close

Вход

Забыли?

вход по аккаунту

?

МЕХАНИЗМЫ АНТИБИОТИКОРЕЗИСТЕНТНОСТИ И МОЛЕКУЛЯРНАЯ ЭПИДЕМИОЛОГИЯ НОЗОКОМИАЛЬНЫХ ШТАММОВ SALMONELLA ENTERICA СЕРОВАР TYPHIMURIUM

код для вставкиСкачать
ФИО соискателя: Козырева Варвара Константиновна Шифр научной специальности: 03.02.03 - микробиология Шифр диссертационного совета: Д 208.130.01 Название организации: Научно-исследовательский институт эпидемиологии и микробиологии имени почетного ака
 На правах рукописи
КОЗЫРЕВА ВАРВАРА КОНСТАНТИНОВНА
МЕХАНИЗМЫ АНТИБИОТИКОРЕЗИСТЕНТНОСТИ И МОЛЕКУЛЯРНАЯ ЭПИДЕМИОЛОГИЯ НОЗОКОМИАЛЬНЫХ ШТАММОВ SALMONELLA ENTERICA СЕРОВАР TYPHIMURIUM
03.02.03 - микробиология
АВТОРЕФЕРАТ
диссертация на соискание ученой степени
кандидата биологических наук
Москва -2012
Работа выполнена в НИИ антимикробной химиотерапии ГБОУ ВПО "Смоленская государственная медицинская академия" Министерства здравоохранения и социального развития Российской Федерации.
Научный руководитель: доктор медицинских наук, профессор, Козлов Роман Сергеевич Официальные оппоненты: доктор медицинских наук, Игорь Андроникович Шагинян, заведующий лабораторией молекулярной эпидемиологии госпитальных инфекций ФГБУ "Научно-исследовательский институт эпидемиологии и микробиологии имени почетного академика Н.Ф.Гамалеи" Министерства здравоохранения и социального развития Российской Федерации.
доктор медицинских наук, профессор, Кветная Ася Степановна, руководитель отдела микроэкологии человека ФГБУ "Научно-исследовательский институт детских инфекций ФМБА России".
Ведущая организация:
ГБОУ ВПО "Самарский государственный медицинский университет" Министерства здравоохранения и социального развития Российской Федерации.
Защита состоится " " 2012 г. на заседании диссертационного совета Д 208.130.01 ФГБУ "Научно-исследовательский институт эпидемиологии и микробиологии имени почетного академика Н.Ф.Гамалеи" Министерства здравоохранения и социального развития Российской Федерации, 123098, г. Москва, ул. Гамалеи, д. 18.
С диссертацией можно ознакомиться в библиотеке ФГБУ "Научно-исследовательский институт эпидемиологии и микробиологии имени почетного академика Н.Ф.Гамалеи" Министерства здравоохранения и социального развития Российской Федерации.
Автореферат разослан "____" ___________________2012г.
Ученый секретарь диссертационного совета: доктор медицинских наук, профессор Е.В.Русакова.
Актуальность проблемы. Сальмонеллез является актуальной проблемой здравоохранения для всех стран без исключения: это миллионы случаев заражения и тысячи смертей в год по всему миру [WHO, 2005]. Клиническое проявление инфекции, вызванной нетифоидными сальмонеллами вида S. enterica подвид I, может сильно варьировать: от бессимптомного носительства и нетяжелой диареи, не требующей антимикробной терапии, до тяжелой инвазивной инфекции, когда назначение антимикробных препаратов является необходимым [Darby, 2008]. Большая часть таких осложнений приходится на долю нозокомиальных инфекций [Campo, 1997; Fernandez Guerrero, 1997; Benca, 2007]. Штаммы сальмонелл, распространяющиеся в госпитальной среде, как правило, отличаются от внебольничных изолятов множественной лекарственной устойчивостью (полирезистентностью). При этом, более чем в 80% случаев нозокомиальная форма сальмонеллеза вызвана штаммами серотипа Typhimurium [Акимкин, 2002; Акимкин, 2010].
На фоне глобального роста резистентности S. Typhimurium к ампициллину, ко-тримоксазолу, хлорамфениколу, тетрациклину, сульфаниламидам и ряду других антимикробных препаратов [Targant, 2010; dos Reis, 2011; Yu, 2011] особенно большую тревогу вызывает появление и распространение полирезистентных штаммов, устойчивых также к цефалоспоринам III поколения (цефотаксиму, цефтриаксону) и фторхинолонам- препаратам выбора для лечения инвазивных сальмонеллезов [Arlet, 2006; Butaye, 2006].
До недавнего времени было несколько сообщений о распространении резистентных к цефалоспоринам S. Typhimurium в России и Беларуси. Крупные вспышки нозокомиального сальмонеллеза, вызванного полирезистентными штаммами были зарегистрированы в 1994-2003 гг. в Москве, Санкт-Петербурге, Смоленской, Минской, Гомельской, Гродненской и Витебской областях Эйдельштейном и соавт. В Гомельской области выделение цефотаксиморезистентных штаммов, продуцирующих -лактамазы расширенного спектра действия (БЛРС) CTX-M-5, отмечалось позднее в 2007 г и было зафиксировано Тапальским и соавт. Клональное распространение полирезистентных штаммов S. Typhimurium в разных странах и регионах мира широко описано в литературе [Butaye, 2006; Wasyl, 2006; Yu, 2011], однако, популяционная структура и эпидемиология нозокомиального сальмонеллеза, вызванного штаммами с множественной резистентностью, в России и соседних странах мало изучена.
Цель работы- Определить особенности молекулярной эпидемиологии и механизмы антибиотикорезистентности цефотаксимоустойчивых нозокомиальных штаммов S. Typhimurium, выделявшихся в ходе спорадических вспышек в стационарах на территории России, Беларуси и Казахстана с 1996 по 2009 гг.
Задачи исследования: 1. Оценить генетические связи между цефотаксиморезистентными нозокомиальными штаммами S. Typhimurium, выделенными на территории Российской Федерации и сопредельных государств, с помощью методов молекулярно-генетического типирования (мультилокусного секвенирования-типирования (MLST), мультилокусного анализа тандемных повторов (MLVA) и пульс-электрофореза макрорестрикционных фрагментов геномной ДНК (PFGE)).
2. Выявить генетические детерминанты, ответственные за формирование резистентности штаммов S. Typhimurium к -лактамам и хинолонам.
3. Определить локализацию генов приобретенных -лактамаз и их связь с мобильными генетическими элементами.
4. Исследовать штаммы S. Typhimurium на наличие фенотипа гипермутабельности и оценить частоту возникновения мутаций резистентности к хинолонам.
Научная новизна. В представленной работе впервые:
1. установлена клональность цефотаксиморезистентных нозокомиальных штаммов Salmonella enterica серовар Typhimurium, выделяемых на территории России, Беларуси и Казахстана, с использованием современных методов молекулярной эпидемиологии;
2. выявлены механизмы и распространение резистентности к -лактамам и хинолонам у штаммов, вызвавших вспышки нозокомиального сальмонеллеза в России, Беларуси и Казахстане;
3. охарактеризованы неизвестные ранее неавтоконъюгативные CTX-M-5-кодирующие плазмиды, специфичные для описанной клональной группы S. Typhimurium.
4. показана гипермутабельность штаммов S. Typhimurium, циркулирующих в больничной среде на территории России и сопредельных государств. Практическая значимость результатов. Результаты исследования позволили выявить клональный характер распространения нозокомиальных цефотаксиморезистентных штаммов S. Typhimurium, продуцирующих БЛРС-ферменты CTX-M-5 типа, что позволяет сформировать рекомендации по рутинному определению чувствительности штаммов S. Typhimurium, выделяемых в стационарах, к цефалоспоринам III поколения, а также обосновать необходимость использования в практике современных генетических методов субвидового типирования для обеспечению должного контроля за распространением опасных клонов сальмонелл. Полученные данные по распространенности и механизмам резистентности изолятов S. Typhimurium к хинолонам, а также факт выявленной гипермутабельности у внутрибольничных штаммов дают возможность оптимизировать определение чувствительности S. Typhimurium к фторхинолонам и прогнозировать риск неэффективности фторхинолонов при терапии инфекций, вызванных штаммами, проявляющими фенотип гипермутабельности.
