулярно-генетически (самки и самцы). Обнаружено 14 межвидовых спариваний: 5 пар L. arcana (ПЦР+) × L. saxatilis (ПЦР-) и 9 пар L. saxatilis (ПЦР-) × L. arcana (ПЦР+). Это - 21.8% от общего числа проанализированных пар. Ни одного случая спаривания L. compressa с особями других видов комплекса "saxatilis" не обнаружено.
5.3 Микросателлитный анализ популяций видов группы "saxatilis".
Филогенетические взаимоотношения видов литторинид группы "saxatilis" проведено с использованием микросателлитных маркеров, а именно 6 микросателлитных локусов (Lsub8, Lsub16, Lsub32, Lsub62, Lsax6 и Lsax20). Для анализа использованы морфологически идентифицированные самки трёх криптических видов, типированные при помощи амплификации фрагмента А2.8. Показан дефицит гетерозигот в ряде популяций всех трех видов (по двум локусам для L. saxatilis и L. arcana и по трем локусам для L. compressa). Анализ выявил наличие "нулевых" аллелей, специфичное для отдельных популяций всех трех видов. Расчет генетического расстояния (Fst) свидетельствует о большей степени дифференцировки L. compressa от двух других видов комплекса (средние Fst = 0,253 и 0,231 для L. arcana и L. saxatilis соответственно). Напротив, L. saxatilis и L. arcana очень близки (среднее Fst = 0,085). Внутивидовые различия существенно меньше (среднее Fst не превышает 0,048).
Результаты оценки принадлежности индивидуумов к каждому из трех видов группы "saxatilis", полученные на основании частот аллелей по шести микросателлитным локусам, показали наличие "неустойчивых" индивидуумов L. arcana и L. saxatilis как в норвежской, так и в двух баренцевоморских популяциях. Дендрограмма, построенная с помощью алгоритма UPGMA (Рис. 8), обладает наибольшей поддержкой, наблюдается кластеризация видов, за исключением популяции AC (L. arcana), которая расположена между видами L. arcana и L. saxatilis. В этой же популяции наблюдается значительное количество "неустойчивых" индивидуумов.
Рис. 8. UPGMA дендрограмма невзвешенных генетических расстояний (Nei, 1978) для популяций L.saxatilis, L.arcana и L.compressa из трех популяций: a - L.arcana, Тромсе, Норвегия; c - L.compressa, Тромсе, Норвегия;
s - L.saxatilis, Тромсе, Норвегия; AC - L. arcana, Плохие Чевры, Россия; AO - L. arcana, бухта Оскара, Россия; CC - L. compressa, Плохие Чевры, Россия; CO - L. compressa, бухта Оскара, Россия; SC - L. saxatilis, Плохие Чевры, Россия; SO - L. saxatilis бухта Оскара, Россия.
В дендрограмме, полученной методом объединения соседних пар (Рис. 9), не все ветви имеют значительную поддержку, и, в соответствии с данными, две популяции - AC и SC, имеют промежуточное расположение, в то время как остальные популяции образуют единый видовой кластер. При этом, популяция SC характеризуется большим числом "неустойчивых" индивидуумов, поэтому именно дендрограмма, полученная методом объединения соседних пар, отражает наиболее реалистичную картину кластеризации.
Рис. 9. Дендрограмма попарных генетических расстояний по Нею, полученная методом "ближайшего соседа" (Neighbor-joining), для L. arcana, L. compressa и L. saxatilis в трех местообитаниях.
a - L. arcana, Тромсе, Норвегия; c - L. compressa, Тромсе, Норвегия; s - L. Saxatilis, Тромсе, Норвегия; AC - L. arcana, бухта Плохие Чевры, Россия; AO - L. arcana, бухта Оскара, Россия; CC - L. compressa, бухта Плохие Чевры, Россия; CO - L. compressa, бухта Оскара, Россия; SC - L. saxatilis, бухта Плохие Чевры, Россия; SO - L. saxatilis, бухта Оскара, Россия.
MDS диаграмма, построенная на основе анализа многомерного шкалирования (MDS-анализ) (Рис. 10) показывает, что особи L. saxatilis из трех популяций близки друг к другу. Популяции L. arcana из Норвегии и бухты Оскара (Россия) также очень близки, в то время как L. arcana из бухты Плохие Чевры (Россия) занимает промежуточное положение, между всеми популяциями L. saxatilis и оставшимися популяциями L. arcana. Из диаграммы следует, что L. saxatilis и L. arcana более близки друг другу, чем каждый из них к L. compressa. Популяции L. compressa из России ближе между собой, чем каждая из них к популяции L. compressa из Норвегии. Диаграммы со значениями FST, полученными при помощи программы Genepop (величина стресса = 0.00009978; 0.009978%) или программы FreeNa, учитывающей наличие потенциальных нулевых аллелей (величина стресса = 0.00009649; 0.009649%) показывают сходное распределение. Различие двух вариантов диаграмм в том, что диаграмма, полученная с учетом наличия потенциальных нулевых аллелей, является более компактной. Такой эффект наблюдается потому, что скорректированные значения FST уменьшаются. L. compressa находится на втором варианте диаграммы ближе к L. saxatilis и L. arcana, чем на первом (где наличие нулевых аллелей не учитывалось), но даже в этом случае можно видеть, что L. saxatilis гораздо ближе к L. arcana, чем к L. compressa (Рис. 10).
Основные итоги главы. Впервые, с использованием молекулярного диагностического маркера (клонированного RAPD фрагмента А2.8), проведена идентификация самцов криптических видов L. saxatilis, L. arcana и L. compressa из симпатрических популяций Баренцева моря и самцов L. saxatilis из аллопатрических популяций Белого моря. Методом морфометрического и генетического анализа показано, что самцы L. compressa надежно диагностируются; для самцов видов-двойников L. saxatilis (ПЦР-) и L. arcana (ПЦР+) видоспецифичных морфологических признаков не обнаружено. Рис. 10. MDS диаграмма результатов многомерного шкалирования. Значения FST получены при обработке данных в программе FreeNa и MDS анализе. Величина стресса= 0.00009649
a - L. arcana, Тромсе, Норвегия; c - L. compressa, Тромсе, Норвегия; s - L. saxatilis, Тромсе, Норвегия; AC - L. arcana, Плохие Чевры, Россия; AO - L. arcana, б. Оскара, Россия; CC - L. compressa, Плохие Чевры, Россия; CO - L.compressa, б. Оскара, Россия; SC - L. saxatilis, Плохие Чевры, Россия; SO - L. saxatilis, б. Оскара, Россия.
