close

Вход

Забыли?

вход по аккаунту

?

Эволюция редактируемых генов митохондриального генома трипаносоматид

код для вставкиСкачать
ФИО соискателя: Герасимов Евгений Сергеевич Шифр научной специальности: 03.01.03 - молекулярная биология Шифр диссертационного совета: Д 501.001.76 Название организации: Московский государственный университет им.М.В.Ломоносова Адрес организации: 119
На правах рукописи
Герасимов Евгений Сергеевич
Эволюция редактируемых генов митохондриального
генома трипаносоматид
03.01.03 – Молекулярная биология
автореферат
диссертации на соискание ученой степени
кандидата биологических наук
Москва 2012
Работа выполнена на кафедре молекулярной биологии Биологического факультета
Федерального государственного бюджетного образовательного учреждения высшего
профессионального образования "Московский государственный университет имени
М.В.Ломоносова".
НАУЧНЫЙ РУКОВОДИТЕЛЬ:
Доктор биологических наук, профессор Колесников Александр Александрович
ОФИЦИАЛЬНЫЕ ОППОНЕНТЫ:
Рубцов Петр Михайлович, доктор биологических наук, профессор, Федеральное
государственное бюджетное учреждение науки Институт молекулярной биологии им.
В.А. Энгельгардта Российской академии наук, заведующий лабораторией молекулярной
эндокринологии.
Кульбачинский Андрей Владимирович, доктор биологических наук, Федеральное
государственное бюджетное учреждение науки Институт молекулярной генетики
Российской академии наук, заведующий лабораторией молекулярной генетики
микроорганизмов.
ВЕДУЩАЯ ОРГАНИЗАЦИЯ:
Федеральное государственное бюджетное учреждение науки Институт общей генетики
им. Н.И. Вавилова Российской академии наук
Защита состоится 11 октября 2012 г. в ______ на заседании Совета Д 501.001.76 по
защите докторских и кандидатских диссертаций при Московском государственном
университете имени М.В. Ломоносова по адресу: 119991 Москва, Ленинские Горы, МГУ,
Биологический факультет, ауд. 389.
С диссертацией можно ознакомиться в библиотеке Биологического факультета МГУ
имени М.В. Ломоносова
Автореферат разослан «____» ______________ 2012 г.
Ученый секретарь диссертационного совета,
кандидат биологических наук
И.А. Крашенинников
ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ
Актуальность проблемы:
Редактирование РНК широко распространено в природе и встречается у
представителей разных филогенетических групп от вирусов до человека.
Внутри отдельных филумов обнаруживаются разные механизмы РНК
редактирования, в него вовлекаются транскрипты разных генов, в ряде
случаев редактирование вносит существенный вклад в экспрессию генома.
В митохондриях простейших из группы Trypanosomatidae происходит
редактирование путем вставки или удаления уридиловых оснований.
Большинство
митохондриальных
генов,
называемых
криптогенами,
нуждается в редактировании их транскриптов в участке, называемом
редактируемым доменом (РД). Механизм уридилового редактирования на
сегодняшний день достаточно хорошо изучен. Необходимые реакции
осуществляются сложным белковым комплексом, эдитосомой, при участии
дополнительных белковых факторов и молекул гРНК. Молекула гРНК
определяет место и количество вставляемых или удаляемых уридилов, а
белки эдитосомы осуществляют необходимые реакции.
Как правило, зона РД криптогена не содержит открытой рамки
считывания, которая впоследствии создается уридиловым редактированием.
Так как около 12 из 18 митохондриальных генов трипаносоматид –
криптогены, редактирование вносит решающий вклад в экспрессию генома
этой органеллы. Несмотря на достаточно глубокое изучение механизмов
данного процесса, его эволюционные аспекты и назначение остаются во
многом спорными и неизвестными.
Сравнительный анализ известных у трипаносоматид структур криптогенов
показывает, что длина РД варьирует у разных криптогенов, также длина РД
одного криптогена в некоторых случаях варьирует у видов, входящих в
разные филогенетические группы. Некоторые криптогены, называемые
полностью редактируемыми (pan-edited), нуждаются в редактировании по
1
всей длине транскрипта и не содержат открытой рамки считывания, тогда как
другие, называемые 5’-редактируемыми, имеют транскрипты, содержащие 3’фрагмент открытой рамки считывания и редактируемый домен на 5’ конце.
На сегодняшний день хорошо изученными являются представители
гетероксенных видов (род Trypanosoma, род Leishmania) в виду их
медицинской и практической значимости для человека: данные виды
вызывают болезни человека и домашних животных, а иногда и растений.
Представители же гомоксенных видов, образующие на филогенетическом
дереве
трипаносоматид
большинство
ветвей,
остаются
практически
неизученными, в редких случаях изученными фрагментарно. Недостаток
данных о структуре криптогенов представителей разных филогенетических
групп не дает возможности провести информативный сравнительный анализ
и выявить закономерности в эволюции и структурной организации
криптогенов трипаносоматид. В нашей работе мы пытаемся расширить
спектр известных нам последовательностей криптогенов ранее неизученных
гомоксенных трипаносоматид.
Цели работы:
1) Установить возможное разнообразие структур РД криптогенов разных
представителей группы Trypanosomatidae.
2) Определить, насколько распространено явление редукции длины РД
среди гомоксенных видов, происходит ли редукция длины РД
согласованно у нескольких генов или носит индивидуальный характер.
3) Выявить общие черты структурной организации РД криптогенов
трипаносоматид и факторы, влияющие на изменение длины РД
криптогена и его первичную структуру.
Экспериментальные задачи:
1) С помощью ПЦР и молекулярного клонирования получить первичные
структуры криптогенов и отредактированных мРНК нескольких
2
представителей
гомоксенных
трипаносоматид
из
разных
филогенетических групп.
2) Определить границы РД исследуемых криптогенов.
3) Установить филогенетические отношения между изучаемыми в работе
и используемыми для сравнительных анализов видами трипаносоматид.
4) Провести сравнительный анализ первичных структур РД криптогенов,
полученных в работе, и структур, известных из баз данных, и выявить
структурные варианты организации РД.
Научная новизна:
1) Впервые
установлены
отредактированных
первичные
мРНК
ранее
структуры
криптогенов
неизученных
и
гомоксенных
трипаносоматид, принадлежащих к разным филогенетическим группам.
2) Обнаружены случаи совместной редукции длины РД у криптогенов A6,
ND8,
Полученные
COIII.
данные
являются
подтверждением
ретропозиционной гипотезы, высказанной ранее в работах других
авторов.