Связь работы с научными программами. Диссертация выполнена по плану НИР ГБОУ ВПО "Смоленская государственная медицинская академия" Минздравсоцразвития России (№ гос. регистрации ВНТИЦ 01200951949). Основные положения, выносимые на защиту:
1. Вспышки нозокомиального сальмонеллеза на территории России, Беларуси и Казахстана с 1996 по 2009 гг. были вызваны клонально родственными цефотаксиморезистентными штаммами S. Typhimurium.
2. Резистентность к цефалоспоринам III-IV поколений у нозокомиальных штаммов S. Typhimurium обусловлена продукцией b-лактамазы расширенного спектра действия CTX-M-5, ген которой находится в сцеплении с мобильным элементом ISEcp1 на небольшой неконъюгативной, но мобилизируемой плазмиде.
3. Механизмом устойчивости нозокомиальных штаммов S. Typhimurium к хинолонам является возникновение мутаций области, определяющей устойчивость к хинолонам (QRDR), гена субъединицы А ДНК-гиразы (gyrA).
4. Независимое приобретение мутаций резистентности к хинолонам разными членами описанной клональной группы является следствием гипермутабельности изолятов.
Внедрение результатов работы в практику. Результаты исследования внедрены в практику работы микробиологической лаборатории Федерального бюджетного учреждения здравоохранения "Центр гигиены и эпидемиологии в Смоленской области" (г. Смоленск) в форме информационного письма "Рекомендации по эпидемиологическому типированию и определению чувствительности к цефалоспоринам III-IV поколений и хинолонам нозокомиальных штаммов Salmonella enterica серовар Typhimurium", утвержденного в 2011 году. Выпущенное в 2012 году на основании результатов работы информационное письмо "О внедрении новых методических подходов в практику определения антибиотикочувствительности и эпидемического типирования возбудителей нозокомиального сальмонеллеза Salmonella enterica серовар Typhimurium" явилось основой для внедрения соответствующих практических рекомендации в работу лабораторий антибиотикорезистентности и клинической бактериологии НИИ антимикробной химиотерапии ГБОУ ВПО СГМА Минздравсоцразвития России. Также результаты работы внедрены в учебный процесс кафедры микробиологии ГБОУ ВПО СГМА Минздравсоцразвития России и используются в программах циклов повышения квалификации врачей-бактериологов и семинарах для практических врачей, проводимых в НИИ антимикробной химиотерапии ГБОУ ВПО СГМА Минздравсоцразвития России.
Апробация работы. Результаты исследования представлены на 18-ом Европейском конгрессе по клинической микробиологии и инфекционным заболеваниям (Барселона, 2008); Заседаниях проблемной комиссии по иммунологии, иммуноморфологии и иммунопатофизиологии ГБОУ ВПО "Смоленская государственная медицинская академия" Министерства здравоохранения и социального развития Российской Федерации (Смоленск, 2008, 2012); X Международном конгрессе по антимикробной химиотерапии (Москва, 2008); XVI Российском национальном конгрессе "Человек и лекарство" (Москва, 2009); XI Международном конгрессе МАКМАК/ESCMID по антимикробной терапии (Москва, 2009); Республиканской конференции "Современные принципы рациональной антибиотикотерапии" (Якутск, 2009); XVII Российском национальном конгрессе "Человек и лекарство" (Москва, 2010); Межрегиональной научно-практической конференции "Современная антибиотикотерапия в клинической практике" (Саратов, 2010); XII Международном конгрессе МАКМАХ/ESCMID по антимикробной терапии (Москва, 2010); Региональной конференции "Современные подходы к лечению сепсиса" (Минск, 2010); III Ежегодном Всероссийском Конгрессе по инфекционным болезням (Москва, 2011); XIX Российском национальном конгрессе "Человек и лекарство" (Москва, 2012); Конференции "Безопасность и эффективность антимикробной терапии: уроки доказательной медицины" (Санкт-Петербург, 2012); Международной научно-практической конференции "Молекулярно-генетические методы исследования в медицине и биологии" (Караганда, 2012); 52-ой Междисциплинарной конференции по антимикробным препаратам и химиотерапии (Сан-Франциско, 2012); на совместном заседании сотрудников кафедр микробиологии, инфекционных болезней с эпидемиологией, инфекционных болезней у детей, поликлинической педиатрии, факультетской терапии, ЦНИЛ и НИИАХ ГБОУ ВПО "Смоленская государственная медицинская академия" Министерства здравоохранения и социального развития Российской Федерации (Смоленск, 2012).
Публикации. По материалам диссертации опубликовано 9 научных работ: 4- в зарубежной и 5- в отечественной печати (из них 2 работы опубликовано в рецензируемых ВАК журналах). Структура и объем работы. Диссертация изложена на 116 страницах машинописного текста и содержит следующие разделы: введение, обзор литературы, собственные исследования (материалы и методы, результаты, обсуждение), выводы, практические рекомендации и список литературы. Работа иллюстрирована 10 рисунками и 4 таблицами. Список литературы состоит из 207 источников, из них 48 отечественных и 159 иностранных. СОДЕРЖАНИЕ РАБОТЫ
МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ
Клинические штаммы Salmonella Typhimurium. Первичная видовая и серологическая идентификация клинических нозокомиальных штаммов Salmonella enterica подвид enterica серовар Typhimurium проводилась в локальных микробиологических лабораториях в соответствии с принятыми стандартами. Повторно все штаммы идентифицировались в НИИ антимикробной химиотерапии ГБОУ ВПО СГМА Минздравсоцразвития России с помощью биохимических идентификационных систем API20E (bioMerieux) и наборов сывороток к О- и Н-антигенам Salmonella (BioRad).
Определение чувствительности к антибиотикам. Значения минимальной подавляющей концентрации (МПК) антибиотиков были определены с помощью метода последовательных разведений в агаре Мюллера-Хинтон [CLSI, 2012] для следующих препаратов: ампициллин, амоксициллин-клавулановая кислота (2:1), азтреонам, цефотаксим, цефотаксим-клавулановая кислота (4 мг/л), цефтазидим, цефтазидим-клавулановая кислота (4 мг/л), цефепим, цефоперазон, цефоперазон-сульбактам (1:1), пиперациллин, пиперациллин-тазобактам (4 мг/л), гентамицин, ко-тримоксазол, имипенем, меропенем, эртапенем, дорипенем, налидиксовая кислота, ципрофлоксацин (табл. 1). Таблица 1
Критерии интерпретации чувствительности сальмонелл к антибиотикам по значению МПК.