Морфологическая идентичность копулятивного органа самцов видов-двойников не препятствует межвидовым спариваниям моллюсков. Использование молекулярного маркера А2.8 для идентификации партнёров в копулирующих парах криптических видов группы "saxatilis" позволило подтвердить наличие межвидовых спариваний видов-двойников L. saxatilis и L. arcana. L. compressa в межвидовых спариваниях не обнаружена. Результаты объясняют наличие около 30% гибридных особей L. saxatilis (ПЦР+) и L. arcana (ПЦР-) в симпатрических, географически удаленных друг от друга, популяциях Баренцева моря, побережий Норвегии и Франции (процент гибридных особей в популяциях разных стран одинаков), что демонстрирует универсальный характер поведения моллюсков. Микросателлитный анализ показал четкие генетические различия между тремя видами группы "saxatilis". Значения показателя Fst при попарном сравнении видов показывают, что L. arcana и L. saxatilis являются генетически более близкими друг к другу видами, в то время как L. arcana и L. compressa генетически наиболее удалены друг от друга. Генетические различия между российскими и норвежскими популяциями одного и того же вида всегда меньше, чем различия между видами. Тест оценки принадлежности индивидуумов к каждому из трех видов показал наличие "неустойчивых" индивидуумов - индивидуумы, определенные на основании морфологических и молекулярно-генетических (А2.8 маркер) признаков как L. arcana, по данным микросателлитного анализа, скорее относились к L. saxatilis, и наоборот. Это, наряду с фрагментом А2.8, второе доказательство наличия гибридных особей в двух разных географических популяциях видов-двойников. Для L. compressa "неустойчивых" индивидуумов не обнаружено.
Глава 6. ЗОНАЛЬНОЕ И МИКРОБИОТОПИЧЕСКОЕ РАСПРЕДЕЛЕНИЯ ВИДОВ РОДА LITTORINA ПОДРОДА NERITREMA НА ЛИТОРАЛИ.
6.1 Распределение видовых популяций подрода Neritrema по горизонтам литорали.
Зональное распределение видов комплексов "saxatilis" и "obtusata" свидетельствует, с одной стороны, о значительном перекрывании областей обитания популяций разных видов, с другой - о видоспецифичном характере зонального распространения (Рис. 11). Так, виды комплекса "obtusata" приурочены к поясу макрофитов в среднем и нижнем горизонтах литорали; L. fabalis проявляет четкую приуроченность к нижнему горизонту и верхней сублиторали. Виды комплекса "saxatilis" распределены по всем зонам литорали. Однако, L. compressa приурочена к зоне макрофитов, в среднем горизонте литорали, L. arcana населяет среднюю литораль, на границе гравия и пояса фукоидов и не обнаружена в нижней части литорали в районе нуля глубин. Среди видов комплекса "saxatilis" наиболее широко распространен L. saxatilis. Особи этого вида обнаружены как в пределах пояса фукоидов, так и выше макрофитов на камнях, гравии и гальке.
А Б В
Рис.11 Зональное распределение видов литторин (%) на литорали: А - бухта Оскара, Б - губа Ярнышной (Восточный Мурман, Баренцево море), В - корга у Левин-наволока (губа Чупа, Белое море). По осям абсцисс - зоны литорали: 1 - район нуля глубин, 2 - нижняя часть пояса макрофитов, 3 - средняя часть пояса макрофитов, 4 - верхняя граница пояса макрофитов, 5 - верхняя часть литоральной зоны выше пояса макрофитов. В зонах 2-5 - количественные сборы моллюсков, в зоне 1 - качественный сбор. - L. fabalis, - L. obtusata, - L.saxatilis, - L. compressa, - L. arcana.
6.2. Распределение гибридных особей L. saxatilis и L. arcana в зависимости от плотности поселения родительских видов. Количественные данные получены для двух популяций Баренцева и Норвежского морей (см. Материалы и методы). Для обоих мест показано, что плотность поселения самок L. saxatilis и L. arcana (определены морфологически) зависит от горизонта литорали. Максимальная плотность поселения L. arcana приурочена к средней части литорали (уровни 3-4, верхняя граница зоны макрофитов, приблизительно соответствует уровню HWNT) (Рис. 12а), L. saxatilis равномерно распределена по всем уровням литорали. Все особи из количественных сборов были генетически типированы амплификацией фрагмента А2.8 (n=529).
Соотношение фракций гибридных особей и потенциальных родительских видов была рассчитана корреляционным анализом, с использованием трёх вариантов предсказаний на основе данных конкретных количественных площадок: 1. на основе долей морфологически определенных самок L. saxatilis и L. arcana; 2. на основе долей генетически определенных самок, независимо от их морфологических признаков; 3. на основе долей генетически определенных самок и самцов, независимо от их морфологических признаков. Результаты корреляционного анализа (Табл. 1) показали наличие значительной положительной связи между количеством гибридов и всеми перечисленными вариантами предсказаний для двух популяций (кроме одного, с использованием самцов из норвежской популяции). Отметим, что полученные корреляции аналогичны в обоих исследованных районах, что подтверждается общим корреляционным анализом материала (см. Табл. 1, строка "суммарно"). Таблица 1. Корреляция количества гибридных особей для двух географических мест со следующими параметрами: пропорции морфологически определенных самок L.saxatilis и L.arcana (столбец 1); пропорции генетически типированных самок (ПЦР- и ПЦР+) (столбец 2); пропорции генетически типированных самок и самцов (ПЦР- и ПЦР+) (столбец 3). Статистически значимые значения (р<0,05) выделены серым
Место сбора количественных пробhybrids vs. N_f_sax*N_f_arc/ (N_f_total)^2
1hybrids vs. N_f_min*N_f_plu/ (N_f_total)^2
2hybrids vs. (N_f_min+N_m_min)*
(N_f_plu+N_m_plu)/
(N_total)^2
3Баренцево море 0.643 [ 0.170; 0.875] 0.750 [ 0.364; 0.916] 0.750 [ 0.364; 0.916]Норвежское море 0.613 [ 0.123; 0.863] 0.885 [ 0.667; 0.963] 0.449 [-0.107; 0.791]суммарно 0.726 [ 0.317; 0.907] 0.795 [ 0.457; 0.932] 0.748 [ 0.360; 0.915] Более детальная количественная оценка потенциальной гибридизации выполнена с использованием модели логистической регрессии. Материалом послужили только сборы в популяциях Баренцева моря, поскольку слишком низкая плотность поселения L. arcana не позволяет использовать в построении моделей данные по Норвежскому морю. Выбор модели логистической регрессии обоснован необходимостью моделировать бинарный результат с помощью непрерывных регрессоров. События моделировали, исходя из допущения, является ли моллюск гибридом или нет (смоделирована вероятность в каком случае моллюск будет гибридным). Естественный способ оценить ожидаемую частоту гибридов состоит в умножении частоты родительских особей. Эти предсказания были использованы в качестве независимых переменных. Scaled девиантности и χ-квадрат Пирсона использованы для оценки качества соответствия. Оба эти показателя применимы для оценки степени совпадения. Поскольку результаты совпадают, представляем только Scaled девиантности.