3) Выявлены три принципиальных структурных варианта организации РД
криптогенов
трипаносоматид:
полностью
редактируемые
с
вариабельной структурой РД; консервативные с коротким РД и
криптогены, претерпевающие редукцию длины РД. Сформулированы
возможные причины, обуславливающие тот или иной вариант
организации РД.
4) Впервые показано альтернативное редактирование криптогена rps12 у
Wallaceina sp. Wsd. Ранее случаи альтернативного редактирования
были известны для других полностью редактируемых криптогенов
(COIII,
G5,
ND9).
альтернативного
Нами
впервые
редактирования
максикольцевого генома.
3
может
показано,
являться
что
причиной
гетерогенность
Структура диссертации:
Диссертация состоит из четырех частей: 1) Обзор литературы; 2)
Материалы и методы; 3) Результаты и обсуждение; 4) Приложения.
Работа содержит список цитируемой литературы (____ ссылок), 23
рисунка, 3 таблицы. Общий объем диссертации ____ страницы.
Апробация работы и публикации:
Результаты диссертации были представлены на регулярно проводящихся
семинарах кафедры молекулярной биологии Биологического факультета
МГУ,
а
также
на
международных
конференциях:
международной
конференции студентов, аспирантов и молодых ученых Ломоносов-2010 и –
Ломоносов-2012, Москва, Россия, 2010 и 2012 годы; VI European Congress of
Protistology, Берлин, Германия, 2011; совместная конференция ISOP/ISEP
«Protist-2012», Осло, Норвегия, 2012. По теме диссертации опубликовано 3
статьи.
МАТЕРИАЛЫ И МЕТОДЫ
В работе использовались культуры Leptomonas collosoma ATCC 30261,
Leptomonas seymouri ATCC 30220, Leptomonas rigidus (изоляты 1b, PL и Sld),
Leptomonas
pyrrhocoris,
Wallaceina
sp.
Wsd,
Wallaceina
podlipaevi,
Herpetomonas pessoai, Herpetomonas muscarum, Angomonas deanei, любезно
предоставленные сотрудниками Зоологического института РАН, (199034,
Санкт-Петербург). Культуры клеток трипаносоматид растили при 26°C на
среде Brain Heart Infusion (Becton, Dickinson and Company) с добавлением
гемина
(10
мкг/мл).
Кинетопластную
ДНК
выделяли
на
10
день
культивирования по методике, описанной в работе Maslov et al., (1984). РНК
выделяли набором для выделения РНК RNeasy Mini Kit («QIAGEN»,
Германия). Обратную транскрипцию проводили по методике, описанной
фирмой-производителем
обратной
транскриптазы
RevertAid™
RT
(«Fermentas», Литва). Для ПЦР использовали наборы GenePak PCR Core Kit
(«ИзоГен», Москва). Молекулярное клонирование проводили наборами
4
CloneJET и InsTAclone PCR Cloning Kit («Fermentas», Литва). Синтез
праймеров и секвенирование образцов проводила фирма «Синтол» (Москва).
Анализ полученных последовательностей осуществляли в программах
MEGA 5.03, BioEdit, пакете программ Vector NTI, а также использовали
серверы BLAST, ClustalW, MUSCLE, MAFFT, ORF Finder, доступные в сети
«Интернет» на сайтах NCBI, EBI-EMBL и других организаций.
РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
Установление структуры криптогена ND8 Wallaceina sp. Wsd,
Leptomonas
collosoma,
Leptomonas
rigidus
и
Angomonas
deanei
(Herpetomonas roitmani).
Открытие у Strigomonas. oncopelti варианта 5’ редактируемого криптогена
ND8 (Aravin et al, 1998) привело к пониманию, что редукция РД может быть
достаточно распространенным явлением среди трипаносоматид и не
ограничиваться только РД криптогенов ND7, COIII и A6 у представителей
«слабодивергирующей» группы. Однако, последующий скрининг ND8
гомоксенных видов из «слабодивергирующей» группы (Merzlyak et al., 2001)
не выявил новых вариантов с редукцией РД. В данной работе мы установили
структуру криптогена ND8 у 4 прежде неизученных видов гомоксенных
трипаносоматид, не входящих в «слабодивергирующую» группу: Wallaceina
sp. Wsd, Leptomonas collosoma, Leptomonas rigidus и Angomonas deanei,
эндосимбионт-содержащего вида, родственного S. oncopelti.
Нуклеотидные
последовательности
криптогенов
ND8
трех
видов
гомоксенных трипаносомтид Wallaceina sp. Wsd, Leptomonas collosoma и
Leptomonas rigidus оказались схожими по длине и первичной структуре с
отредактированной
мРНК
«модельных»
трипаносоматид.
Криптоген
четвертого изучаемого вида, A. deanei, по первичной структуре оказался
схожим с криптогеном S. oncopelti. Результаты выравнивания приведены на
рис. 1.