АнтибиотикКритерии интерпретации чувствительности (МПК)Организация, выпустившая рекомендации; редакция нормативного документа"Ч" , мг/л"Р" ≥, мг/лАмпициллин 8 16 EUCAST; версия 2.0Амоксициллин-клавулановая к-та8/432/16CLSI; 2012Пиперациллин 8 32 EUCAST; версия 2.0Пиперациллин-тазобактам 8 32 EUCAST; версия 2.0Цефотаксим 1 4 EUCAST; версия 2.0 Цефотаксим-клавулановая к-та нет критериев интерпретации Цефтазидим 1 8 EUCAST; версия 2.0 Цефтазидим-клавулановая к-та нет критериев интерпретацииЦефепим 1 8 EUCAST; версия 2.0Азтреонам 18EUCAST; версия 2.0Имипенем 216EUCAST; версия 2.0Дорипенем 18EUCAST; версия 2.0Меропенем 216EUCAST; версия 2.0Эртапенем0,52EUCAST; версия 2.0Гентамицин 28EUCAST; версия 2.0Ко-тримоксазол 28EUCAST; версия 2.0Налидиксовая к-та 1632CLSI; 2012Ципрофлоксацин0,060,12EUCAST; версия 2.0Хлорамфеникол 816EUCAST; версия 2.0Тетрациклин 416CLSI; 2012
Чувствительность к тетрациклину и хлорамфениколу была определена с помощью диск-диффузионного метода [CLSI, 2012]. Для контроля качества определения чувствительности были использованы штаммы E. coli ATCC(r)25922 и E. coli ATCC(r)35218. Продукция БЛРС оценивалась с помощью фенотипических тестов, основанных на эффекте подавления активности БЛРС в отношении оксиимино--лактамов в присутствии клавулановой кислоты: методом двойных дисков [CLSI, 2012], а также по снижению МПК цефотаксима или цефтазидима в присутствии клавулановой кислоты (4 мг/л) не менее чем в 8 раз. При выявлении БЛРС методом двойных дисков использовали 18-24-часовые культуры микроорганизмов, выращенные на агаризованных средах. Суспензии микроорганизмов плотностью 0,5 по стандарту МакФарланда, готовили в стерильном изотоническим растворе хлорида натрия (0,9%) и наносили плотным газоном на поверхность агара Мюллера-Хинтон (BBL). После этого на инокулированную поверхность агара в центр чашки помещали диск с амоксицилином/клавулановой кислотой (AmC 20/10 мкг), а на расстоянии 20 мм и 30 мм от него - диски с цефтазидимом (CAZ 30 мкг) и цефотаксимом (СТХ 30 мкг, BBL) (по два диска с каждым антибиотиком на разных расстояниях). Результаты теста учитывали после инкубации в течении 18-20 ч при 35°С. О продукции БЛРС судили по наличию расширения зон подавления роста между дисками с цефалоспоринами III поколения и диском, содержащим клавулановую кислоту.
Детекция генов -лактамаз и их генетического окружения. Гены -лактамаз, принадлежащих к группам OXA-1, TEM, SHV и CTX-M определяли с помощью ПЦР в реальном времени с праймерами, перечисленными в таблице 2 [Mabilat, 1993; Nuesch-Inderbinen, 1997; Edelstein, 2004; Степанова, 2011]. Таблица 2
Использованные праймеры и условия амплификации
№Наименование праймераПоследовательность (5'-3')НазначениеУсловия амплификации1TEM fwdgcaaatatgtatccgctcatgagacaataaccblaTEM 1) 95- 15 мин
2) 35 циклов: 95- 20 сек, 56- 30 сек, 72- 45 сек
3) 72- 2 мин2TEM revgacagttaccaatgcttaatca3SHV fwdcgccgggttattcttatttgtcgcblaSHV 1) 95- 15 мин
2) 37 циклов: 95- 30 сек, 72- 90 сек
3) 72- 3 мин4SHV revtctttccgatgccgccgccagtca5OXA-1 fwdatgaaaaacacaatacatatcaacblaOXA-1 1) 95- 15 мин
2) 40 циклов: 95- 20 сек, 58- 20 сек,72- 30 сек
3) 72- 3 мин6OXA-1 revaaaggacattcacgcctgtg Продолжение таблицы 2
7CTX-M-FexttttgcgatgtgcagtaccagtaablaCTX-M 1) 95- 15 мин
2) 40 циклов: 95- 15 сек,
58- 20 сек, 72- 15 сек
3) 72- 2 мин8CTX-M-R1cccgctgccggtcttatc9CTX-M(1-2)-RNesttgatctcaacgcgctgattta10CTX-M-RextcgatatcgttggtggtgccataГенетическое окружение blaCTX-M 1) 95- 15 мин
2) 40 циклов: 95- 20 сек,
58- 20 сек, 72- 30 сек
3) 72- 3 мин11ISEcp1-Ftgtctggtataataagaatatcatc12ORF513atccatcacagagtcgtctc13STGYRA1tgtccgagatggcctgaagcПЦР и секвенирование QRDR GyrA 1) 95- 15 мин
2) 40 циклов: 95- 20 сек,
64- 30 сек, 72- 60 сек
3) 72- 3 мин14STGYRA12-GTcgttgatgacttccgtcaggt15pCTXM5-FgacacagagaagttgataggcgaТипирование CTX-M-5-кодирующих плазмид 1) 95- 15 мин
2) 30 циклов: 95- 20 сек,
62- 30 сек, 72- 45 сек
3) 72- 2 мин16pCTXM5-Rttccaaatagatccacggtgac17STTR3-F R6GR6G-ccccctaagcccgataatggMLVA типирование1) 95- 15 мин
2) 30 циклов: 95- 30 сек,
63- 30 сек, 72- 30 сек
3) 72- 15 мин18STTR3-Rtgacgccgttgctgaaggtaataa19STTR6-F FAMFAM-tcgggcatgcgttgaaa20STTR6-Rctggtggggagaatgactgg21STTR5-F R6GR6G-atggcgaggcgagcagcagt22STTR5-Rggtcaggccgaatagcaggat23STTR9-F FAMFAM-agaggcgctgcgattgacgata24STTR9-Rcattttccacagcggcagtttttc25STTR10pl-F ROXROX-cgggcgcggctggagtatttg26STTR10pl-Rgaaggggccgggcagagacagc27thrA_seq_FatcccggccgatcacatgatMLST типирование1) 95- 15 мин
2) 40 циклов: 95- 20 сек,
55- 30 сек, 72- 60 сек
3) 72- 5 мин28thrA_seq_Rctccagcagcccctctttcag29aroC_Fcctggcacctcgcgctatac30aroC_sRcatatgcgccacaatgtgttg31dnaN_Fatgaaatttaccgttgaacgtga32dnaN_sRccatccaccagcttcgaggt33hemD_F1gaagcgttagtgagccgtctgcg34hemD_Ratcagcgaccttaatatcttgcca35hisD_sFgtcggtctgtatattcccgg36hisD_sRggtaatcgcatccaccaaatc37purE_Fatgtcttcccgcaataatcc38purE_R1cgagaacgcaaacttgcttc39sucA_Fagcaccgaagagaaacgctg40sucA_Rggttgttgataacgatacgtac Для выявления ассоциации генов blaCTX-M с известными мобильными элементами: ISEcp1 или ISCR1 (ранее описанным как orf513) использовали ПЦР-картирование [Edelstein, 2004]. В ПЦР смеси объемом 25 мкл стандартно использовали 0,2мМ дНТФ, 0,5 мкМ каждого праймера, 1,5мМ MgCl2, 2,5 Ед TaqF ДНК-полимеразы, 1x ПЦР-буфер (67 мМ Tris-HCl (pH=8,3), 17 мМ сульфат аммония, 0,1% Tween-20, 0,12 мг/мл БСА, 8% глицерин) (ИнтерЛабСервис), 1 мкл раствора 1:1000 SYBR Green I в ДМСО (Amresco) и 2 мкл образца ДНК, выделенной с помощью наборов InstaGene Matrix (Bio-Rad, США) в соответствии с протоколом производителя. Секвенирование полученных ПЦР-продуктов проводилось с помощью амплификационных праймеров, наборов BigDye(r) Terminator v3.1 Cycle Sequencing Kit и генетического анализатора ABI Prism(r) 310 (Applied Biosystems).
Определение мутаций в QRDR области гена gyrA. Амплификацию и прямое секвенирование внутреннего фрагмента гена gyrA проводили с помощью праймеров STGYRA1 и STGYRA12-GT (табл. 2) [Nakaya, 2003].
Анализ плазмид, несущих blaCTX-M гены. Конъюгационный перенос плазмид от исследуемых штаммов в реципиентный штамм E.coli AB1456 (RifR) [Kholodii, 2000] проводился при совместном культивировании клеток донора и реципиента в бульоне Мюллера-Хинтон с последующим рассевом на плотные среды, содержащие рифампицин (100 мг/л) в комбинации с ампициллином (100 мг/л) или цефотаксимом (1 мг/л). Эффективность конъюгации рассчитывали как отношение количества колоний трансконъюгантов на чашках с комбинацией двух антибиотиков к количеству колоний реципиента на чашках с рифампицином.