Модели соответствуют тому, что частота гибридных особей (наблюдаемое распределение) значимо соответствует частоте распределения в данном горизонте литорали вероятных родительских видов (исходя из частоты которых, и рассчитывается ожидаемая частота гибридов) (Рис. 12б).
а) б)
Рис. 12. Распределение гибридных особей по горизонтам литорали. а) Диаграмма стандартной трансекты, показывающая уровни литорали от 1 (HWNT - уровень сизигийного прилива, верх литорали) до 8 (LWST - верхняя граница сублиторали) б) Ожидаемая (треугольники) и наблюдаемая (точки) частоты встречаемости гибридных особей L. saxatilis и L. arcana, полученные в соответствии с логистической моделью. В работе проанализировано семь различных моделей, в которых использованы различные сочетания потенциальных комбинаций родительских особей L. saxatilis и L. arcana. Наиболее точное соответствие наблюдаемой и ожидаемой частот основано на сочетании следующих групп в качестве потенциальных родительских особей. Среди самцов имеет значение частота самцов L. arcana (ПЦР+), среди самок - L. saxatilis (ПЦР-) и L. arcana, не имеющие соответствующего молекулярного маркера (ПЦР-). Самки L. arcana (ПЦР+), также как и самцы L. saxatilis (ПЦР-), в соответствии с моделью, не имеют существенного значения для межвидовой гибридизации. Основные итоги главы. Показана приуроченность видов рода Littorina к конкретным микробиотопам и горизонтам приливно-отливной зоны. Плотность поселения L. arcana максимальна в средних горизонтах литорали, на границе пояса макрофитов и гравия, L. compressa - в средних горизонтах в поясе фукоидов, L. saxatilis - равномерно распределена по всем горизонтам литорали. Места обитания видов группы "obtusata" разделены границей верхней сублиторали - L. fabalis обитает ниже нуля глубин, L. obtusata - на литорали. При помощи количественных популяционных методов анализа доказана положительная корреляция между числом родительских видов L. saxatilis и L. arcana и числом гибридных особей при изучении микро-пространственного распределения видов на литорали. Все особи были определены морфологически и типированы амплификацией А2.8 ДНК маркера. Данные свидетельствуют о межвидовом скрещивании видов-двойников, учитывая невысокий уровень индивидуальной активности особей и отсутствие плавающей расселительной личинки в жизненном цикле видов подрода Neritrema.
Глава 7. ФИЛОГЕОГРАФИЯ ВИДОВ ЛИТТОРИНИД ГРУППЫ "SAXATILIS" 4.1 Гаплотипы митохондриального гена цитохрома оксидазы b (cyt b) Проведен анализ 213 фрагментов гена cyt b трёх видов литторин группы "saxatilis": L. saxatilis (n=71), L. arcana (n=71) и L.compressa (n=71). Размер секвенированного фрагмента митохондриального гена cyt b составил около 700 пн, для аллаймента использовали общий участок, размером 625 пн.
Анализ секвенированных последовательностей выявил значительный полиморфизм по фрагменту гена cyt b. Выявлено 33 вариабельных позиции, из них 22 парсимониально информативных. Для трёх видов литторин группы "saxatilis" обнаружено 22 гаплотипа (Табл. 2). Необходимо учесть, что материал из Англии, использованный в работе, был прислан в виде замороженных тканей моллюсков, и проверка морфологического определения видов для этих образцов была затруднительна. Нельзя исключить вероятные ошибки в морфологическом определении криптических видов. Таким образом, делать окончательные филогеографические выводы по данным из трех регионов было бы поспешным. По выборкам литторин из России и Норвегии, определение видов которых мы проводили лично и, в достоверности определения которых мы уверены, получены следующие данные: для L. saxatilis обнаружено 8 гаплотипов, 4 из которых являются видоспецифичными; для L. compressa - 4 гаплотипа, 3 - видоспецифичных; для L. arcana - 7 гаплотипов, 3 из которых - видоспецифичные. Один гаплотип (Е4) - общий для всех трёх видов группы "saxatilis", три гаплотипа (Е10, Br6 и E1) оказались общими для L. saxatilis и L. arcana. Для каждого из трёх видов обнаружены гаплотипы, маркирующие конкретные географические популяции.
Таблица 2. Гаплотипы фрагмента митохондриального гена cyt b для трех видов литорин. В ячейках указано число особей с соответствующим гаплотипом. Ru -Баренцево море, Россия; Nor - Тромсё, Норвегия; UK - Уэльс, Великобритания. вид№12345678910111213141516171819202122E4E10Br6E1NS6NS10SC9NS21SW4SW19CW1CW11CW7CC1CC2NC18CW20AC16AW1AW17NA1NA9L.saxatilisRU798Nor11342211UK5112212L.compressaRU12111Nor1211UK3105141L.arcanaRU122145Nor2201UK63123N48251882181121051391115123201
Основные итоги главы. Из трёх видов группы "saxatilis", вид L. compressa наименее полиморфный - 96% моллюсков из России и Норвегии представлены двумя гаплотипами фрагмента митохондриального гена cyt b. Самый полиморфный вид - L. saxatilis представлен 8 гаплотипами, 25% особей имеет, специфичные только для этого вида, гаплотипы. 55% особей L. arcana имеет гаплотипы, свойственные только L. arcana. Наличие общего для всех трёх видов гаплотипа Е4 свидетельствует об общем происхождении трёх видов группы "saxatilis"; наличие 3 общих гаплотипов у L. saxatilis и L. arcana - об их близкой эволюционной истории. L. compressa (по материалу из популяций России и Норвегии) не имеет общих гаплотипов с L. saxatilis и L. arcana.