5
Wwsd RNA (E) ATGTTTTTTTTTGATTTTTTATTT TCTTCTTTTGTAATATTTTATATGTG
Wwsd
Lcol
Lrig
Sonc
Adea
Ltar
Ltar
Tbru
Tbru
DNA
DNA
DNA
DNA
DNA
RNA
DNA
DNA
RNA
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
A G
GA
AT
TCTTCTTTTGTAATATTTTATATGTG
A G
GA
AT
TCTTTTTTTGTATTGCTTTATATGTG
A G
GA
AT
TCTTTTTTTGTAATATTTTATATGTG
ATG TG
G GA
GT
C
G
G
A A G G
ATG
G
A A
C
G
G
A A G G
ATGTTTGTTTATGATTTTT GTTTTTCTTTTTTTGTTTGTTTTTATATGTG
A GA
GTTTT C
G
G
A A G G
A G
GA
GTTTTT
G
G
A A G G
ATGTTTTTTTTTGATTTTTTGTTTTTTTTTTTT GTTTGTTTTTATATGTG
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
TTTTGTTTGTT
TTTTGTTTGTT
TTTTGTTTGTT
G G
G G G
TTTTTTATGTT
A G
T
G
G
TTTTGTTTGTT
GT
GT
GT
G
G
GT
G
G
GT
GTTA
CTTAT
ATTTTACCATTAGAATTATGTATGGTAAGTGTGATGGTT
GTTA
CATAT
ATTTTACCATTAGAATTATGCATGGTTAGTGTGATGGTA
GTTA
CATAT
ATACTACCATTAGAATTATGTATGGTTAGTGTAATGGTA
G A
C A
GT
ACC TGGAG AACCAA G AG G
G G
GT
G A
G
CCG GGAA AACG
G AG G A G
GTTA
CTTTG
GTTTTACCATTGGAGTTGACCATTGTTAGTATTTGTGTT
G AT
C
G
G
ACCA GGAG GACCA G AG A
G GTTT
G ATTTTC ATTTTGATTTCCCA
GAG AACCA G AG
A GG
GTTA
CT ATTT GTTTACCCATT GAGTTAACCATTGTTAGTTTATTGGTT
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
AGAGGAAATCATTTTTTACGTTTTTATT
GAT GTGGATTAGAA CGTTGTATAGCTTGTCGATTATGTGA
AGAGGAAATCACTTTTTAAGATTTTATT
GAT GTGGTTTAGAA CGTTGCATAGCCTGTAGATTATGTGA
AGAGGGAATCACTTTTTAAGATTTTATT
GAT GTGGTTTAGAA CGTTGCATAGCTTGCAGATTATGTGA
CG GG A ACATT
ACG
A
GA
G GGT AGAAGCGG
A GCTTGTCG
G GTGA
CG GG A ACA
GCG
A
GG
G GG
AGA GCGG
A GC G CG
A G GA
CGTGGTAACCATTTTTTTGCGTTTTTATT GAT GTGGTTTAGAA CGTTGTATTGCCTGCCGTTTATGTGA
CG GG AACCA
GCG
ATTT GATTTG GG
AGAA CG G A GCC GCCG
A GTGA
CG GG AACCA
GCGTTTT ATTTTTGG
G GG
AGA GCG G A GC G CG
A G GA
CGTGGTAACCATTTTTTGCGTTTTTATT
GGT GTGGTTTAGA GCGTTGTATTGCTTGTCGTTTATGTGA
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
TTATATAT
GTC
CCA
GTGTAGCTTT
AGATGTA
C
GTGTCGG TGTTAGTT
TTATATAT
GTC
CTA
GTGTTGCATT
AGATGTA
C
GTGTAGG TGTAAGTT
TTATATAT
GTC
CTA
GTGTTGCTTT
AGATGTA
C
GTGTAGG TGTAAGTT
A A
GCCTTTTTTTCTA
G
AGCA
AGA G
CTTTG G GGG
G AAG
A A
GTC
CTG
AG
AGCA
AGA G G
C
G
GG
G C
TTTTATAT
GCC
CAA
GTTTAGCTCT
AGATGTT
C
GTTGTG TTAGAAGTT
A ATTTTGCC
CAA
G
AGC CTTTTTTAGA G
C
G G G
AGAAG
AA
GCC
C ATTTTG
AGCA G
GA GTTTTTC
G G GG G GGAG
TTTAATTT
GCC
CTA
GTTTAGCATTG
GATGTT
C
GTGTTGG GTGGAGTT
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
TTAAT GGTTAT AGA TTCGCAGATTTATTTAA
TTAAT GGTTAT AGA TTCGCAGATTTATTTAA
TTAAT GGTTAT AGA TTTGCAGATTTATTTAA
A G GGTTT CA
T
CGGC C G
GGG
A G GG G CACGG
CA A
GTTTAA
TATGT GGTTAT CGG TTTTCCGATGTGTTTAA
A GTTGG AT CGG
CCGA G G
AA
GG GG CATTTCTG
GCGGA GA
ACA
TTGGT GGTCAT C GTTTTGCGGATTGATTTACA
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
ATATTGCATGCATGTATGTC
TTATTGTATGCATGTATGCC
TTATTGTATGCATGTATGTC
TTTTTGTATGCATGTATGTC
CTATTGTATGCATGTTTGTC
TTTTTGTATGCATGTTTGTC
TTT G A GCA G
G C
G A GCA G
GCC
TTTTTGTATGCATGTTTGCC
(1)
(2)
(4)
(5)
(6)
(7)
(8)
(9)
TTGCGTATGT
TTGTGTTTGT
TTGTGTTTGC
CTGTGTTTGT
TTGTTGTTGT
G G G
G
G G
GTTTTTGTTGT
CTACA
CAACA
CAACA
CAAC T
CAACC
CAACA
CAACATTTT
CGACA
CGACA
TTTAAGTTAT A GA
AGATGCATATATTGTGG
TTTAAGTTAT A GA
AGATGTATTTATTGTGG
TTTAAGTTAT A GA
AGATGTATTTATTGTGG
G GAGTTAT C G
CGTTGTATTTATTGTGG
A AG AT C GA
AGATGTATTTATTGTGG
TATTAGTTAT C GT
CGTTGTATTTATTGTGG
A AG AT C GTTTTCG G A
A G GG
GAG ATTCTTGTTT CG G A
A G GG
TTGAGTTAT C GT
CGTTGTATTTATTGTGG
GA T
GCT ATTAC TCATTCTTTATTTGTT TTATT
GA T
GCA ATTAC ACATTCATTATTTGTA TTATT
GA T
GCA ATAAC ACATTCATTATTTGTA TTATT
GA T
GCCGATAAC CCATTCA ATTTTTGTTTTATA
GA T
GCC ATAAC ACACTCC ATTTTTATTTTATA
GAC
GCC ATTAC GCATTCATGTTTTTTG TTATT
GACTTTTTTGCC A ACTTGCA CA G
G
A
GA TTTTT GCC A AC GCATTCA G
G
A G
GA T
GCC ATTAC GCATTCATTGTTTGTT
ATGT
TTAGCT AT GTATTTATTA G C
GCCA
AAATTTTTATTATTC G
G
TTGGCT AT GTATTTGTTA G C
ACCA
AAATTTTTTATTATT G
G
TTAGCT AT GTATTTATTA G C C
CCT
AAATTTTTATT ATTCG
G
TTAGCT AT GTATTTATTA G C
ATTGCC AT GTATTTAT
G C GCA CCT
AAATTT GTTTTATTTG
G
A GCC A
G A
A
GTCTGCA CCT
AAA
GTTT A
GTTTTG
AGCCTTATTTG A
A GTG C GCTTTCTTTCAAG
A
G
G
G
TTAGCC AT GTATTTATTG G C GC
C
CAAGTTTTT ATT GTTTG
G
6
(1)
(2)
(4)
(6)
(7)
(8)
(9)
TTGTAGTTTTATGCTATTT
GATTTTTACTTATGCTTTGTATAA
ATGTTGTTTTATGTTGTTT
GATTTTTATCTTTGCTTTGTATAA
TTGTTGTTTTATGTTGTTT
GATTTTTATTTATGTTTTGTATAA
TTGTTGTTTTATGTTATTT
GATTTTTATTTGTGTTTTGTTTAG
G G
A G ATTTTTTGA
A
G G
G
AG
G G
A G A
GA
A
G G
G G AG
TTGTTGTTTTATGTTATTT
GATTTTTATTTGTGTTTTGTGTAG
Рис. 1. Множественное выравнивание открытой рамки считывания криптогена ND8
исследуемых и «модельных» видов. Wwsd - Wallaceina sp. Wsd; Lcol - Leptomonas
collosoma; Lrig - Leptomonas rigidus; Sonc - Strigomonas oncopelti (взято из Aravin et al.,
1998); Adea - Angomonas deanei; Tbru - Trypanosoma brucei (взяты GenBank(TM)); Ltar Leishmania tarentolae (взяты GenBank(TM)). Черным выделены вставляемые в мРНК
нуклеотиды и стоп-кодон в рамке считывания белка ND8.