CTX-M-кодирующие плазмиды были выделены у исследованных штаммов и их трансконъюгантов с помощью наборов Plasmid Midi Kit (QIAGEN). Полученной плазмидной ДНК был трансформирован компетентный лабораторный штамм E. coli EPI300. Рестрикционный анализ плазмид, повторно выделенных от трансформантов, проводили с помощью эндонуклеаз PstI (Promega) и PvuII (Amersham), которые использовали в соотношении 10 Ед на 1мкг ДНК и инкубировали 3 ч при 37С. Концентрацию ДНК определяли спектрофотометрически на приборе Ultraspec 3000 (Pharmacia Biotech). Продукты рестрикции разделяли электрофорезом в 1% агарозном геле.
Плазмиды, по одной из каждого описанного рестрикционного профиля, были выделены от трансформантов и секвенированы с помощью генетического анализатора ABI Prism(r) 3730 Genetic Analyzer (Applied Biosystems) и набора BigDye(r) Terminator v.3.1 Cycle Sequencing Kit для Сэнгеровской реакции на базе лаборатории молекулярной генетики микроорганизмов ФГУ "Научно-исследовательский институт физико-химической медицины" ФМБА России. Предсказание генов в последовательности отсеквенированных плазмид выполнено с помощью программного обеспечения Artemis Version 8 (Sanger Institute). Выравнивание нуклеотидных последовательностей выполнено в программе CLC Main Workbench v 5.7.1 (CLC bio) и путем поиска гомологий BLASTN и BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
ПЦР-типирование CTX-M-кодирующих плазмид выполнено с праймерами pCTXM5-F и pCTXM5-R (табл. 2), специфичными учаcтку гипотетической открытой рамки считывания ORF-X, которая является частью консервативного каркаса плазмид, кодирующих CTX-M-5 БЛРС (координаты мишени для амплификации в последовательности # JX017306 в базе данных GenBank: 3393-4226пн). Реакционная ПЦР-смесь общим объемом 25мкл содержала 0,5мкМ каждого из праймеров, 1,5 Ед TaqF ДНК-полимеразы (AmpliSens), 1,5мМ MgSO4, 0,2мМ каждого из дНТФ, 1мкл раствора 1:1000 SYBR Green I в ДМСО (Amresco), коммерческий 1x ПЦР-буфер (ИнтерЛабСервис) и 2мкл тотальной геномной ДНК, выделенной с помощью InstaGene Matrix (BIO-RAD). ПЦР реакция проводилась на термоциклере RotorGene 2000 (Corbett Research).
Типирование изолятов с помощью пульс-электрофореза макрорестрикционных фрагментов геномной ДНК (PFGE). Для анализа использовали наборы для выделения геномной ДНК GenePath Group 6 Reagent Kit (Bio-Rad). Геномная ДНК была подвергнута рестрикции эндонуклеазой XbaI (MBI Fermentas) [Struelens, 1993]. Разделение фрагментов ДНК проводили на приборе CHEF DRIII (Bio-Rad) в 1% агарозном геле (PFGE Agarose; Bio-Rad) и 1x ТВЕ буфере (44,5 мМ Трис, 44,5 мМ борная кислота, 1 мМ ЭДТА-Na2) в течении 22 ч при температуре 10°С, угол 120°, градиент 6 В/см, начальное время переключения поля 2,16 сек, финальное время переключения 54,17 сек. Гели окрашивали в растворе бромистого этидия (0,5мкг/мл). Типирование изолятов с помощью мультилокусного анализа тандемных повторов (MLVA) выполнено с детекцией по пяти VNTR локусам (STTR3, STTR5, STTR6, STTR9, STTR10pl) [Lindstedt, 2004] (табл. 2). Реакционная ПЦР-смесь общим объемом 10мкл содержала 0,5мкМ каждого из праймеров, 1 Ед TaqF ДНК-полимеразы (AmpliSens), 1,5мМ MgSO4, 0,2мМ каждого из дНТФ, 1x ПЦР-буфер (ИнтерЛабСервис) и 1мкл тотальной геномной ДНК. Анализ соответствующих флуоресцентно-меченых ПЦР-продуктов был проведен с помощью генетического анализатора ABI Prism(r) 310 и программного обеспечения Peak Scanner Software v.1.0 (Applied Biosystems). Кластерный анализ MLVA-профилей выполнен с помощью программного пакета BioNumerics Software v.6.1 (Applied Maths) с использованием алгоритма минимального остовного дерева (minimum spanning tree, MST) для категориальных значений.
Типирование изолятов с помощью мультилокусного секвенирования-типирования (MLST) проводилось по семи генам "домашнего хозяйства" (aroC, dnaN, hemD, hisD, purE, sucA, thrA) в соответствии с стандартной схемой MLST-типирования (http://mlst.ucc.ie). Для амплификации и секвенирования использовались единые праймеры (табл. 2). В состав ПЦР-смеси общим объемом 25мкл входили: 0,5мкМ каждого из праймеров, 2,5 Ед TaqF ДНК-полимеразы (AmpliSens), 1,5мМ MgSO4, 0,2мМ каждого из дНТФ, 1x ПЦР-буфер (ИнтерЛабСервис) и 2мкл геномной ДНК [Harbottle, 2006]. Секвенирование полученных ПЦР-продуктов выполнено на генетическом анализатора ABI Prism(r) 310 (Applied Biosystems). Анализ последовательностей секвенированных фрагментов и идентификация аллелей выполнен с помощью программного пакета BioNumerics Software v6.1(Applied Maths).
Тест на мутабельность. Фенотип гипермутабельности клинических изолятов S. Typhimurium определяли с помощью скринирующего теста с диском налидиксовой кислоты (30 мкг) согласно методике предложенной Galán и соавт. [Galan, 2004], для чего суспензии тестируемых микроорганизмов в физиологическом растворе плотностью 2 по McFarland наносили с помощью тампонов на поверхность агара Мюллера-Хинтон и через 24 часа инкубирования при 35°C оценивали наличие отдельных колоний мутантов внутри зоны подавления роста налидиксовой кислоты. Частоту возникновения спонтанных мутантов, резистентных к налидиксовой кислоте, у исходно чувствительных изолятов определяли с помощью стандартного метода: суточные культуры микроорганизмов в разведении от 10-1 до 10-12 рассевали на агар с налидиксовой кислотой (32 мг/л) и без антибиотика; частоту спонтанных мутантов рассчитывали как соотношение количества колоний, выросших на чашках с налидиксовой кислотой, к количеству колоний, выросших на чашках без антибиотика. В качестве положительного и отрицательного контрольных штаммов использовали, соответственно, мутатор E. coli GM2995 (mutD5) [Stepanova, 2008] и E. coli ATCCÒ25922.
РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
Всего исследовано 88 резистентных к цефотаксиму изолятов Salmonella enterica подвид enterica серовар Typhimurium, выделенных при вспышках и спорадических случаях нозокомиального сальмонеллеза в 15 населенных пунктах 10 регионов России, Беларуси и Казахстана в 1996-2009 гг. (табл. 3). Таблица 3
Источники выделения цефотаксиморезистентных изолятов S. Typhimurium
РегионКоличество изолятовДаты выделения С.-Петербург, Россия 6 1996-1997, 2003 Гомель, Беларусь 22 1997, 2006-2007 Москва, Россия 1 1998 Витебск, Беларусь 13 1999-2000 Иркутск, Россия 1 2003 Воронеж, Россия 5 2004 Ярославль, Россия 2 2004 Смоленск, Россия 26 2004, 2006, 2009 Караганда, Казахстан 9 2006-2007 Томск, Россия 3 2007-2008 Все изоляты были неповторяющимися (по одному от каждого пациента). В качестве контролей при оценке клональности в исследование были включены эпидемиологически несвязанные изоляты: цефотаксиморезистентный штамм CAS5 из Аргентины, продуцирующий БЛРС CTX-M-2 [Bauernfeind, 1992], а также два чувствительных изолята из Смоленской и Гомельской областей, выделенные в тех же стационарах, откуда были получены резистентные штаммы S. Typhimurium, но от пациентов с внебольничной инфекцией.