Глава 8. ЭВОЛЮЦИЯ КОМПЛЕКСА КРИПТИЧЕСКИХ ВИДОВ ПОДРОДА NERITREMA НА ОСНОВАНИИ МОРФОЛОГИЧЕСКИХ И МОЛЕКУЛЯРНЫХ ДАННЫХ
Морфологическое описание видовых признаков для всех 19 ныне живущих видов рода Littorina было сделано Дэвидом Ридом в монографии 1996 года (Reid, 1996). Нами показано, что подрод Neritrema в российских морях Северной Атлантики представлен пятью криптическими видами литторин, входящих в состав двух групп - "obtusata" (Littorina obtusata, L. fabalis) и "saxatilis" (L. saxatilis, L. arcana, L. compressa). Вид L. obtusata в Белом и Баренцевом морях представлен северным вариететом geog. var. palliata, раковина которого характеризуется относительно более высоким завитком, в отличие от формы geog. var. retusa, населяющей южную часть ареала обитания вида. Вид L. fabalis (=L. mariae) в Белом море и на побережье Восточного Мурмана представлен вариететом geog.var.limata. В отличие от южного вариетета (geog.var.typica), обладающего почти шаровидной раковиной, моллюски морей Северной Атлантики характеризуются более выраженным завитком и тонкостенной раковиной. Тонкие морфологические детали строения раковины усложняют идентификацию видов внутри комплекса "obtusata" по конхологическим особенностям. В то же время признаки строения половой системы позволяют надежно различать указанные виды между собой (но не между видами групп "obtusata" и "saxatilis").
Беломорская фауна литторинид включает лишь одного представителя видового комплекса "saxatilis". Это яйцеживородящий вид Littorina saxatilis (Olivi 1792). В некоторых работах для этого вида употребляются более поздние синонимичные названия - "Littorina rudis" (Maton 1797) (Галактионов, Добровольский, 1984) или "L. tenebrosa" (Montagu 1803) (Middendorff, 1849). L. saxatilis проявляет значительную внутривидовую пластичность. Как более южные представители (geog.var.typica), так и представители северной части ареала вида (в частности, популяции Белого и Баренцева морей - geog.var.groenlandica) характеризуются существенной изменчивостью. Это, а также способность вида осваивать разнообразные условия обитания привело к выделению внутри L. saxatilis форм, якобы имеющих видовой статус. Наиболее яркий пример - обитающие среди раковин балянусов мелкие "L. neglecta". Лишь широкое применение методов генетического анализа и детальное морфо-анатомическое описание позволило подтвердить единство вида L. saxatilis и рассматривать "L. neglecta" в качестве внутривидовой экологической морфы (Johannesson, Johannesson, 1990, 1993; Reid, 1996).
Помимо яйцеживородящих L. saxatilis, на баренцевоморском побережье обитают также два вида из группы "saxatilis", которые могут быть охарактеризованы как виды с прямым развитием, откладывающие бентические кладки в литоральной зоне, на поверхности камней и талломах макрофитов, это - L. compressa и L. arcana. Характер их размножения и тип развития аналогичны таковым для обоих представителей группы "obtusata" - L. fabalis и L. obtusata. Лишь в начале 80-х годов появляются первые данные о сложном составе вида "L. saxatilis" на побережье Восточного Мурмана. В частности, отмечалось что, помимо L. saxatilis, обнаружен вид L. nigrolineata (Галактионов, Русанов, 1983, Галактионов, Марасаев, 1986). Позже, по-видимому этот же вид, упоминается под названием Littorinovaga jugosa (определение А.Н.Голикова, цит. по: Галактионов, 1993). Ревизия рода Littorina, проведенная в 1996 г. Д. Ридом, установила название L. compressa, основываясь на наиболее надежной ранней идентификации моллюсков этого вида (L. saxatilis var. compressa Jeffreys 1865) (Reid, 1996). В цитируемой монографии приведены данные по единичным особям L. compressa из района пос. Дальние Зеленцы, широкое присутствие вида подтвердилось позже, в результате анализа массового материала (Гранович и др., 2004). В 2001 г. на побережье Восточного Мурмана был обнаружен еще один представитель комплекса видов "saxatilis" - L. arcana (Granovitch, Sokolova, 2001), обозначив самое восточное место нахождения вида. Вероятно, что L. arcana и L. compressa распространены и далее на восток по побережью Кольского полуострова, однако этот вопрос требует дополнительного исследования. Первое детальное описание всех видов подрода Neritrema на Восточном Мурмане, включая анализ популяционной структуры видов, было сделано в 2004 году (Гранович и др., 2004).
Систематика и эволюция моллюсков семейства Littorinidae (включая род Littorina) изучается на протяжении последних сорока лет. В самом начале, систематика литторинид базировалась, главным образом, на характеристике раковины моллюсков (Rosewater 1970; 1981), однако, раковины видов сходны по форме и характеризуются как генетической, так и широкой экологической изменчивостью и высокой степенью полиморфизма. В дальнейшем, систематики обратились к анатомическим признакам видов (Heller, 1975; Bandel, Kadolsky, 1982; Reid, 1986) и использовали их в кладистическом анализе, для построения моделей филогенетических отношений внутри видов литторинид (Reid, 1989; 1990; 2002). Первый морфологический филогенетический анализ 18 современных видов рода Littorina был проведен Д. Ридом (Reid, 1986; 1990). Для всех видов рода было использовано 13 морфологических признаков, с присвоенными им градациями, которые и послужили основой для кладистического анализа, а именно: 1. раковина - форма раковины и характер ее минерализации; 2. копулятивный орган - 4 категории, учитывающие расположение пениальных желез; 3. сперма - отсутствие "стержня" в парасперматозоидах у Littorina (в отличие от видов родов Nodilittorina и Littoraria); 4. паллиальный овидукт - 3 категории строения спиральных петель на белковой и капсульной железах; 5. тип развития - пять типов яйцевых капсул; радула и строение передней кишки. В этой работе Д. Рид сделал описание двух синапоморфий рода Littorina: организация последовательных спиральных петель яичных желобов через белковую и капсульную железы паллиального комплекса яйцевода самок и отсутствие "стержня" в сперматозоидах. По наличию этих двух синапоморфий, род Littorina был определен как монофилетическая клада, в которой пять североатлантических видов подрода Neritrema cформировали отдельную кладу, внутри которой L. obtusata и L. fabalis значимо различались от видов группы "saxatilis". Виды рода Littorina представляют собой уникальную модель для изучения разных эволюционных проблем. Одним из интересных и важных эволюционных вопросов, касающихся рода, является вопрос о происхождении прямого развития в группе видов подрода Neritrema. Большинство литторинид (более 140 видов) размножаются с помощью пелагических яиц, из которых выходят свободноплавающие личинки, способные к широкому распространению. В противоположность этому, все 10 видов подрода Neritrema (5 из них - североатлантические виды) характеризуются прямым развитием: девять видов откладывают бентические кладки (яйцекладущие) и один вид (L.saxatilis) является яйцеживородящим. В связи с наличием прямого развития и относительно низкой локомоторной активностью, распространение особей и поток генов в популяциях видов, у которых отсутствует планктонная личинка, ограничены, что имеет важное значение для внутривидовой генетической дифференциации и видообразования в целом (Reid, 1996). Именно с этими особенностями генетической структуры видов может быть связана высокая пластичность и формирование разнообразных географических вариететов, экологических морф, локальных межпопуляционных различий, которые характерны для структуры всех видов рассматриваемой группы. Наличие у видов подрода Neritrema бентических кладок и