В начале гена Wallaceina sp. Wsd, L. collosoma и L. rigidus находится
несколько гипотетических стартовых кодонов, расположенных в одной рамке
считывания. Самый дистальный (от 5’ конца транскрипта) расположен
непосредственно за РД ND8 у трех исследуемых видов, таким образом, он
оказывается доступным для рибосом уже до редактирования пре-мРНК.
У других видов все инициаторные кодоны создаются в результате
редактирования. Таким образом, первичный транскрипт ND8 у трех
представителей,
изучаемых
нами,
может
транслироваться
без
редактирования. Мы назвали такой вариант структуры ND8 минимально
редактируемым геном.
Чтобы
проверить,
происходит
ли
редактирование
минимально
редактируемого гена ND8, мы получили серию молекулярных клонов мРНК
ND8 для Wallaceina sp. Wsd и Leptomonas collosoma. Большинство из них
оказались не отредактированными, однако были также получены полностью
отредактированные
варианты.
На
рис.
2
приведен
участок
отредактированной мРНК, который полностью совпадает у всех полученных
клонов L. collosoma и W. sp. Wsd. 18 уридиловых остатков вставляется на 5’
конце криптогена, создавая структуру, похожую на отредактированные
мРНК других видов.
7
WSD
DNA
WSD
RNA
Tbru DNA
Tbru RNA
ATACAAAATATAAATTATATTTTAATAA-G---------GA------AT--TCTTTTTTTGTAATATTTTATATGTG
M Q N I N Y I L I R
N
S F F V I F Y M C...FVCC>>>
AUACAAAAUAUAAAUUAUAUUUUAAUAAuGuuuuuuuuuGAuuuuuuAUuuUCUUUUUUUGUAAUAUUUUAUAUGUG
M Q N I N Y I L I M F F F D F L F S F F V I F Y M C...FVCC>>>
A--A-------A-------A-----G-A-G---------GA------GTTTTT-------G---G-----A-A-G-G
AuuAuuuuuuuAuuuuuuuAuuuuuGuAuGuuuuuuuuuGAuuuuuuGUUUUUuuuuuuuGuuuGuuuuuAuAuGuG
M F F F D F L F F F F V C F Y M C...FVCC>>>
Рис. 2. Редактируемый домен ND8 Wallaceina sp. Wsd и Leptomonas collosoma.
Выравнивание с Trypanosoma brucei (Tbru DNA, RNA – криптоген и мРНК
соответственно). Приведены белковые последовательности, соответствующие рамке
считывания ND8. Три стартовых кодона выделены черным цветом.
Приведенное на рис. 2 сравнение структуры 5’ конца мРНК T. brucei и
исследуемых
нами
видов
показывает,
что
редактирование
вносит
незначительный вклад в структуру открытой рамки считывания ND8. В
транскрипте ND8 имеется открытая рамка считывания, которая уже до
редактирования содержит гомолог ND8, в отличие от 5’-редактируемых
криптогенов эндосимбионт-содержащих видов (A. deanei и S. oncopelti), где
все стартовые кодоны и около половины 5’ концевой части триплетов
создается в результате редактирования.
Есть мнение, что у кинетопластид возможен произвольный выбор
инициаторного кодона и рамки считывания на мРНК, которое основано на
следующих фактах:
1. короткие
5’
нетранслируемые
монофосфорилированный
5’
конец
не
области
мРНК
и
позволяют
расположить
последовательности типа Шайна-Дальгарно или задействовать capзависимую инициацию;
2. мРНК трипаносоматид, как правило, содержат группу расположенных
со сдвигом +1 и -1 относительно друг друга терминальных кодонов;
3. мРНК некоторых генов содержат более одной перекрывающейся рамки
считывания.
Другой
проблемой
является
различение
отредактированной
и
неотредактированной мРНК. Предполагается, что 3’ НТО участвует в
процессе дискриминации (Bhat et al., 1991; Bhat et al., 1992; Read et al., 1994;
Militello and Read, 1999). Транслируемые матрицы, как правило, имеют
длинные поли(А) «хвосты» (200-300 н.п.), состоящие из гетерополимеров
8
A\U, а нетранслируемые – короткие (20-30 н.п.). Исходя из изложенного
выше, нельзя однозначно утверждать, происходит ли в случае ND8
трансляция неотредактированной формы мРНК или нет, но потенциальная
возможность
получить
полнофункциональный
белковый
продукт
с
неотредактированной матрицы имеется.
Установление филогенетических отношений между Wallaceina sp.
Wsd, Leptomonas collosoma, Leptomonas rigidus, Angomonas deanei и
другими видами.
Мы решили установить, есть ли взаимосвязи между филогенетическим
положением вида и типом структуры криптогена ND8. Заметим, что у
исследуемого нами A. deanei ND8 имеет схожую структуру с ND8 S.oncopelti,
оба вида являются эндосимбионт-содержащими. В каком филогенетическом
отношении окажутся виды с минимально редактируемым геном ND8 между
собой и с группой «эндосимбионт-содержащих» видов?
Одним из наиболее используемых для построения филогении ядерных
маркеров является ген 18S рРНК. Для построения филогенетического дерева
мы использовали последовательности 18S ядерной рРНК из GenBank™.
Филогенетическое дерево на рис. 4, согласуется с построениями,
полученными для трипаносоматид другими авторами (Teixeira et al., 2011;
Флеготнов, 2008; Podlipaev et al., 2004), но включает исследуемые в нашей
работе виды.