Фенотипическое определение чувствительности цефотаксиморезистентных нозокомиальных изолятов S. Typhimurium. Результаты определения чувствительности исследованных нозокомиальных изолятов S. Typhimurium представлены в таблице 4. Таблица 4
Чувствительность изолятов к антибиотикам
Антибиотик МПК, мг/л Категория чувствительности Диапазон 50% 90%Ч, изолятов (%)УР, изолятов (%)Р, изолятов (%)Ампициллин 256 256 256 0 0 88 (100%)Амоксициллин-клавулановая к-та 8-64 32 32 9 (10,2%) 0 79 (89,7%)Пиперациллин 256 256 256 0 0 88 (100%)Пиперациллин-тазобактам 2-256 256 256 21 (23,8%) 1 (1,13%) 66 (75%)Цефотаксим 128-256 256 256 0 0 88 (100%)Цефотаксим-клавулановая к-та 0,06-1 0,25 0,5 - - -Цефтазидим 1-256 8 16 2 (2,27%) 1 (1,13%) 85 (96,5%)Цефтазидим-клавулановая к-та 0,25-1 0,5 0,5 - - -Цефепим 8-256 128 256 0 0 88 (100%)Азтреонам 8-256 64 64 0 0 88 (100%)Имипенем 0,06-0,5 0,25 0,25 88 (100%) 0 0Дорипенем 0,06-1 0,06 0,5 88 (100%) 0 0Меропенем 0,06-0,125 0,06 0,125 88 (100%) 0 0Эртапенем 0,06-0,5 0,06 0,06 88 (100%) 0 0Гентамицин 1-256 16 32 11 (12,5%) 1 (1,13%) 76 (86,3%)Ко-тримоксазол 0,125-256 256 256 29 (32,9%) 0 59 (67%)Налидиксовая к-та 4-512 8 512 50 (56,8%) 0 38 (43,1%)Ципрофлоксацин 0,03-0,5 0,03 0,5 51 (57,9%) 0 37 (42%)Хлорамфеникол - - - 10 (11,4%) 0 78 (88,6%)Тетрациклин - - - 8 (9,09%) 0 80 (90,9%) Все изоляты обладали высоким уровнем устойчивости к цефотаксиму, цефепиму и азтреонаму (МПК90 ≥256, ≥128 и ≥64 мг/л, соответственно) и пониженной чувствительностью к цефтазидиму (МПК90 = 16 мг/л) по сравнению с чувствительными в норме штаммами, для которых характерна МПК цефтазидима £2 мг/л.
При определении МПК и методом "двойных дисков" у всех изолятов был выявлен синергизм между оксииминоцефалоспоринами и клавулановой кислотой, свидетельствующий о продукции БЛРС, что позволяет считать изоляты резистентными ко всем ЦС III-IV поколения и азтреонаму. Устойчивость к ингибиторозащищенным пенициллинам была вариабельной: 89,7% и 75% изолятов были нечувствительны, соответственно, к амоксициллину-клавулановой кислоте и пиперациллину-тазобактаму. Все изоляты проявляли чувствительность к карбапенемам.
Ассоциированная устойчивость к одному и более не-b-лактамным антибиотикам была отмечена у 85 (96,6%) изолятов. Резистентностью одновременно к пяти не-b-лактамным антибиотикам обладали 22 (25%) изолята (профиль резистентности Tet-Chl-Gm-Sxt-Nal), к четырем - 44 (50%) (профили Tet-Chl-Gm-Sxt - 34 (38,6%) или Tet-Chl-Gm-Nal - 10(11,4%)), к трем препаратам - 10 (11,4%) (профили Tet-Chl-Gm- 7(8%), Tet-Chl-Nal - 2 (2,3%) или Gm-Sxt-Nal - 1(1,1%)), к двум - 7 (8%) (профили Tet-Chl - 3 (3,4%), Tet-Sxt - 2 (2,3%) или Gm-Nal - 2 (2,3%)), к одному препарату (гентамицин или налидиксовая кислота)- резистентны 2 (2,3%) изолята. Только 3 изолята (3,4%) не имели добавочной резистентности к не-b-лактамным антибиотикам.
В соответствии с критериями CLSI устойчивость к налидиксовой кислоте была выявлена у 38 (43,1%) изолятов, большинство из которых также проявляло нечувствительность к ципрофлоксацину согласно последним рекомендациям EUCAST и CLSI 2012 года для Salmonella spp. (МПК ципрофлоксацина >0,06 мг/л) [Leclercq, 2011; EUCAST, 2012]. Единственный изолят имел пограничные значения МПК ципрофлоксацина (МПК = 0,06 мг/л) и был формально отнесен к фторхинолоночувствительным. Субвидовое типирование изолятов. Типирование с помощью метода PFGE было проведено для 14 изолятов, выделенных в России и Беларуси до 2003 г. Эпидемиологически несвязанный штамм S. Typhimurium из Аргентины, продуцирующий CTX-M-2, был использован для сравнения. Метод позволил отнести российские и белорусские цефотаксиморезистентных изоляты к одному из семи макрорестрикционных профилей (А1-А7), которые проявляли выраженное сходство с различием максимум по 3 полосам (Рис. 1), что согласно критериям предложенным Tenover и соавт. [Tenover, 1997], свидетельствует об вероятной генетической родственности изолятов. Аргентинский штамм CAS5 обладал уникальным профилем (B1), который отличался от профилей А1-А7 четырьмя полосами. Рис. 1. Генетическое родство цефотаксиморезистентных штаммов S. Typhimurium на основании сравнения профилей PFGE.
Белорусские изоляты (дорожки 1-12): 1- SE006/Vt-1358; 2 - SE007/Re-27; 3 - SE008/Vt-1603; 4 - SE009/Vt-6570; 5 - SE010/Vt-3078; 6 - SE011/Us-13205; 7 - SE012/Or-13935; 8 - SE013/Us-1845; 9 - SE014/Vt-14533; 10 - SE015/Vt-13526; 11 - SE019/Vt-700; 12 - SE018/Us-16753;
Российские штаммы (дорожки 13-14): 13 - SE004/Sp-891; 14 - SE020/Mo-20;
Аргентинский штамм- дорожка 15 - SE021/Ar-CAS5.
М - маркер молекулярной массы бактериофаг . Все цефотаксиморезистентные изоляты, включая более "поздние" по времени выделения культуры из России, Беларуси и Казахстана, были также типированы с помощью мультилокусного анализа тандемных повторов (MLVA). MLVA типирование позволило отнести все изоляты к 17 типам. Несмотря на большое количество выявленных MLVA-типов, все цефотаксиморезистентные изоляты были отнесены к одной клональной группе в результате кластеризации MLVA профилей с использованием как алгоритма минимального остовного дерева (MST) (Рис. 2); соответствующие MLVA-профили отличались друг от друга на 1-2 VNTR-локуса. Чувствительные к цефалоспоринам штаммы отличались между собой и от наиболее близких изолятов из описанной клональной группы по 3 и более VNTR-локусам. Рис. 2. Кластеризация MLVA-профилей на основании алгоритма Минимального остовного дерева.
