close

Вход

Забыли?

вход по аккаунту

?

Патент BY10908

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2008.08.30
(12)
(51) МПК (2006)
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
C 12Q 1/68
СПОСОБ ОПРЕДЕЛЕНИЯ КОНЦЕНТРАЦИИ ДНК
CHLAMYDOPHILA PNEUMONIAE И MYCOPLASMA PNEUMONIAE
В БИОЛОГИЧЕСКОМ МАТЕРИАЛЕ
(21) Номер заявки: a 20060670
(22) 2006.07.05
(43) 2008.02.28
(71) Заявитель: Государственное учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(72) Авторы: Хулуп Геннадий Яковлевич; Костюк Светлана Андреевна;
Силич Татьяна Владимировна; Полуян Ольга Сергеевна (BY)
BY 10908 C1 2008.08.30
BY (11) 10908
(13) C1
(19)
(73) Патентообладатель: Государственное
учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(56) TONDELLA M. L. et al. Journal of
Clinical Microbiology. - 2002. - V. 40. № 2. - P. 575-583.
Хулуп Г.Я. и др. Иммунопатология,
аллергология, инфектология. - 2004. № 3. - С. 84-89.
RU 2205876 C1, 2003.
RU 2241042 C1, 2004.
(57)
Способ определения концентрации ДНК Chlamydophila pneumoniae и Mycoplasma
pneumoniae в биологическом материале, заключающийся в том, что выделяют ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae из биологического материала и проводят
с ними мультиплексную полимеразную цепную реакцию в режиме реального времени с
праймерами 5'-CATGGTGTCATTCGCCAAGT-3', 5'-CGTGTCGTCCAGCCATTTTA-3', 5'CCAACCAAACAACAACGTTCA-3' и 5'- ACCTTGACTGGAGGCCGTTA-3' и TaqMan
олигонуклеотидными
мечеными
пробами
5'(FAM)TCTACGTTGCCTCTAAGAGAAAACTTCAAGTTGGA(TAMRA)3'
и
5'(FAM)TCAATCCGAATAACGGTGACTTCTTACCACTG(TAMRA)3', причем на этапе амплификации ДНК Chlamydophila
pneumoniae и Mycoplasma pneumoniae проводят денатурацию ДНК при температуре
+ 95 °С в течение 5 минут, отжиг сначала при температуре + 50 °С в течение 2 минут, а
затем при температуре + 95 °С в течение 10 минут и элонгацию сначала при температуре
+ 95 °С в течение 15 секунд в количестве 50 циклов, а затем при температуре + 60 °С в течение 1 минуты, и концентрацию ДНК Chlamydophila pneumoniae Q1, выраженную в количестве копий на 1 мл биологического материала, рассчитывают по формуле:
Vднк
1
⋅
⋅ 10 ( −0,338Ct +11,378 ) ,
Vпцр Vэкстр
где Vднк - объем ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae, выделенных из
биологического материала, мкл;
Vпцр - объем ДНК, взятый для проведения полимеразной цепной реакции в режиме реального времени, мкл;
Vэкстр - объем биологического материала, мкл;
Q1 =
BY 10908 C1 2008.08.30
Ct - значение цикла амплификации, при котором флуоресценция превышает пороговый уровень,
а концентрацию ДНК Mycoplasma pneumoniae Q2, выраженную в количестве копий на
1 мл биологического материала, рассчитывают по формуле:
Q2 =
Vднк
⋅
1
Vпцр Vэкстр
⋅10 (− 0,340Ct +12,678) ,
где Vднк - объем ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae, выделенных из
биологического материала, мкл;
Vпцр - объем ДНК, взятый для проведения полимеразной цепной реакции в режиме реального времени, мкл;
Vэкстр - объем биологического материала, мкл;
Ct - значение цикла амплификации, при котором флуоресценция превышает пороговый уровень.
Изобретение относится к медицине, к разделу клинической лабораторной диагностики.
Известен способ определения концентрации ДНК Chlamydophila pneumoniae путем
моноплексной количественной полимеразной цепной реакции в режиме реального времени (реал-тайм ПЦР) с использованием TaqMan олигонуклеотидных меченых проб, при котором определяется концентрация Chlamydophila pneumoniae в ПЦР смеси. Данный
способ является прототипом по отношению к заявляемому способу [1].
Общим признаком для заявляемого способа и прототипа является определение концентрации ДНК Chlamydophila pneumoniae в режиме реального времени (реал-тайм ПЦР)
с использованием TaqMan олигонуклеотидных меченых проб.
Однако указанный способ обладает следующими недостатками:
определяют концентрацию ДНК только одного возбудителя хламидиально-микоплазменной природы, а именно Chlamydophila pneumoniae, при заданном режиме амплификации с использованием праймеров и TaqMan олигонуклеотидных меченых проб,
выбранных для проведения моноплексной полимеразной цепной реакции в режиме реального времени, что увеличивает время и количество проводимых исследований в связи с
необходимостью проведения дополнительной реакции с другим режимом амплификации
для определения концентрации ДНК Mycoplasma pneumoniae и концентрацию ДНК Chlamydophila pneumoniae определяют в ПЦР смеси, что усложняет интерпретацию результата
определения концентрации ДНК Chlamydophila pneumoniae методом реал-тайм ПЦР с использованием TaqMan олигонуклеотидных меченых проб.
Задачей заявляемого способа является сокращение времени и количества проводимых