Группа эндосимбионт-содержащих видов (Strigonomas culicis и Angomonas
deanei)
обладает
редуцированным
до
5’-редактированной
формы
криптогеном ND8. Родственную ей группу образуют три исследованных в
нашей работе вида с минимально редактируемым геном ND8: Wallaceina sp.
Wsd, L. collosoma и L. rigidus. Сравнения с филогениями, полученными ранее
другими авторами, подтверждают отделение L. collosoma и W. sp. Wsd
(Kostygov et al., 2004; Podlipaev et al., 2004; Merzlyak et al., 2001b; Podlipaev et
al., 2004) от «слабодивергирующей» группы, куда попадают виды с
9
«слабодивергирующая»
LLW
ЭС
Рис. 4. Филогенетическое дерево, построенное на основании выравнивания
участков гена 18S рРНК для некоторых видов трипаносоматид. В качестве корневой
группы взяты бодониды. LLW - группа «LLW», ЭС - группа «эндосимбионт-содержащих»
видов.
полностью редактируемым криптогеном ND8. Мы далее будем обозначать
группу 1 (на рис.4) с минимально редактируемым ND8 как «LLW» по
первым буквам в названиях родов входящих в нее представителей.
Можно предположить, что процесс редукции РД ND8 начался при
отделении
групп
«LLW»
и
эндосимбионт-содержащей
от
дерева
трипаносоматид, и завершается почти полной утратой редактирования в
группе «LLW». В связи с этим было бы интересно установить первичную
структуру ND8 Sergeia podlipaevi и Trypanosomatidae sp. Eva, ДНК которых
10
не было у нас в лаборатории. Исходя из модели ретропозиции (Simpson et al.,
2000; Maslov and Simpson, 1992), эти виды должны обладать 5’ или
минимально редактируемым криптогеном ND8.
Отметив такое группирование видов с редукцией РД ND8 на нашем
филогенетическом
дереве,
мы
провели
дальнейший
анализ
других
криптогенов представителей группы «LLW», а также ранее неизученных
представителей «слабодивергирующей» группы, классифицированных по
морфологическим чертам в роды Wallaceina и Leptomonas с целью ответа на
вопросы:
1. какие криптогены претерпевают редукцию длины РД?
2. согласована ли редукция РД нескольких криптогенов в пределах вида?
3. насколько
широко
распространена
редукция
длины
РД
у
представителей разных групп?
Криптогены с редукцией редактируемого домена
Постепенное уменьшение длины РД криптогена А6 наблюдается в ряду
видов: T.brucei, 8-10 гРНК (Ochs et al., 1996); L. tarentolae и другие
лейшманий, 4-6 гРНК (Kolesnikov et al., 2000); Crithidia fasciculata, 4 гРНК; S.
culicis 1 гРНК (по Simpson and Maslov, 1999).
Нами были получены структуры криптогенов COIII и A6 следующих
представителей гомоксенных трипаносоматид: Leptomonas pyrrhocoris и
Wallaceina podlipaevi из группы «слабодивергирующих» видов; Leptomonas
collosoma, Leptomonas rigidus и Wallaceina sp. Wsd из группы «LLW».
РД A6 двух представителей «слабодивергирующей» группы W. podlipaevi
и L. pyrrhocoris имеет длину, примерно на 60 нуклеотидов меньшую, чем РД
у L. tarentolae (рис. 5, А), сходную с длиной у C. fasciculata.
У трех представителей группы «LLW» обнаруживается дальнейшая
редукция длины РД A6 до варианта минимально редактируемого гена.
Имеется потенциальный стартовый кодон, однако его положение отличает
11
представителей данной группы от других видов, у которых в данном
положении нет инициаторного кодона.
Короткий участок между терминаторными кодонами предшествующего
гена cyb и началом открытой рамки считывания A6 у исследуемых видов,
скорее всего, подвергается очень незначительному редактированию (рис. 5,
А).
Похожие результаты были получены для COIII (рис. 5, Б). У двух видов
«слабодивергирующей» группы сохраняется короткий РД, характерный для
изученных ранее видов той же группы. У трех видов из группы «LLW» на
уровне ДНК обнаруживается полная открытая рамка считывания белка COIII,
обладающая высокой степенью идентичности с отредактированными мРНК
«модельных» видов. Полученная мРНК Wallaceina sp. Wsd оказалась
полностью идентичной последовательности ДНК COIII. Сайтов возможного
редактирования не выявляется. Таким образом, у видов из группы «LLW»
COIII является геном. Как и в случае двух рассмотренных выше криптогенов,
у COIII имеется два сближенных стартовых кодона в начале гена. Второй
расположен всего в 15 (5 триплетах) нуклеотидных позициях от первого.
На выравнивании нами также представлена структура COIII S. culicis,
взятая из баз данных, чтобы показать, что окончательная утрата РД
происходит уже на уровне общего предка «эндосимбионт-содержащих»
видов и группы «LLW», что хорошо согласуется с полученными нами
филогенетическими построениями и приведенными рассуждениями.
12
Рис. 5. Криптогены A6 и COIII, претерпевающие редукцию длины РД. Нуклеотиды РД
отмечены черным. А. Криптоген А6. Стрелками показаны позиции начала открытой рамки
считывания белка А6 в последовательности криптогена. Б. Криптоген и ген COIII.
Зачеркнутым шрифтом показана последовательность белка, соответствующая
редактируемой части транскрипта у видов из «слабодивергирующей» группы.
13
Группа криптогенов с консервативной структурой коротких РД.
Мы установили структуру РД криптогенов cyb и ND7 у тех же
представителей группы «LLW», а также у некоторых ранее неизученных
представителей «слабодивергирующей» группы и 4 видов рода Leishmania (L.
chagasi,
L.arabica,
L.turanica,
для
L.mexicana)
оценки
степени
консервативности первичной структуры.
Сравнительный
анализ
структуры
РД
cyb
приведен
в
виде
множественного выравнивания на рис. 6 (А). У всех изученных, а также
показанных на рисунке «модельных» (из баз данных) видов, относящихся к
разным
филогенетическим
группам,
структура
РД
cyb
оказывается
идентичной по длине и нуклеотидному составу.
Аналогичные результаты были получены при установлении структуры
редактируемых доменов криптогена ND7. У всех исследованных видов ND7
имеет два коротких редактируемых домена на 5’ конце, в редактировании
каждого из которых, по-видимому, участвует по 1 гРНК, как у L. tarentolae.
Сравнение РД ND7 для 2-го РД данного криптогена приведено на рис. 6 (Б).