Каждому MLVA-типу соответствует круг, обозначенный буквой латинского алфавита; названия городов, где были выделены изоляты, указаны рядом с соответствующими типами. Размер круга отражает количество изолятов, принадлежащих данному MLVA-типу. Длина и тип соединительных отрезков отражает генетическое расстояние (число отличающихся VNTR локусов) между двумя ближайшими типами: короткая непрерывная линия соединяет два MLVA-типа, отличающихся друг от друга единственным VNTR локусом, длинная пунктирная линия соединяет двухлокусные варианты. MLVA-типы, отличающиеся не более чем на 2 локуса, объединены в клональные группы (выделены серым фоновым цветом). Различия на 3 локуса и более на диаграмме не отражены. Круги черного цвета соответствуют изолятам, чувствительным к цефалоспоринам III поколения. Таким образом, результаты MLVA-типирования также подтверждают данные PFGE для ранее выделенных изолятов (до 2003 г) и свидетельствуют о том, что все цефотаксиморезистентные изоляты сальмонелл, выделенные на территории России, Беларуси и Казахстана в ходе вспышек нозокомиального сальмонеллеза в период с 1996 по 2009 гг., представляют одну клональную группу, и существенно отличаются по совокупности молекулярно-генетических характеристик от чувствительных штаммов S. Typhimurium, выделенных в тех же стационарах. Изоляты, принадлежащие к 7 MLVA-типам были получены как минимум из двух разных регионов, что наглядно отражает легкость распространения клонов, принадлежащих указанной клональной группе. Профиль MLVA CTX-M-2-продуцирующего штамма S. Typhimurium из Аргентины отличался от ближайшего MLVA-типа, найденного в Смоленске, по двум локусам, что позволяет отнести его к описанной клональной группе. MLST-типирование пяти цефотаксиморезистентных изолятов, принадлежащих к основным MLVA-типам и выделенных в разных географических районах (MLVA-тип A- Санкт-Петербург, D- Москва, K- Иркутск, L- Караганда,Q- Гомель), показало наличие у них идентичных аллельных профилей aroC-dnaN-hemD-hisD-purE-sucA-thrA (116-7-12-9-5-9-2), определяющих принадлежность к сиквенс-типу 328 (ST328). ST328 отличается единственной мутацией в гене aroC от сиквенс-типа ST19 (10-7-12-9-5-9-2), к которому был отнесен взятый для сравнения штамм из Аргентины (MLVA-тип T). Таким образом, MLST типирование подтвердило генетическую родственность CTX-M-5-продуцирующих штаммов S. Typhimurium, показанную с помощью MLVA. Поскольку распространенный в России, Беларуси и Казахстане сиквенс-тип ST238 является однолокусным вариантом сиквенс-типа ST19, отдаленная родственность наших изолятов и аргентинского штамма, выявленная с помощью MLVA, также была подтверждена MLST-типированием. Таким образом, результаты всех трех использованных нами методов генетического типирования PFGE, MLVA и MLST свидетельствуют о клональном характере распространения госпитальных штаммов S. Typhimurium, резистентных к современным цефалоспоринам.
Молекулярная характеристика детерминант резистентности к -лактамам. У всех исследованных изолятов методом ПЦР в реальном времени и последующего секвенирования были выявлены гены blaCTX-M-5, кодирующему ранее описанный у S. Typhimurium вариант БЛРС - CTX-M-5. При амплификации с праймерами к внутренним последовательностям генов tnpA ISEcp1 и blaCTX-M-5, у всех изолятов был получен характерный ПЦР-фрагмент длиной около 470 пн. ПЦР тест на наличие сцепления гена blaCTX-M с ISCR1 не дал положительных результатов ни для одного из исследованных изолятов, кроме CTX-M-2-продуцирующего штамма CAS-5 из Аргентины, взятого для сравнения. Таким образом, результаты ПЦР картирования свидетельствуют о наличии характерной для blaCTX-M-5 ассоциации с инсерционной последовательностью ISEcp1 [Bradford, 1998].
ПЦР-анализ на наличие генов других распространенных -лактамаз молекулярных классов А и D выявил присутствие blaTEM у 4 (4,5%) и blaOXA-1-подобных генов у 66 (75%) изолятов. Гены SHV -лактамаз не были обнаружены. Наличие OXA-1-подобных -лактамаз, которые проявляют устойчивость к ингибированию клавулановой кислотой и тазобактамом [Livermore, 1995], коррелировало с резистентностью к пиперациллину-тазобактаму.
Анализ CTX-M-кодирующих плазмид. При конъюгативном переносе плазмид выявлено 2 типа трансконъюгантов, отличающихся по фенотипу резистентности. Трансконъюганты первого типа были получены от большинства исследованных изолятов при культивировании на среде с рифампицином и ампициллином с высокой частотой (10-3-10-4) и обладали резистентностью к пенициллинам, комбинациям пенициллинов с ингибиторами и не--лактамным антибиотикам, но проявляли чувствительность к оксиимино--лактамам. С помощью ПЦР у трансконъюгантов данного типа были выявлены только гены OXA-1-подобных пенициллиназ. Трансконъюганты второго типа были получены всего от двух цефотаксиморезистентных изолятов S. Typhimurium на среде, содержащей рифампицин и цефотаксим, с гораздо меньшей частотой (10-7-10-8). Тем не менее, перенос плазмид, обеспечивающих резистентность к цефотаксиму, при конъюгации с низкой частотой свидетельствует о возможности их ко-мобилизации другими плазмидами. Эти неавтоконъюгативные плазмиды обеспечивали резистентность только к пенициллинам и оксиимино-цефалоспоринам, связанную с наличием в их составе генов БЛРС СТХ-М-5.
Плазмиды, кодирующие CTX-M БЛРС, были также выделены от 26 изолятов из разных стационаров и перенесены в реципиетнтый штамм E. coli EPI300 с помощью трансформации. Полученные цефотаксиморезистентные трансформанты обладали единственной низкомолекулярной плазмидой (размером около 7-8 тпн на электрофорезе). Рестрикционный анализ плазмид, выделенных от трансформантов, показал, что все они могут быть отнесены к одному из четырех типов (Рис. 3). Наиболее распространенный рестрикционный профиль A1 был характерен для 20 изолятов, 11 из которых были выделены в стационарах Беларуси, 8 - в России и 1 - в Казахстане. Плазмиды с остальными, минорными профилями A2, А3 и А4 отличались от А1 единичными изменениями в сайтах рестрикции. То есть, все четыре типа CTX-M-5-кодирующих плазмид являлись сходными между собой по данным рестрикционного анализа.
Рис. 3. Рестрикционный анализ CTX-M-5-кодирующих плазмид: А) рестрикция эндонуклеазой PstI, Б) рестрикция эндонуклеазой PvuII. A1-A4‒ репрезентативные рестрикционные профили CTX-M-5-кодирующих плазмид; М- маркер молекулярной массы λ/BstEII+pUC18/HaeIII. Полное секвенирование последовательности четырех типов плазмид, выявленных с помощью рестрикционного анализа, подтвердило идентичность их генетического каркаса, включающего гены мобилизации (mobA, mobB, mobC, mobD), инициации репликации, гипотетическую открытую рамку считывания (orfX), мобильного элемента ISEcp1 и -лактамазы CTX-M-5 (Рис. 4). Рис. 4. Cравнение нуклеотидных последовательностей CTX-M-5-кодирующих плазмид. Черные стрелки- предполагаемые кодирующие регионы и ключевые структурные элементы: консервативные гипотетический протеин (orfX), мобилизационные белки (mobA-D), сайт репликации, гены b-лактамаз (blaCTX-M-5, blaTEM-1), инсерционные последовательности (ISEcp1, IS1), транспозаза (tnpA) и резолваза (tnpR) транспозона Tn3. Серые стрелки- консервативная часть плазмид.