прямого развития интерпретировались как адаптация к умеренно-холодному климату северной части Атлантического и Тихого океанов и признаны синапоморфией, которая определяет монофилию подрода (Reid, 1996). До сих пор не было получено независимых подтверждений уникального происхождения этих черт развития, как молекулярными данными, так и наличием иных морфологических признаков. Одновременное происхождение прямого развития у видов подрода Neritrema может быть признано достоверным, если будут получены молекулярные данные, по которым все 10 видов подрода смогут образовать общую кладу в молекулярном анализе. Полученные в последнее время молекулярные данные неоднозначны, однако в анализе, проведенном по пяти генам (28S рРНК, 12S рРНК, 16S rRNA, COI и cyt b) только для видов одного рода Littorina, виды подрода Neritrema образует единую кладу, но с низкой поддержкой ветвей (PP = 0,71) (Reid et al., 2012). Таким образом, вопрос об эволюционном происхождении прямого развития у Littorina близок к разрешению, но все еще требует проведения дополнительных исследований. Очень важной характеристикой североатлантических литторин являются ареалы распространения криптических видов. Так, вид L. saxatilis широко распространен в Северной Атлантике: от побережий Северной Америки, Канады, Гренландии на западе, до побережий восточной Европы. Вид обитает почти во всех морях Северной Атлантики, встречается по всему европейскому побережью от Гибралтара до Нордкапа и далее на восток до островов Вайгач и Новая Земля (Reid, 1996). Иная ситуация наблюдается в распространении двух других видов группы "saxatilis". Области современного распространения L. arcana и L. compressa совпадают, виды характеризуются сходными узкими ареалами и встречаются только на побережье Великобритании, Франции, Норвегии и Баренцева моря (Reid 1996). Полное перекрывание областей распространения криптических видов может свидетельствовать о симпатрическом видообразовании, поскольку аллопатрическое видообразование связано с географическим разделением ареалов видов. В концепциях эволюции возможность симпатрического видообразования до сих пор остается одним из наиболее дискуссионных моментов. Некоторыми авторами его возможность отрицается или оно признается как очень редкое явление (Mayr, 1963). Доказать существование симпатрического видообразования сложно, однако, на некоторые косвенные доказательства, полученные с использованием модели криптических видов подрода Neritrema следует обратить внимание. Так, например, L. saxatilis характеризуется широким диапазоном распространения, способны населять экологически контрастные биотопы и формировать экотипы, демонстрируя значительную изменчивость вида. Как уже было отмечено ранее, такое удивительное морфологическое варьирование может быть результатом адаптаций вида к локальным условиям обитания, чему дополнительно способствует наличие прямого развития (яйцеживорождение) и ограничение в распространении вида (небольшой радиус индивидуальной активности особей в течение жизни). На трех побережьях Северной Атлантики (Испания, Англия, Швеция) обнаружены, обитающие в симпатрии, морфологически различные экотипы. Их формирование связано с адаптациями к жизни в условиях присутствия или отсутствия хищничества со стороны крабов. Еще более существенные различия симпатричных "экотипов" наблюдаются в связи с зональностью литоральной зоны в прибойных местообитаниях. Такие случаи "внутривидовой дивергенции" представляет собой хорошую модель для изучения микроэволюционных процессов и экологического видообразования (Butlin et al., 2008; Johannesson et al., 2010). Эти данные, а также соотношение ареалов видов комплекса "saxatilis" заставляет еще раз задуматься о реальности симпатрического видообразования. Прогресс в изучении филогенетических отношений в группе видов рода Littorina был связан с анализом, проводимом на основе частот аллозимов. Филогенетический анализ на основе частот аллозимов измеряет генетические расстояния между видами, используемые в построениях кластерных моделей. Этот метод базируется на предположении о том, что дифференциация белков пропорциональна времени, прошедшему с момента дивергенции видов. Такой метод был использован для анализа от 16 до 25 локусов у 6 атлантических видов Littorina (Ward, 1990), показавший их близкое родство. Среди членов подрода Neritrema виды группы "obtusata" и "saxatilis" существенно различались. По данным Варда, виды L. saxatilis и L. arcana оказались ближе друг другу, чем к виду L. compressa. Сходные результаты получены по 22 локусам для трех видов группы "saxatilis", где L. saxatilis и L. arcana показывают более тесную связь друг с другом, чем с L. compressa (Knight, Ward, 1991). В другой работе (Backeljau, Warmoes, 1992) показано, что семь видов литторин представляют собой не монофилетическую группу, а L. compressa и L. arcana кластеризуются как сестринские виды. В более поздней работе (Backeljau et al., 1994), использовано три разных подхода к измерению генетических дистанций и кластерных методов анализа. Большинство кластерных методов подтвердило обособленность видов группы "saxatilis" и показана кластеризация видов L. saxatilis и L. arcana. Однако, данные, полученные по частотам аллозимов, необходимо интерпретировать с осторожностью, поскольку на разных видах литторин доказано, что некоторые локусы ферментов подвержены отбору (Janson, Ward, 1984; Johannesson, Johannesson, 1989; 1990; 1993; Grahame et al., 1992; Tatarenkov, Johannesson, 1994; Johannesson et al., 1995). Дальнейший прогресс в изучении филогенетических отношений в группе видов рода Littorina был связан с применением молекулярных методов анализа геномной ДНК. Так, применение метода амплификации ДНК со случайными праймерами (метод RAPD) показал большее генетическое сходство двух видов L. saxatilis и L. arcana по сравнению с L. compressa (Crossland et al., 1993). Поскольку RAPD методом обнаруживается полиморфизм по фрагментам ДНК неизвестного происхождения, то более широкое применение получили методы прямого секвенирования фрагментов известных митохондриальных и ядерных генов. Так, митохондриальные гены являются очень перспективными для изучения филогенетических отношений видов (Avise, 1994), а каждая мутация в составе ДНК последовательности этих генов несет потенциальную филогенетическую информацию. Впервые, данные по митохондриальному геному Littorina (12S rRNA) были опубликованы в 1994 году (Rumbak, et al., 1994), с использованием ДНК 11 видов литторин. Полученные данные показали монофилетическое происхождение рода Littorina. В дальнейшем эта работа была расширена и опубликованы данные анализа по фрагментам трёх митохондриальных генов (12S, 16S rRNA и cyt b) для всех 19 существующих современных видов литторин (Reid et al., 1996). При проведении анализа на основе каждого из трех генов, показано, что поддержка ветвей слабая, но топология деревьев, в каждом случае, почти полностью соответствует друг другу. Что касается филогенетических отношений внутри рода Littorina, то на основании сиквенса трёх митохондриальных генов была показана монофилия видов группы "saxatilis", однако, филогенетические связи среди трёх близких криптических видов достоверно разрешить не удавалось (Reid, 1996). В случае трех видов группы "saxatilis" не обнаружено морфологических синапоморфий, которые бы определяли их филогенетическую связь. Хотя L. arcana и L. compressa по ДНК анализу разрешаются как сестринские виды (bootstrap поддержка 62%), поддержка L. arcana и L. saxatilis в качестве сестринских видов оказалась еще меньше (Reid, 1996).