Также нами были получены последовательности гена gMURF2-II, гРНК,
участвующей в редактировании короткого домена MURF2. Множественное
выравнивание гена gMURF2-II приведено на рис. 6 (В). Ген гРНК сохраняет
почти полную идентичность у всех изученных видов и «модельных» видов.
Исходя из этого, мы предполагаем, что соответствующая гРНК структура РД
криптогена MURF2 также идентична у данных видов.
Таким образом, три исследованных нами криптогена MURF2, cyb и ND7
(за исключением Trypanosoma) имеют у всех изученных трипаносоматид
идентичную структуру короткого РД. Анализ
данных литературы и баз
данных позволяет обобщить наше заключение, добавив в эту группу также
COII, имеющий короткий РД, редактируемый цис-гРНК. Последовательность
гРНК gCOII-I и РД COII оказываются феноменально консервативными у всех
представителей трипаносоматид и даже у бодониды Bodo saltans (Kapushoc
and Simpson, 1999; Golden and Hajduk, 2004).
14
Рис. 6. Сравнение структуры криптогенов cyb, ND7 и MURF2 с короткими
консервативными РД. Белым шрифтом обозначены идентичные нуклеотидные позиции.
полужирным курсивным выделены замены, считающиеся нейтральными в виду того, что
при образовании дуплекса гРНК-мРНК происходит образование пары G:U наряду с G:C.
Черным шрифтом показаны значимые замены. Последовательности из GenBank ™ : Ltar –
Leishmania tarentolae, Tbru – Trypanosoma brucei, Tbor – Trypanoplasma borelli.
Последовательности, полученные в данной работе: Ltur – Leishmania turanica, LchaLeishmania chagasi, Lmex – Leishmania mexicana, Lara – Leishmania arabica, Lpyr –
Leptomonas pyrrhocoris, Lsey – Leptomonas seymouri, Lcol – Leptomonas collosoma, Lrig –
Leptomonas rigidus, Wwsd – Wallaceina sp. Wsd, Wpod – Wallaceina podlipaevi, Hmus –
Herpetomonas muscarum, Hpes- Herpetomonas pessoai. А. РД криптогена cyb. Б. 2-ой РД
криптогена ND7. В. Ген gMURF2-II, гРНК, отвечающий за редактирование MURF2.
Криптогены с вариабельной первичной структурой, транскрипты
которых редактируются по всей длине
Ко второй группе криптогенов с неизменной длиной РД относятся rps12,
G5 и G4. Транскрипты этой группы редактируются по всей длине, поэтому
далее данный тип организации мы будем кратко называть «полностью
редактируемые криптогены». Последовательности, полученные в ходе нашей
работы, доступны в GenBank (JN944119, JN944120, JN944123, JN944125, JN944127, JN944134 для участка, содержащего G4 и gMURF2-II; и JN944121, JN944122, JN944124, JN944126, JN944128,
JN944129, JN944130, JN944133, JN944135 – для участка, содержащего G5 и rps12).
15
Сравнительный
анализ
показал,
что
первичная
структура
этих
криптогенов оказывается крайне вариабельной как по наличию замен, так и
по количеству вставок\делеций не только Т, но и A, G и C. В ряде случаев
наблюдаются ди- и тринуклеотидные вставки. Типичное выравнивание
приведено на рис. 7.
Lrig
Ltar
Lmex
Linf
Ldon
Lcha
Lara
Ltur
Wpod
Lpyr
Lsey
-TGATA--AATAG-----AGTT--------GAGGTATTGGGGATGGGGTTTGCAGAGCGT
-AGGTC--GATAGGTATTAGTT--------TGGGGAGGAGGGAAAAAG--GGCAGAGCG-AGGTCTGAATAGGTATTTAGT--------TAGGAAAGAGGGAAAAAG--GGCAGAGCG--GGGC--AATTAGGATTAG----------TCGGGAAGAGGAAAAG----GGCAGAGCGAAGGTC--AATTAGGATTAG----------TCGGGAAGAGGGAAAAAG--GGCAGAGCG-AGGTC--AATTAGGATTAGT---------CGGGGAAGAGGGAAAAAG--GGCAGAGCG-AGGTC--AATAGGTGTTAGT---------TGGGAAAGAGGGAAAGAG--GGCAGAGCG-AGGTC-GATTAGGTATTAGTT--------TGGGAAAGAGGGAAAGAG--GGCAGAGCGTTAGTC--AATAGGCATGCAATAGGTGTGATGGGAAGGAGGGAAAGG---TGCAGAGCGA
ATGGTC--AATAGGCATGA-----------TTAGGAAGGTGGAAAGAG--CGCAGAGCGA
ATGGTC--AATAGGCATGA-----------TTAGGAAGGTGGAAAGAG--CGCAGAGCGA
*
* *
* *
********
[LLW]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[СД]
[СД]
[СД]
Lrig
Ltar
Lmex
Linf
Ldon
Lcha
Lara
Ltur
Wpod
Lpyr
Lsey
GTTGGGGCGGGGGAGACAGAACAC----GGGG-----GACATG-TTTGAAGGAGGAGGAG
G--GAGACGGGGGAGACAGAACAC----GAGATTGC-AAGAAG--TTCGCAGAAGGAGTT
G--GAGACAGGGGAGACAGAACAC----GAGATTATTAAGAAG-TTTCGCAAAGGGAGAC
G--GAGACAGGGGAGACAGAACAC----GAGACTATTAAGAAG--TTCGCAAAAAGGAAA
G--GAGACAGGGGAGACAGAACAC----GAGACTATTAAGAAG-TTTCGCAAAAGGAAAC
G--GAGACAGGGGAGACAGAACAC----GAGACTATTAAGAAG-TTTCGCAAAAGGAAAC
G--GAGACAGGGGAGACAGAACAC----GAAACTATTAAGAAGTTTTCGCAGAGGAGAAC
G--GAGACAGGGGAGACAGAACAC----GAGACTATTAAGAAG-TTTCGCAGAGGGGGAC
G--GAGGCAGGGAGGACAGAACTTTTCGGAGGATGAGAAGATG--------GGAGAGGAC
G--GAGGCAGGGAGGACAGAACAC----GAGAGGA--GAGATG--GACCGGGAGGGGGAC
G--GAGGCAGGGAGGACAGAACAC----GAGAGGA--GAGATG--GACCGGGAGGGGGAC
* * * * *** ********
*
* * *
[LLW]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[СД]
[СД]
[СД]
Lrig
Ltar
Lmex
Linf
Ldon
Lcha
Lara
Ltur
Wpod
Lpyr
Lsey
ATACCGTGAGAGGAGTGAGGAGAGGGGAGTGGATTTGGGATTGGTTGGGGTTGATTGA-TTACCTTTAAGGTTAAAAATAGGGGGG-AAGGAAAGGGGGGGAGAGGAGATTTGTAAAAG
C---TTTTAAGG--TTGAAGAAGGGGGGAAGGAAAAGGGAGGAAGAGGGA-TTGTTAAAA
CCTTTTTTAAGTCTTAAAAAAGGGGGAGAAGGAAGAGGGGGGGGAAGAGATTTGTTAAAA
CTTTTTTTAAGGTCTTAAAAAGGGGGAGAAGGAAGAGGGGGGGGAAGAGATTTGTTAAAA
CTTTTTTTAAGGTCTTAAAAAGGGGGAGAAGGAAGAGGGGGGGGAAGAGATTTGTTAAAA
C----TTTAAGGTTTTAAAAAAGGGGGGAAGGAAAAGGGGGGAGGAGGGATT-GTTAAAA
C----TTTAAGGTTTTAAAAAAGGGGGGAAGGAAAAGGGGGGAGAAGGGATTTGTTAAAA
C-------AAGGGAATTAAGAGGGAAGAAAGT--GGGGGATTAGGAGGGGAGGACCATAA
C-------AAGGAAGTTAATAGGGGAGAAAGTTGAGGGAAGATGAAGGGATAGGGCGTAA
C-------AAGGAAGTTAATAGGGGAGAAAGTTGAGGGAAGATGAAGGGATAGGGCGTAA
*
* * *
*
**
* *
[LLW]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[ЛЕЙ]
[СД]
[СД]
[СД]
Рис. 7. Множественное выравнивание криптогена G5 (фрагмент) видов из разных групп.
