close

Вход

Забыли?

вход по аккаунту

?

Патент BY10907

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2008.08.30
(12)
(51) МПК (2006)
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
BY (11) 10907
(13) C1
(19)
C 12Q 1/68
G 01N 33/48
СПОСОБ ДИАГНОСТИКИ РЕСПИРАТОРНОГО МИКОПЛАЗМОЗА
(21) Номер заявки: a 20060669
(22) 2006.07.05
(43) 2008.02.28
(71) Заявитель: Государственное учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(72) Авторы: Хулуп Геннадий Яковлевич; Костюк Светлана Андреевна;
Скороход Геннадий Алексеевич;
Силич Татьяна Владимировна; Полуян Ольга Сергеевна (BY)
(73) Патентообладатель: Государственное
учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(56) LIU G. et al. Diagnostic Microbiology
and Infections Disease, 2005, v. 52, p. 714.
BY 8164 C1, 2006.
US 5712090 A, 1998.
JP 2002281980 A, 2002.
BY 10907 C1 2008.08.30
(57)
Способ диагностики респираторного микоплазмоза, при котором проводят полимеразную цепную реакцию в режиме реального времени с биологическим материалом из
респираторного тракта больного, при этом используют праймеры 5´-CAGTACATGTTAATCCCAGAAGTATAGTTGG-3´ и 5´-GCTGGATAATCGCCGTATGAACCTGC-3´ и
TaqMan меченый олигонуклеотид 5' FAM GTCAATCGATCGATAATCGATACGATATACTG TAMRA 3' спейсерного фрагмента гена 16S-23S рРНК возбудителя рода Mycoplasma, а респираторный микоплазмоз диагностируют при выявлении указанного
олигонуклеотида в концентрации 102-104 копий в расчете на 1 мл биологического материала.
Изобретение относится к медицине, к разделу клинической лабораторной диагностики.
Известен способ выявления возбудителей заболеваний различных отделов респираторного тракта микоплазменной природы, таких как Mycoplasma hominis и Mycoplasma
pneumoniae методом полимеразной цепной реакции в режиме реального времени, при котором определяют вид возбудителя и его количественные характеристики. Данный способ
является прототипом по отношению к заявляемому способу [1].
Общим признаком для заявляемого способа и прототипа является определение возбудителей микоплазменной природы в биологическом материале пациентов путем проведения полимеразной цепной реакции в режиме реального времени с количественной схемой
детекции продуктов амплификации.
Однако известный способ обладает следующими недостатками:
при проведении полимеразной цепной реакции в режиме реального времени одновременно может определяться только один вид возбудителя рода Mycoplasma. Вследствие
того, что течение инфекционного процесса, индуцированного представителями рода My-
BY 10907 C1 2008.08.30
coplasma, схоже и протоколы лечения респираторных микоплазмозов одинаковы, существующий способ выявления возбудителей в биологическом материале пациентов с заболеваниями различных отделов респираторного тракта малоэффективен по причине
длительности проведения данного вида исследования и как следствие несвоевременного
назначения этиопатогенетической терапии.
Задачей заявляемого способа является повышение вероятности выявления возбудителей респираторных микоплазмозов в биологическом материале пациентов с заболеваниями различных отделов респираторного тракта за счет определения общего для нескольких
видов возбудителей рода Mycoplasma молекулярного маркера.
Поставленная задача осуществляется следующим образом. Предложен способ диагностики респираторного микоплазмоза, при котором проводят полимеразную цепную реакцию в режиме реального времени с биологическим материалом респираторного тракта
больного, при этом используют праймеры 5'-CAGTACATGTTAATCCCAGAAGTATAGTTGG-3' и 5'-GCTGGATAATCGCCGTATGAACCTGC-3' и TaqMan меченный
олигонуклеотид 5' FAM GTCAATCGATCGATAATCGATACGATATACTG TAMRA 3'
спейсерного фрагмента гена 16S-23S рРНК возбудителя рода Mycoplasma, а респираторный микоплазмоз диагностируют при выявлении указанного олигонуклеотида в концентрации 102-104 копий в расчете на 1 мл биологического материала.
В качестве биологического материала возможно использование назофарингеальных
соскобов эпителиальных клеток, материала из среднего носового хода (пазухи), забранного интраоперационно, а также мокроты.
Пример 1
Необходимо выявить наличие или отсутствие возбудителей рода Mycoplasma в биологическом материале из среднего носового хода, забранного интраоперационно, пациента
А с клиническим диагнозом "хронический обструктивный бронхит".
Для выявления данных видов микроорганизмов применяют Mycoplasma-специфичные