Если виды обитают в симпатрии, то существование значимо разных частот аллелей используется как доказательство их репродуктивной изоляции и поддерживает их статус в качестве самостоятельных видов. Это, например, показано для L. compressa и L. saxatilis (Knight, Ward, 1986; 1991). В случае этих двух видов репродуктивная изоляция дополнительно подтверждается различиями по строению репродуктивной системы самцов и самок. Генетические различия между аллопатрическими популяциями видов трудно интерпретировать, поскольку поток генов может быть ограничен географической изоляцией и различиями, связанными с отбором или дрейфом генов, что может оказаться значительней, чем морфологические различия близких видов. L. saxatilis и L. arcana - морфологически сходные виды, генетические дистанции между которыми небольшие и, до настоящего времени, не было обнаружено аллелей, которые можно признать диагностическими. Интересно, что в лабораторных условиях были получены межвидовые гибриды этих двух видов (Warwick et al., 1990), однако, гибридные особи не были обнаружены в природных популяциях. Нам удалось обнаружить видоспецифичные для L. arcana RAPD фрагменты, доказать наличие в природе межвидовых копулирующих пар, неравномерное распределение видов-двойников по горизонтам литорали и прямую зависимость числа гибридных особей в разных микробиотопах от частоты встречаемости родительских видов L. saxatilis и L. arcana. Анализ микросателлитной ДНК криптических видов подтвердил наличие гибридных особей в географически удаленных популяциях (Россия и Норвегия), что придает полученным данным универсальный характер. Более поздняя эволюция видов подрода Neritrema подтверждена хронограммой, построенной с учетом возраста ископаемых остатков литторинид: североатлантические виды располагаются на самых коротких ветвях филогенетического древа, полученного для 147 видов подсемейства Littorininae (Reid et al., 2012). Результаты представленных в работе многолетних исследований позволяют сделать заключение, что криптические виды группы "saxatilis" - эволюционно молодые виды, среди которых виды-двойники L. saxatilis и L. arcana находятся в процессе эволюционного становления, характеризуясь неполной репродуктивной изоляцией и, как следствие, потоком генов между ними. Молекулярно-генетические данные показали участие некодирующей ДНК (RAPD маркер А2.8 и шесть локусов микросателлитной ДНК) в молекулярной эволюции видов-двойников. Интересно отметить, что не обнаружено различий по функциональным генам криптических видов. Филогеографические данные (митохондриальный ген cyt b) подтверждают генетическую близость L. saxatilis и L. arcana из северных краевых популяций Баренцева и Норвежского морей, по сравнению с L. compressa, по наличию общих гаплотипов. Моллюски подрода Neritrema представляют собой очень перспективную модель для дальнейшей проверки эволюционных гипотез видообразования и, по-видимому, прогресс в ближайшем времени будет связан с получением новых данных по структуре геномов видов, в сочетании с новыми знаниями о морфологии, биологии, филогеографии и распространению этих видов.
ВЫВОДЫ 1. Состав рода Littorina подрода Neritrema на побереже Баренцева моря включает пять видов - Littorina saxatilis (Olivi 1792), L. compressa Jeffreys 1865, L. arcana (Hannaford Ellis 1978), L. obtusata (Linnaeus 1758), L. fabalis (W.Turton 1825). Три вида литторин подрода Neritrema обитают на побережье Белого моря - L. saxatilis, L. obtusata, L. fabalis.
2. Виды рода Littorina подрода Neritrema входят в состав двух групп криптических видов: группа "saxatilis" - L. saxatilis, L. compressa, L. arcana и группа "obtusata" - L. obtusata, L. fabalis.
3. Зональное распределение популяций рода Littorina на литорали видоспецифично. Плотность поселения L. arcana максимальна в средних горизонтах, на границе пояса макрофитов и гравия, L. compressa - в средних горизонтах в поясе фукоидов, L. saxatilis - равномерно распределена по всем горизонтам литорали. Места обитания видов группы "obtusata" разделены границей верхней сублиторали - L. fabalis обитает ниже нуля глубин, L. obtusata - на литорали. 4. Два вида литторин группы "saxatilis" - L. saxatilis и L. arcana определены как виды-двойники: самцы видов не имеют диагностических признаков, самки отличаются строением паллиального комплекса яйцевода и размером копулятивной бурсы. 5. Клонированный RAPD фрагмент А2.8, видоспецифичен для L. arcana и использован для диагностики вида в симпатрических популяциях моллюсков группы "saxatilis". RAPD фрагмент A2.8 отсутствует в геноме L. compressa. 6. Анализ микросателлитной ДНК криптических видов группы "saxatilis" из разных географических популяций, подтвердил видовой статус моллюсков и выявил видоспецифичные маркеры, пригодные для их диагностики. На основе сравнения частот гаплотипов микросателлитной ДНК показана большая филогенетическая близость L. saxatilis и L. arcana по сравнению с L. compressa.
7. В симпатрических популяцих L. saxatilis и L. arcana Баренцева, Норвежского морей и пролива Ла-Манш обнаружены гибридные особи (маркированы ДНК фрагментом А2.8.), что свидетельствует о гибридизации двух видов. В аллопатрических популяциях L. saxatilis различных географических районов гибридные особи не обнаружены.
8. Виды-двойники L. saxatilis и L. arcana способны к межвидовому спариванию, что показано анализом партнёров в копулирующих парах.
9. Доказана положительная корреляция между числом родительских видов L. saxatilis и L. arcana и числом гибридных особей при изучении микропространственного распределения видов на литорали. Данные свидетельствуют о межвидовом скрещивании видов, однако конкретные механизмы постзиготической репродуктивной изоляции неизвестны.