Ltar – Leishmania tarentolae (из GenBank); Lmex – Leishmania mexicana; Linf – L. infantum;
Ldon – L. donovani; Lcha – L. chagasi; Lara – L. arabica; Ltur – L. turanica; Lrig –
Leptomonas rigidus; Wpod – Wallaceina podlipaevi; Lpyr – Leptomonas pyrrhocoris; Lsey –
Leptomonas seymouri. Программа MUSCLE, параметры по умолчанию для сервера EMBLEBI.
16
Выборка
Фрагмент
максикольца
rps12
G5
G4
cyb(^)
COIII
9S
Представители всех
групп (1)
Только «слабодивергирующая»
группа (2)
Внутри рода
Leishmania (3)
0,528
0,605
0,798 (0,680^)
0,190
0,268
0,179
0,252
0,476
0,172
0,137
0,113
0,140
0,119
0,050
Таблица 1. Средняя генетическая дистанция между последовательностями, определенная
в программе MEGA 5.03 по алгоритму Tajima-Nei 1. Выборка, включающая
представителей всех групп: Leptomonas pyrrhocoris, Wallaceina podlipaevi (для 9S, G4
используется Leptomonas seymouri), Leptomonas collosoma, Wallaceina sp. Wsd, Leptomonas
rigidus, Leishmania turanica, Leishmania tarentolae (из GenBank), Trypanosoma brucei (из
GenBank) и в случае G4 также включает Herpetomonas muscarum и Herpetomonas pessoai.
2. Выборка видов из группы «слабодивергирующая» включает Leishmania tarentolae (из
GenBank), Leishmania turanica, Leptomonas pyrrhocoris, Leptomonas seymouri или
Wallaceina podlipaevi, Crithidia fasciculata (из GenBank). 3. Выборка представителей рода
Lieshmania включает Leishmania tarentolae (из GenBank), Leishmania turanica, Leishmania
arabica, Leishmania chagasi, Leishmania mexicana. ^ - взята часть криптогена, не входящая
в состав РД.
В таблице 1 приведены значение средней генетической дистанции по
алгоритму Tajama-Nei для выбранных участков максикольца равной длины.
Средняя генетическая дистанция для полностью редактируемых участков
оказывается в 3 и более раз выше, чем у других участков максикольца (для
сравнения взяты cyb и 9S). Высокая степень вариабельности этих
последовательностей может объясняться тем, что они редактируются гРНК
миникольцевого происхождения. Соотношение числа копий гена гРНК к
криптогену на максикольце в таком случае составляет около 100:1.
Многократное преобладание числа копий гРНК открывает возможность для
мутационной изменчивости, делая последовательность максикольца более
пластичной.
17
Рис. 8. Альтернативное редактирование rps12 Wallaceina sp. Wsd. rps12 - мРНК rps12;
alt12 - альтернативный вариант мРНК, содержащий белок без явных гомологий в базах
данных. Полужирным курсивным шрифтом показан альтернативно редактируемый
участок. Крестом вычеркнут дискриминирующей динуклеотид AG, отсутствующий у alt12
клонов.
Отредактированные мРНК G4 и rps12 T.brucei содержат по две
перекрывающиеся рамки считывания (Corell et al., 1994; Read et al., 1992), а
G5 T.brucei (Read et al., 1994b), rps12 L.tarentolae (Sturm et al., 1992) и ND9 L.
mexicana (Maslov, 2010) подвергаются альтернативному редактированию.
Гетерогенность максикольцевого генома в участке дивергентной области
была продемонстрирована нами в работе Flegontov et al (2009). Мы
предполагаем, что гетерогенность максиколец в кодирующей области,
особенно в участках полностью редактируемых криптогенов, играет
важнейшую роль и тесно связана с альтернативным редактированием. В
данной
работе
мы
впервые
продемонстрировали
альтернативное
редактирование rps12 Wallaceina sp. Wsd. Сравнение альтернативной и
18
«нормальной» отредактированных мРНК приведено на рис. 8. Зачеркнутая
крестом
динуклеотидная
вставка
AG
отсутствует
в
альтернативно
редактируемых клонах и является гетерогенным сайтом, обеспечивающим
переключение на альтернативную гРНК.
Три типа структурной организации криптогенов трипаносоматид
На основании полученных в работе результатов, а также анализа
имеющихся в базах данных последовательностей, мы выделили три типа
криптогенов на основании их структуры: криптогены, у которых происходит
редукция длины РД (A6,COIII, ND8); криптогены с консервативной
структурой короткого РД (cyb, ND7, MURF2, COII) и полностью
редактируемые криптогены с вариабельной структурой (rps12, G4,G5). В
работе мы обсуждаем возможные причины формирования того или иного
типа структуры РД.