Отсутствие tra оперона, ответственного за конъюгационный перенос, при наличии полного набора генов мобилизации в консервативном каркасе описанных плазмид поддерживает наши данные о переносе CTX-M-5-кодирующих плазмид от двух изолятов при конъюгации с низкой частотой и свидетельствует о том, что данные плазмиды являются неавтоконъюгативными, но способными к ко-мобилизации другими плазмидами. Описанным плазмидам было присвоено название "pCTXM5" в сочетании с номерами соответствующих изолятов. Полные нуклеотидные последовательности плазмид депонированы в базу данных GenBank. Плазмида pCTXM5-637 (полная нуклеотидная последовательность депонирована в GenBank под номером JX017306), с самым частым типом рестрикции А1, являлась наиболее простой и обладала наименьшим размером- 7438 пн. Плазмиды pCTXM5-1845 (GenBank № JX017309) и pCTXM5-1358 (GenBank № JX017308) с рестрикционными профилями А2 и А3, соответственно, были крупнее (8215-8216 пн) и отличались от pCTXM5-637 вставкой IS1-подобных элементов, нуклеотидные последовательности которых незначительно варьировали. Наиболее крупная плазмида pCTXM5-891 (GenBank № JX017307) с профилем рестрикции А4 отличалась от pCTXM5-637 наличием транспозона Tn3-типа, который нес в своем составе ген TEM-1 -лактамазы. Наиболее распространенная плазмида pCTXM5-637 может считаться предшественником других типов плазмид и эволюционировала путем приобретения мобильных элементов IS1 (в случае pCTXM5-1358 и pCTXM5-1845) или Tn3 (pCTXM5-891). ПЦР-типирование CTX-M-5-кодирующих плазмид позволило детектировать специфическую последовательность, соответствующую консервативному каркасу плазмид pCTXM5-типа у 80 (90,9%) цефотаксиморезистентных изолятов. Однако, у восьми цефотакcим-резистентных изолятов (3 изолята из Томска; 2- из Караганды; 1- из Иркутска; 1 - из С.-Петербурга; 1- из Витебска), имеющих ген blaCTX-M-5, сцепленный с ISEcp1, не удалось детектировать наличие плазмид путем ПЦР-типирования, а также осуществить выделение и перенос pCTXM5-плазмид путем трансформации или конъюгации, что можно объяснить ISEcp1- опосредованной транслокацией гена blaCTX-M на хромосому, примеры которой были описаны в ряде публикаций [Hopkins, 2006; Mendonca, 2007; Fabre, 2009; Sun, 2010]. ПЦР-типирование показало отcутствие плазмид pCTXM5-типа у эпидемиологически несвязанных изолятов: цефотаксимочувствительных внебольничных изолятов S. Typhimurium и у CTX-M-2-продуцирующего аргентинского штамма CAS-5.
Таким образом, локализация генов blaCTX-M-5 на схожих, не поддающихся самостоятельному переносу плазмидах поддерживает данные о клональном распространении цефотаксиморезистентных нозокомиальных штаммов S.Typhimurium. Более того, описанные плазмиды являются специфичными для данной клональной группы S. Typhimurium и, покуда, не были найдены у штаммов S. Typhimurium других генетических линий.
Молекулярная характеристика детерминант резистентности к хинолонам. У исследованных нами изолятов S. Typhimurium резистентность к хинолонам во всех случаях была вызвана различными точечными мутациями приводящими к аминокислотным заменам в QRDR области субъединицы А ДНК-гиразы (GyrA): Asn-87, Gly-87, Tyr-87 и Phe-83 (Рис. 5). При этом, у чувствительных к налидиксовой кислоте изолятов соответствующие мутации не были обнаружены. Таким образом, фенотип чувствительности к налидиксовой кислоте строго коррелировал с генотипом gyrA. МутацияКоличество (%) изолятовДиапазон МПК, мг/лNALCIPНет (WT)50 (56,8%)4 - 16≤0,03 - 0,06Asn-8725 (28,4)128 - ≥5120,125 - 0,5Gly-873 (3,4%)256 - ≥5120,06 - 0,5Tyr-872 (2,3%)128 - 2560,125 - 0,25Phe-838 (9,1%)≥5120,25 - 0,5Рис.5. Распределение исследованных изолятов S.Typhimurium по МПК налидиксовой кислоты (NAL) и ципрофлоксацина (CIP) в зависимости от характера мутаций в QRDR GyrA. Большинство штаммов с характерными мутациями в QRDR GyrA также проявляли устойчивость низкого уровня к ципрофлоксацину, однако один изолят с заменой Gly-87 формально сохранял чувствительность к ципрофлоксацину (МПК 0,06 мг/л). Данное наблюдение свидетельствует, на наш взгляд, о том, что налидиксовая кислота является более чувствительным маркером для выявления хромосомно-опосредованной резистентности к хинолонам.
Выявленные в ходе данного исследования мутации в 83 и 87 позиции GyrA являются типичными для хинолонорезистентных клинических штаммов разных видов семейства Enterobacteriaceae. Эффект данных мутаций хорошо изучен и для штаммов сальмонелл. Наиболее часто у исследованных нами изолятов встречались замены на Asn (аспарагин) в 87 позиции (28,4%) и на Phe в 83 (9,1%). Мутация Phe-83, как и было показано ранее, была связана с более высокими значениями МПК как налидиксовой кислоты (³512мг/л), так и ципрофлоксацина (³0,25мг/л).
Ввиду показанной нами клональной родственности исследованных изолятов, было бы логично предположить, что мутации в хромосомном гене gyrA должны быть одинаковыми у всех штаммов, резистентных к хинолонам. Однако, данные кластерного анализа штаммов, выполненного по результатам MLVA-типирования (Рис. 6), свидетельствуют о том, что распространение резистентности к хинолонам в изучаемой генетической линии S. Typhimurium лишь отчасти носит клональный характер и в значительной мере связано с независимым приобретением мутаций в gyrA исходно чувствительным штаммом. Кластеризация MLVA-профилей на основании алгоритма Минимального остовного дерева. MLVA-типы, отличающиеся не более чем на 2 локуса, объединены в одну клональную группу (выделена серым фоновым цветом). Заливка круга отражает доли изолятов с разными мутациями QRDR gyrA, принадлежащих данному MLVA-типу.
Тест на гипермутбельность. У исследованных нами изолятов частота спонтанных мутаций устойчивости к налидиксовой кислоте составила приблизительно 1  10-5 (соответствует увеличению частоты мутаций на 4 порядка по сравнению с обычными штаммами [Levy, 2004]), что позволило считать их гипермутабельными. Также при постановке скринирующего теста с диском налидиксовой кислоты у всех штаммов S. Typhimurium, не проявляющих резистентность к налидиксовой кислоте, аналогично с контрольным штаммом-мутатором E.coli GM2995 (mutD5), наблюдался рост многочисленных мутантных колоний внутри зоны подавления роста. Подобного роста у немутабельного контроля не замечено (Рис. 7). У произвольно выбранных мутантов, полученных in vitro, методом секвенирования было установлено наличие мутаций в QRDR gyrA, идентичных выявленным у хинолонорезистентных клинических изолятов. Рис. 7. Примеры выявления фенотипа гипермутабельности с помощью быстрого теста с диском налидиксовой кислоты
А, Б - Клинические изоляты S. Typhimurium; В - отрицательный контроль - E. coli ATCCÒ25922; Г - положительный контроль - E. coli GM2995. Стрелкой отмечены мутантные колонии внутри зон подавления роста.
Фенотип гипермутабельности наблюдался у всех исходно чувствительных к налидиксовой кислоте изолятов, относящихся к разным MLVA-субтипам внутри одной клональной группы и, тем самым, разнородность мутаций резистентности к фторхинолонам не противоречит результатам субвидового типирования, а свидетельствует о распространении единого гипермутабельного клона. Таким образом, в течение долгого времени в стационарах на обширной территории Российской Федерации и сопредельных государств циркулирует успешный полирезистентный клон S. Typhimurium, устойчивый к цефалоспоринам III-IV поколений, благодаря продукции плазмидно-кодируемой БЛРС CTX-M-5. Причем, неавтоконъюгативные CTX-M-5-кодирующие плазмиды являются важной характеристикой описанного клона и не были обнаружены у изолятов S. Typhimurium неродственных генетических линий. Значительная доля изолятов принадлежащих данному клону резистентна к фторхинолонам, и существует высокая вероятность дальнейшего роста фторхинолонорезистентности среди изолятов внутри клональной группы вследствие их гипермутабельности, которая облегчает приобретение мутаций устойчивости. Большинство изолятов данной группы проявляют ассоциированную устойчивость к антибиотикам разных классов за счет комбинации дополнительных плазмидных и хромосомных детерминант резистентности.