праймеры и TaqMan олигонуклеотидные пробы, выбранные из гена, кодирующего 16S23S рРНК. Они имеют следующие консервативные нуклеотидные последовательности
М.1 5'-CAGTACATGTTAATCCCAGAAGTATAGTTGG-3' и М.2 5'-GCTGGATAATCGCCGTATGAACCTGC-3', TaqMan олигонуклеотидная меченая проба имеет нуклеотидную
последовательность 5' FАМ GTCAATCGATCGATAATCGATACGATATACTG TAMRA 3'.
Для проведения количественного анализа специфических фрагментов возбудителей
рода Mycoplasma, т.е. для определения концентрации спейсерного участка фрагмента гена
16S-23S рРНК в биологическом материале, применяется полимеразная цепная реакция в
режиме реального времени с использованием термоциклера "Rotor-Gene-3000" ("Corbette
research", Австралия) и программного обеспечения на базе компьютера Intel Pentium-4.
Для определения концентрации возбудителей в биологическом материале строится
стандартная кривая в следующих координатах: X - концентрация стандартов, Y - пороговый цикл СТ (пороговый цикл - значение цикла, при котором пороговая линия и кривая
данных флуоресценции каждого амплифицированного продукта пересекаются). Значения
СТ предсказываются исходя из оценки входного уровня пробы, то есть в стандартных условиях реакции, чем больше начальная концентрация образца, тем меньше СТ (фигура).
Образец считается положительным, если в таблице результатов пороговых циклов по
каналу FАМ для него определяется значение порогового цикла, не превышающее 33. Отсутствие исследуемой ДНК ведет к отсутствию пересечения кривой флуоресценции порогового значения.
Диагностически значимой считается концентрация спейсерного участка фрагмента гена 16S-23S рРНК 102-104 копий/мл. Таким образом, если полученная концентрация спейсерного участка фрагмента гена соответствует диагностически значимой, то можно
утверждать о преимущественной роли этих видов микроорганизмов в развитии данной
патологии.
2
BY 10907 C1 2008.08.30
Определение концентрации спейсерного участка фрагмента гена 16S-23S рРНК рода
Mycoplasma в исследуемом биологическом материале проводится по следующей формуле:
Q = 10(- 0,219х31,26 + 10,535) = 4887 копий на 1 мл биологического материала,
где Q - концентрация спейсерного участка фрагмента гена 16S-23S рРНК,
31,26 - значение порогового цикла СТ.
Полученное значение концентрации позволяет судить о присутствии в респираторном
тракте пациента А возбудителей рода Mycoplasma.
Пример 2
Необходимо выявить наличие или отсутствие возбудителей рода Mycoplasma в назофарингеальном соскобе эпителиальных клеток пациента В с клиническим диагнозом "хронический синусит".
Аналогичным образом для выявления данных видов микроорганизмов применяют
Mycoplasma-специфичные праймеры и TaqMan олигонуклеотидные пробы, выбранные из
гена, кодирующего 16S-23S рРНК. Для определения концентрации возбудителей в биологическом материале строится стандартная кривая согласно примеру 1.
Определение концентрации спейсерного участка фрагмента гена 16S-23S рРНК рода
Mycoplasma в биологическом материале рассчитывается следующей по формуле:
Q = 10(- 0,219х42,56 + 10,535) = 9,9 копий на 1 мл биологического материала,
где Q - концентрация спейсерного участка фрагмента гена 16S-23S рРНК,
42,56 - значение порогового цикла СТ.
Полученное значение концентрации позволяет судить об отсутствии в респираторном
тракте пациента В возбудителей рода Mycoplasma.
Таким образом, по сравнению с прототипом заявляемый способ позволяет получить
следующее преимущество:
использование Mycoplasma-специфичных праймеров способствует повышению частоты выявления возбудителей респираторных микоплазмозов в биологическом материале
пациентов с заболеваниями различных отделов респираторного тракта за счет определения общего для нескольких видов возбудителей рода Mycoplasma молекулярного маркера,
что в свою очередь сокращает время проведения исследования и дает возможность своевременного назначения этиопатогенетической терапии.
Источники информации:
1. Liu G., Talkington D.F., Fields B.S., Levine O.S., Yang Y., Tondella M. - L.C. Chlamydia pneumoniae and Mycoplasma pneumoniae in young children from China with communityacquired pneumonia // Diagn Microb Infect Dis. - 2005. - Vol. 52. - P. 7-14 (прототип).
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
3
Документ
Категория
Без категории
Просмотров
0
Размер файла
110 Кб
Теги
by10907, патент
1/--страниц
Пожаловаться на содержимое документа