На рис. 9 приведена карта максикольца, типичная для C. fasciculata и L.
tarentolae, из которой видно, что криптогены с консервативными короткими
РД
редактируются,
по-видимому,
только
гРНК
максикольцевого
кодирования, поэтому утрата генов таких гРНК (в отличие от генов гРНК,
расположенных
на
миникольцах)
оказывается
маловероятной.
Это
препятствует закреплению ретропозиции в эволюции данных криптогенов.
Мы предполагаем, что максикольцевое расположение гРНК является
основным фактором, определяющим эволюцию структуры криптогенов cyb,
ND7, COII, MURF2. Заметим также, что по данным Gao et al. [2001] у
L.tarentolae
гРНК,
редактирующая
5’
РД
ND8
является
гРНК
максикольцевого кодирования, а в группе «LLW» именно эта часть РД ND8
не утрачивается.
Большинство полностью редактируемых криптогенов имеют гРНК
миникольцевого
происхождения.
Во
многих
случаях
известно
альтернативное редактирование транскриптов этих участков. Мы полагаем,
что существование альтернативных продуктов препятствует ретропозиции у
19
криптогенов этого типа, поэтому они остаются полностью редактируемыми,
пока
оба
продукта
необходимы
для
жизни
клетки.
По-видимому,
вариабельные участки максикольца, содержащие эти криптогены, сильно
гетерогенны внутри ассоциата кпДНК одной клетки. Гетерогенность
ассоциата и смена доминирующих классов максиколец на разных стадиях
жизненного цикла показана нами в работе Flegontov et al., (2009), в данном
случае мы также показали существование двух классов максиколец W. sp.
Wsd, отличающихся наличием AG в криптогене rps12. Существование
разных классов максиколец, имеющих различие в кодирующей области, в
сочетании со сменой соотношения разных классов максиколец в ассоциате
может
являться
мощным
механизмом
переключения
экспрессии
«альтернативной» и «нормальной» форм криптогена.
Криптогены, утратившие необходимость кодирования альтернативного
продукта, такие как COIII (альтернативный белок AEP-I образуется только у
T. brucei), и не имеющие гРНК максикольцевого кодирования, претерпевают
редукции РД путем ретропозиции: A6, COIII, ND8. Однако в ряде случае
(минимально редактируемый ген ND8, A6) РД полностью не утрачивается.
Для ND8 причину формирования минимально редактируемого гена мы
обсуждали выше. На рис. 9 приведены места локализации максикольцевых
транскриптов, выявленных Madej et al, [2007], являющихся олиго(U)-гРНК
подобными РНК. Для некоторых из них точки начала транскрипции
совпадают с 5’ границами РД (А6, ND7, cyb). Функция гРНК-подобных
транскриптов на сегодня остается неясной и, возможно, окажется не
связанной с редактированием, но их присутствие в митохондриальном
геноме может влиять на эволюцию структуры занимаемых ими локусов
максикольца, в частности, РД ряда криптогенов.
20
Рис. 9. Смеха максикольца типичного представителя «слабодивергирующей» группы,
например, Leishmania tarentolae и Crithidia fasciculata. Белыми стрелками показаны РД.
Черным - нередактируемые участки. Вертикальными белыми стрелками отмечены гены
гРНК максикольцевого кодирования. Пунктирными стрелками указаны криптогенымишени. Горизонтальными тонкими стрелками показаны максикольцевые транскрипты,
выявленные Madej et al., [2007].
21
ВЫВОДЫ
1. По структуре и длине редактируемого домена криптогены
митохондриального генома трипаносоматид могут быть объединены в
три группы: 1) криптогены с редукцией длины редактируемого домена,
2) криптогены с короткими консервативными редактируемыми
доменами и 3) криптогены с вариабельной первичной структурой,
транскрипты которых редактируются по всей длине (вариабельные
полностью редактируемые криптогены).
2. Виды, криптогены которых претерпевают определенную степень
редукции длины РД (5’ редактируемая форма, минимально
редактируемый ген) объединяются на филогенетическом дереве в
разные группы.
Редукция длины редактируемых доменов криптогенов A6, COIII, ND8
происходит согласованно в группах LLW и эндосимбионт-содержащих
видов.
3. Структура криптогенов с короткими консервативными РД коррелирует
с максикольцевым кодированием генов гРНК, необходимых для
редактирования этих криптогенов.
4. Для полностью редактируемых криптогенов с вариабельной
структурой характерны преимущественно миникольцевая локализация
генов гРНК и альтернативное редактирование транскриптов.
22
СПИСОК ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ
1) Gerasimov E.S., Kostygov A.Yu., Shi Yan, Kolesnikov A.A. From cryptogene to gene?
ND8 editing domain reduction in insect trypanosomatids. // Europ. J. Protistol. 2012. V. 48
P. 185-193.
2) Flegontov P.N., Zhirenkina E.N., Gerasimov E.S., Ponirovsky E.N., Strelkova M.V.,
Kolesnikov A.A. Selective amplification of maxicircle classes during the life cycle of
Leishmania major. // Mol. Biochem. Parasitol. 2009. V. 165. P. 142-152.
3) Герасимов Е.С., Ефимова Н.С., Колесников А.А. Три типа структурной организации
криптогенов трипаносоматид. // Молекулярная биология. 2012. Том 46. С. 612-621.
4) Kolesnikov A.A., Gerasimov E.S. Persistent structures of trypanosomatid cryptogene editing
domains. // Protist-2012 Conference Materials. 2012. P. 25.
5) Gerasimov E.S., Kostygov A.Y., Shi Yan, Kolesnikov A.A. Reduction of editing domain
length in mitochondrial genes of insect trypanosomatids and their molecular phylogeny.//
Materials on the European Congress of Protistology. 2011.
6) Герасимов Е.С., Ефимова Н.С. Максикольцевая локализация генов гРНК: образование
эволюционно
стабильных
структур
редактируемых
доменов
криптогенов
трипаносоматид. // Материалы Международного молодежного научного форума
«Ломоносов-2012». 2012. C. 185-186.
7) Мерцалов
Г.В.,
Герасимов
Е.С.
Исследование
редактирования
первичных
транскриптов криптогенов G4 и rps12 у простейших семейства Trypanosomatidae. //
Материалы Международного молодежного научного форума «Ломоносов-2012». 2012.
C. 189.
23
Документ
Категория
Биологические науки
Просмотров
26
Размер файла
1 348 Кб
Теги
кандидатская
1/--страниц
Пожаловаться на содержимое документа