ВЫВОДЫ
1. По данным молекулярно-генетического типирования методами мультилокусного секвенирования-типирования (MLST), мультилокусного анализа тандемных повторов (MLVA) и пульс-электрофореза макрорестрикционных фрагментов геномной ДНК (PFGE) цефотаксиморезистентные штаммы Salmonella Typhimurium, вызвавшие вспышки сальмонеллеза в стационарах на территории России, Беларуси и Казахстана с 1996 по 2009 гг., принадлежат к одной клональной группе. 2. Резистентность нозокомиальных штаммов S. Typhimurium к цефалоспоринам III-IV поколения и азтреонаму обусловлена наличием у них генетических детерминант, кодирующих b-лактамазы расширенного спектра действия CTX-M-5, тогда как устойчивость к ингибиторозащищенным пенициллинам связана с генами b-лактамаз OXA-1 типа.
3. Ген приобретенной b-лактамазы CTX-M-5 связан с инсерционным элементом ISEcp1 и находится в составе ранее не описанных сходных между собой неавтоконъюгативных плазмид, которые способны к мобилизации другими конъюгативными плазмидами.
4. Резистентность к хинолонам во всех случаях является результатом единичных аминокислотных замен в области, определяющей устойчивость к хинолонам (QRDR), А-субъединицы ДНК-гиразы (Asn-87, Phe-83, Gly-87, Tyr-87)
5. Штаммы Salmonella Typhimurium описанной клональной группы являются гипермутабельными и характеризуются высокой частотой возникновения спонтанных мутаций резистентности к налидиксовой кислоте (~1´10-5), что способствует независимому приобретению устойчивости к хинолонам. ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ
1. В связи с широким распространением -лактамаз расширенного спектра действия, необходимо проводить регулярное определение чувствительности штаммов Salmonella Typhimurium, выделяемых в стационарах, к цефалоспоринам III поколения.
2. Для адекватной оценки чувствительности штаммов сальмонелл к ципрофлоксацину рекомендуется использовать обновленные критерии Института клинических и лабораторных стандартов (CLSI) 2012 г. (ципрофлоксацин "чувствительный"  0,06 мг/л; "нечувствительный">0,06 мг/л). Дополнительное определение чувствительности к налидиксовой кислоте является наиболее надежным способом выявления устойчивости к фторхинолонам, связанной с мутациями в хромосомном гене gyrA ДНК-гиразы.
3. Для изучения региональной и национальной эпидемиологии сальмонеллеза оптимальным является метод мультилокусного анализа тандемных повторов (MLVA), а для целей глобальной эпидемиологии- сочетание метода MLVA и мультилокусного секвенирования-типирования (MLST).
4. Выявленная нами гипермутабельность нозокомиального клона Salmonella Typhimurium способствует приобретению мутаций резистентности к ципрофлоксацину, в связи с чем назначение фторхинолонов в стационарах должно быть ограничено случаями инвазивного сальмонеллеза у взрослых при невозможности использования цефалоспоринов III поколения по причине резистентности возбудителя к ним или аллергических реакций у пациента.
5. Скрининговый тест с диском налидиксовой кислоты для выявления фенотипа гипермутабельности может явиться полезным инструментом для рутинного предсказания повышенной вероятности приобретения вторичной резистентности к фторхинолонам штаммами Salmonella Typhimurium и связанной с этим клинической неэффективности применения ципрофлоксацина для терапии инвазивной сальмонеллезной инфекции. Публикации по теме диссертации в изданиях, рекомендованных ВАК:
1. Козырева В.К., Эйдельштейн М.В., Тапальский Д.В., Азизов И.С., Романов А.В., Козлов Р.С. Клональное распространение CTX-M-5-продуцирующих нозокомиальных штаммов Salmonella Typhimurium в России, Беларуси и Казахстане // КМАХ. - 2012. -Т.14, №1. - С. 38-50.
2. Козырева В.К., Эйдельштейн М.В., Тапальский Д.В., Азизов И.С., Козлов Р.С. Независимое приобретение резистентности к хинолонам у клонально-родственных нозокомиальных штаммов Salmonella Typhimurium вследствие гипермутабельности // КМАХ. - 2012. - Т.14, №2. - С. 153-161.
Другие публикации по теме диссертации:
1. Kozyreva V., Tapalski D., Azizov I., Edelstein M. Independent emergence of quinolone resistance in CTX-M-5 -lactamase-producing isolates of Salmonella typhimurium from Russia, Belarus and Kazakhstan. 18th ECCMID, Barcelona, 19-22 April 2008, abstr. N: O86.
2. V. Kozyreva, E. Ilina, A. Carattoli, M. Edelstein, R. Kozlov. CTX-M-5-Сoding Plasmids of Nosocomial Salmonella Typhimurium Clone Circulating for a Long Time in Russia, Belarus, and Kazakhstan. 52nd ICAAC, San Francisco, 9-12 September 2012, abstr. N C2-697. Accepted for presentation.
3. Егорова С.А., Кафтырева Л.А., Козырева В.К., Забровская А.В. Устойчивость сальмонелл, выделенных из различных источников, к хинолонам // XIV Междунар. конгресса МАКМАХ по антимикробной терапии: Тез. №1827. - М., 23-25 мая 2012. - С. 15-16.
4. Егорова С.А., Кафтырева Л.А., Козырева В.К., Войтенкова Е.В. Устойчивость к хинолонам штаммов S. Typhi- возбудителей брюшного тифа, зарегистрированного на территории РФ // Итоги и перспективы обеспечения эпидемиологического благополучия населения Российской Федерации: Материалы X съезда ВНПОЭМП- М., 2012. - Т. 2, № 1-2. - С. 261.
5. Забровская А.В., Егорова С.А., Козырева В.К., Селиванова Л.В., Валькова И.А. Сельскохозяйственные животные как источник детерминант резистентности к антимикробным препаратам // Итоги и перспективы обеспечения эпидемиологического благополучия населения Российской Федерации: Материалы X съезда ВНПОЭМП- М., 2012. - Т. 2, № 1-2. - С. 263-4.
6. Stepanova M.N., Pimkin M., Nikulin A.A., Kozyreva V.K., Agapova E.D., Edelstein M.V. Convergent In Vivo and In Vitro Selection of Ceftazidime Resistance Mutations at Position 167 of CTX-M-3 -Lactamase in Hypermutable Escherichia coli Strains // Antimicrobial Agents and Chemotherapy. - 2008. - Vol. 52, N.4. - P.1297-1301.
7. Sukhorukova M., Kozyreva V., Ivanchik N., Edelstein M., Kozlov R. Five-year trends in the prevalence and types of ESBLs and antimicrobial susceptibility of ESBL-producing nosocomial strains of Enterobacteriaceae in Russia. 20th ECCMID, Vienna, 10-13 April 2010, abstr. 964. Accepted for presentation.
Список использованных сокращений
БЛРС-лактамазы расширенного спектра действия
ДНКдезоксирибонуклеиновая кислота
МПКминимальная подавляющая концентрация
МПК50минимальная подавляющая концентрация для 50% исследованных штаммов
МПК90минимальная подавляющая концентрация для 90% исследованных штаммов
пнпар нуклеотидов
ПЦРполимеразная цепная реакция
тпн тысяч пар нуклеотидов
CLSIИнститут клинических и лабораторных стандартов
EUCASTЕвропейский комитет по оценке антибиотикочувствительности
ISинсерционная последовательность
ISCR1инсерционные последовательности с общим регионом 1
MLSTмультилокусное секвенирование-типирование
MLVAмультилокусный анализ тандемных повторов
MSTминимальное остовное дерево
PFGEпульс-электрофорез макрорестрикционных фрагментов геномной ДНК
QRDR область, определяющая устойчивость к хинолонам
STTRтандемный повтор Salmonella Typhimurium
VNTRучасток ДНК с переменным числом тандемных повторов
WTдикий тип
Антибиотики
Chl хлорамфеникол
Cipципрофлоксацин
Gmгентамицин
Nal налидиксовая кислота
Rifрифампицин
Sxt ко-тримоксазол Tet тетрациклин
2
Документ
Категория
Биологические науки
Просмотров
161
Размер файла
1 164 Кб
Теги
кандидатская
1/--страниц
Пожаловаться на содержимое документа