10. Сравнение частот гаплотипов митохондриального гена цитохром оксидазы b (cyt b) видов комплекса "saxatilis" из разных географических популяций подтвердил большую филогенетическую близость L. saxatilis и L. arcana по сравнению с L. compressa. 11. Виды рода Littorina подрода Neritrema образуют две группы криптических видов, из которых виды группы "obtusata" эволюционно отстоят от видов группы "saxatilis". Среди криптических видов группы "saxatilis" два вида - L. saxatilis и L. arcana представлены парой видов-двойников, между которыми существует поток генов, что свидетельствует об эволюционном становлении видов.
12. Виды рода Littorina подрода Neritrema - группа видов, эволюционно самая молодая из 152 видов подсемейства Littorininae, что подтверждается нашими данными и хронограммами, построенными с использованием ископаемых находок (Reid et al., 2012).
Список работ, опубликованных по теме диссертации.
В рецензируемых международных и отечественных изданиях, рекомендованных ВАК:
1. Сергиевский С.О., Гранович А.И., Михайлова Н.А. Неравномерное распределение на литорали моллюсков Littorina obtusata и L.saxatilis (Gastropoda: Prosobranchia), зараженных партенитами трематод. Зоол. журнал. 1984. Т.63. Вып.6. С.929-931.
2. Сергиевский С.О., Гранович А.И., Михайлова Н.А. Влияние трематодной инвазии на выживаемость моллюсков Littorina obtusata (L.) и L.saxatilis (Olivi) в условиях экстремально низкой солености среды. Паразитология. 1986. Т.20. Вып.3. С.202-207.
3. Гранович А.И., Михайлова Н.А., Сергиевский С.О. Возрастные особенности зараженности популяций литоральных моллюсков Littorina obtusata и L.saxatilis партенитами трематод. Паразитология. 1987. Т.21. Вып.6. С.721-729.
4. Михайлова Н.А., Гранович А.И., Сергиевский С.О. Влияние трематодной инвазии на микробиотопическое распределение моллюсков Littorina obtusata и L.saxatilis. Паразитология. 1988. Т.22. Вып.5. С.398-407.
5. Михайлова Н.А., Наумов А.Д. Структура раковины и полиморфизм окраски брюхоногого моллюска Littorina obtusata (Gastropoda: Prosobranchia). Зоологический журнал. 1990. Т.69. Вып.4. С.131-134. 6. Birstein V.Ja., Mikhailova N.A. On the karyology of trematodes of the genus Microphallus and their trematode gastropod hosts, Littorina saxatilis. I. Chromosome analysis of three Microphallus species. Genetica. 1990. 80: 159-165
7. Birstein V.Ja., Mikhailova N.A. On the karyology of trematodes of the genus Microphallus and their trematode gastropod hosts, Littorina saxatilis. II. Karyological study of Littorina saxatilis (Gastropoda:Prosobranchia). Genetica. 1990. 80: 167-170
8. Mikhailova N.A., Johannesson K. A comparison of different protocols for RAPD analysis of Littorina. Hydrobiology. 1998. Vol. 387. P. 33-42
9. Johannesson K., Mikhailova N.A. Habitat-related genetic substructuring in a marine snails (Littorina fabalis) involving a tight link between allozyme and a DNA locus. Biol.J.Linn.Soc. 2004. Vol.81. P. 301-306
10. Mikhailova N.A., Petrova Y.A. Molecular markers for identification of the sibling species of marine gastropods of the genus Littorina. Цитология. 2004. Т.46. №9. С. 823-824
11. Гранович А.И., Михайлова Н.А., Знаменская О., Петрова Ю.А. Видовой состав моллюсков рода Littorina (Gastropoda, Prosobranchia) Восточного Мурмана. Зоологический журнал. 2004. Т.83. № 11. С. 1305-1317.
12. Fokin M.V., Mikhailova N.A. 2004. Characterization of three microsatellite loci in the White Sea periwinkles Littorina obtusata (L.) and L. fabalis Turton. Proc.Zool.Inst.Russ.Acad.Sci. 300:63-68.
13. Ганжа Е.В., Гранович А.И., Петрова Ю.А., Михайлова Н.А. 2006. Анализ гистологических особенностей строения пениальных желез моллюсков рода Littorina Северной Атлантики. Вестн. С.-Петерб. ун-та. Сер.3. Вып.4. С. 40-46.
14. Гранович А.И., Лоскутова З.И., Грачева Ю.А., Михайлова Н.А. 2008. Морфометрический анализ копулятивного органа моллюсков видового комплекса "saxatilis" (Caenogastropoda, Littorinidae): проблемы идентификации и статуса видов. Зоологический журнал. Т.87, вып.12, С.1425-1436.
15. Михайлова Н.А., Грачева Ю.А., Гранович А.И. 2008. Анализ частоты межвидовых спариваний в копулирующих парах морских гастропод рода Littorina комплекса "saxatilis". Вестник СПбГУ. Сер. 3. вып. 4. С.5-9.
16. Mikhailova Natalia A., Yulia A. Gracheva, Thierry Backeljau, Andrey I. Granovitch 2009. A potential species-specific molecular marker suggests interspecific hybridization between sibling species Littorina arcana and L. saxatilis (Mollusca, Caenogastropoda) in natural populations. Genetica. V. 137. № 3. P. 333-340.
17. Старунова З.И., Михайлова Н.А., Гранович А.И. 2010 Анализ межпопуляционных и внутрипопуляционных различий формы раковины у представителей видового комплекса "saxatilis" (Mollusca: Caenogastropoda) методами геометрической морфометрии. Вестн. С.-Петерб. ун-та. Сер.3. Вып.4. С. 23-34.
Статьи, опубликованные в других изданиях:
18. Галактионов К.В., Михайлова Н.А. Популяции литорального моллюска Littorina saxatilis Olivi на северо-восточной границе ареала (о-ва Новая Земля и Вайгач). В кн.: Моллюски. Результаты и перспективы их исследований. Ленинград. 1987. С.436-437.
19. Сергиевский С.О., Гранович А.И., Михайлова Н.А. Возрастная структура популяций брюхоногих моллюсков Littorina saxatilis и L.obtusata в Белом море// Бентос Белого моря. Популяции, биоценозы, фауна. Тр.ЗИН РАН СССР. 1991. Т.233. С.79-126
20. Petrova Yu.A., Granovitch A.I., Mikhailova N.A. Molecular markers for the identification of close Barents Sea littorinid species. In: Marine flora and fauna of the Nordic latitudes: mechanisms of adaptation and growth regulation of organisms. Apatity: Print. Kola Science Centre RAS. 2004. P. 326-333.
21. Петрова Ю.А., Гранович А.И., Михайлова Н.А. Молекулярные маркеры для идентификации близких видов литторинид Баренцева моря. В кн.: "Морская флора и фауна северных широт. Механизмы адаптации и регуляции роста организмов" Апатиты: Изд. КНЦ РАН. 2004. С. 149-156.
22. Старунова З.И., Гранович А.И., Михайлова Н.А. 2011. Использование методов геометрической морфометрии для анализа форм биологических объектов. В кн. Современные проблемы эволюционной морфологии животных (Материалы школы для молодых специалистов и студентов к 105-летию со дня рождения академика А.В.Иванова). СПб. с.134-136.
Работы, опубликованные в материалах конференций:
23. Гранович А.И., Михайлова Н.А., Сергиевский С.О. Влияние трематодной инвазии на пространственную структуру популяций моллюсков Littorina obtusata и L.saxatilis. Проблемы изучения, рационального использования и охраны природных ресурсов Белого моря. Архангельск. 1985. С.102-103.
24. Михайлова Н.А. Нарушение ритма приливно-отливных миграций у моллюсков Littorina obtusata и L. saxatilis, зараженных партенитами трематод. Тез.докл. 4-го Всес. симпоз. Паразиты и болезни водных беспозвоночных. Москва. 1986. С.106-108.
25. Сергиевский С.О., Гранович А.И., Михайлова Н.А. Популяционный анализ динамики взаимодействий в системе "партениты трематод - литторины". Тез.докл. 4-го Всес. симпоз. Паразиты и болезни водных беспозвоночных. Москва. 1986. С.129-131.
26. Mikhailova N., Khalturin K. Restriction fragment length polymorphisms (RFLPs) of DNA two Littorina species. 5th Intern.Symp. on Littorinid Biology. Cork, Ireland. 1996. P.26
27. Mikhailova N.A., Khalturin K.V. Backeljau T. 2001. Population genetic structure of two species of marine mollusks with planktonic larvae. International Symposium on "Ecological Genetics", Antwerp, 2001. P.41-42
28. Гранович А.И, Михайлова Н.А., Знаменская О.С., Петрова Ю.А. Многолетняя динамика зараженности трематодами совместно-обитающих популяций литторин: опыт двадцатилетнего анализа в модельной точке губы Чупа Белого моря. Тез. докл. IV науч. сессия МБС СПбГУ. СПб. 2003. С. 53 - 54.
29. Фокин М.В., Михайлова Н.А. Использование микросателлитных маркеров для анализа популяционной структуры двух видов моллюсков рода Littorina Белого моря. Тез.докл. V научной сессии МБС СПбГУ. 2004. С. 61-62.
30. Van Riel, P., Breugelmans, K., De Wolf, H., Mikhailova, N., Backeljau, T. Van Goethem, J. 2004. Analysis of mitochondrial DNA variation via PCR-SSCP reveals micro- and macrogeographic genetic heterogeneity in the planctonic developing periwinkle, Melarhaphe neritoides (Caenogastropoda, Littorinidae). World Congress of Malacology "Mollucan Megadiversity: Sea, Land and Freshwater", Perth, Australia, 11-16 July 2004, Abstract book p.153. (In: Mees, J. & Seys, J. (Eds) VLIZ young scientists' day, Brugge, Belgium, 5 March 2004: VLIZ Special Publication 17, Oostende, p. 76)
31. Петрова Ю.А., Михайлова Н.А., Гранович А.И. Морфологические особенности и изменчивость копулятивного аппарата самцов беломорских моллюсков Littorina saxatilis (Olivi). Тез. докл. VI науч. сессии МБС СПбГУ. СПб. 2005. С. 55 - 56.
32. Михайлова Н.А., Петрова Ю.А., Гранович А.И., 2006. Молекулярно-генетические методы идентификации видов-двойников морских гастропод Littorina saxatilis - L.arcana. Малакологическое совещание "Моллюски:морфология, таксономия, филогения, биогеография и Экология. 13-17 ноября 2006 г. ЗИН РАН. 33. Петрова Ю.А., Гранович А.И., Михайлова Н.А. 2007. Идентификация кладок литорального моллюска Littorina arcana с использованием молекулярно-генетических методов. Тез. Докл. конф., посвящ. 50-летию ББС ЗИН РАН "Картеш". СПб, С. 92.
34. Грачева Ю.А., Гранович А.И., Михайлова Н.А. 2008. Анализ частоты межвидовых спариваний в копулирующих парах морских гастропод рода Littorina комплекса "saxatilis". IX Научная сессия МБС СПбГУ. 8 февраля 2008 г. С. 47-48.
35. Gracheva Y.A., Granovitch A.I., Mikhailova N.A. 2008. Analysis of the interspecific crosses frequency in copulating pairs of littorinids of "saxatilis" species-complex. Abstracts of 9 Int.Symp. on Littorinid Biol. 2-7 Sept.2008. Oia, Spain. P.20.
36. Loskutova Z.I., Mikhailova N.A., Granovitch A.I., Gracheva Y.A. 2008. Morphometrical analysis of three rough periwinkles copulatory organ. Abstracts of 9 Int.Symp. on Littorinid Biol. 2-7 Sept.2008. Oia, Spain. P.29.
37. Mikhailova N. Morpho-anatomical and molecular complex analysis of the rough periwinkles from the North Atlantic: pro et contra of accepted meaning. Abstracts of 9 Int.Symp. on Littorinid Biol. 2-7 Sept.2008. Oia, Spain. P.30.
38. Лоскутова З.И., Михайлова Н.А., Гранович А.И. 2010. Анализ межпопуляционных и внутрипопуляционных различий формы раковины у представителей видового комплекса "saxatilis" (Mollusca: Caenogastropoda) методами геометрической морфометрии. Тез. докл. XI науч. сессии МБС СПбГУ. СПб. С. 41-43.
39. Starunova Z., Granovitch A., Mikhailova N. 2011. The detection of shell shape differences in "saxatilis" species complex by geometric morphomentric methods. Proceedings of 10 Int.Symp.on Littorinid Biol. and Evol. St.Petersburg, 24-29 July 2011. Polytechnical University Publishing House. P.53.
40. Grabovoi V., Granovitch A., Mikhailova N. 2011. Zonal patterns of five Littorina species distribution in habitats with different salinity (the Barents Sea, Russia). Proceedings of 10 Int.Symp.on Littorinid Biol. and Evol. St.Petersburg, 24-29 July 2011. Polytechnical University Publishing House. P.34.
41. Mikhailova N. 2011. Microspatial distribution of Littorina saxatilis and L. arcana sibling species: arguments for interspecies hybridization. Proceedings of 10 Int.Symp.on Littorinid Biol. and Evol. St.Petersburg, 24-29 July 2011. Polytechnical University Publishing House. P.45.
2
Документ
Категория
Биологические науки
Просмотров
81
Размер файла
1 799 Кб
Теги
Докторская
1/--страниц
Пожаловаться на содержимое документа