реакций при расширении спектра определяемых концентраций возбудителей хламидиально-микоплазменной природы с получением легко интерпретируемого результата определения концентрации ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae в
биологическом материале.
Поставленная задача достигается следующим образом.
Предложен способ определения концентрации ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae в биологическом материале, заключающийся в том, что выделяют
ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae из биологического материала и
проводят с ним мультиплексную полимеразную цепную реакцию в режиме реального
времени с праймерами 5'-CATGGTGTCATTCGCCAAGT-3', 5'-CGTGTCGTCCAGCCATTTTA-3', 5'-CCAACCAAACAACAACGTTCA-3', и 5'-ACCTTGACTGGAGGCCGTTA-3' и
TaqMan олигонуклеотидными мечеными пробами 5'(FAM)TCTACGTTGCCTCTAAGAGAAAACTTCAAGTTGGA(TAMRA)3', и 5'(FAM)TCAATCCGAATAACGGTGACTT2
BY 10908 C1 2008.08.30
CTTACCACTG(TAMRA)3', причем на этапе амплификации ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae проводят денатурацию ДНК при температуре + 95 °С в течение 5 минут, отжиг сначала при температуре + 50 °С в течение 2 минут, а затем при
температуре + 95 °С в течение 10 минут и элонгацию сначала при температуре + 95 °С в
течение 15 секунд в количестве 50 циклов, а затем при температуре + 60 °С в течение 1
минуты, и концентрацию ДНК Chlamydophila pneumoniae Q1, выраженную в количестве
копий на 1 мл в биологического материала, рассчитывают по формуле:
V
1
⋅10 ( −0,338⋅Ct +11,378) ,
Q1 = днк ⋅
Vпцр Vэкстр
где Vднк - объем ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae, выделенных из
биологического материала, мкл;
Vпцр - объем ДНК, взятый для проведения полимеразной цепной реакции в режиме реального времени, мкл;
Vэкстр - объем биологического материала, мкл,
Ct - значение цикла амплификации при флуоресценции превышает пороговый уровень;
а концентрацию ДНК Mycoplasma pneumoniae Q2, выраженную в количестве копий на
1 мл в биологического материала, рассчитывают по формуле:
V
1
⋅10( −0,340⋅Ct +12, 678) ,
Q 2 = днк ⋅
Vпцр Vэкстр
где Vднк - объем ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae, выделенных из
биологического материала, мкл;
Vпцр - объем ДНК, взятый для проведения полимеразной цепной реакции в режиме реального времени, мкл;
Vэкстр - объем биологического материала, мкл,
Ct - значение цикла амплификации при флуоресценции превышает пороговый уровень.
Пример.
Необходимо определить концентрацию ДНК Chlamydophila pneumoniae и концентрацию ДНК Mycoplasma pneumoniae в 1 мл мокроты пациента А с клиническим диагнозом "пневмония".
На первом этапе из 100 мкл (Vэкстр) мокроты суммарную ДНК выделяют сорбционным
методом: адсорбции на частицах двуокиси кремния в присутствии гуанидинатицианата
натрия, отмывая этиловым спиртом. При этом к 100 мкл физиологического раствора, содержащего клинический материал в пробирке объемом 1,5 мл (типа Eppendorf), добавляют
300 мкл раствора I (лизирующего, 6 М раствор гуанидина изотиоцианата) и 10 мкл суспензии сорбента (SiO2). Пробы инкубируют в течение 10 минут при комнатной температуре, 1-2 раза перемешивая на микроцентрифуге "Вортекс CV-1500" ("Хеликон", Россия)
при 1500 об/мин. Пробы центрифугируют в течение 15 сек на центрифуге "Циклотепм201" ("СТМ", Россия) при 12 тыс. оборотов в минуту, супернатант удаляют. К осадку добавляют 100 мкл раствора II (промывочного, 96 % этанол, содержащий 100 мМ ацетат натрия (рН 4,8)), встряхивают и центрифугируют. Процедуру отмывки повторяют 2 раза с
использованием раствора III (промывочного, 70 % этанол). Пробирки помещают в твердотельный микротермостат (модель 205, "СТМ", Россия) и подсушивают пробы 5 минут при
температуре 50 °С, оставляя пробирки открытыми. В пробирки с осадком добавляют 50
мкл ТЕ буфера (на 1 л буфера: 0,04 М Трис-ацетат (242 г Трис, 57,1 мл ледяной уксусной
кислоты), 0,002 М ЭДТА (100 мл 0,5 М ЭДТА рН 8,0) и инкубируют в течение 5 минут
при 50 °С. Пробирки центрифугируют в течение 15 сек при 12 тыс. оборотов. Водную фазу используют в качестве исследуемого образца ДНК для постановки реакции амплификации.
3
BY 10908 C1 2008.08.30
На втором этапе осуществляют амплификацию суммарной ДНК общим объемом 50
мкл (Vднк), выделенную из биологического материала (мокроты), и ДНК стандартов, которые необходимы для определения концентрации ДНК при проведении ПЦР в режиме
реального времени. Используемыми стандартами для определения концентрации Chlamydophila pneumoniae и Mycoplasma pneumoniae служат 10-кратно разведенные серии очищенного генома Chlamydophila pneumoniae и Mycoplasma pneumonia известных
концентраций в диапазоне от 102 до 104 копий/мл.
Проводят подготовку пробирок с ПЦР-смесью-1, содержащей смесь специфических
праймеров, позволяющих детектировать специфические фрагменты ДНК Chlamydophila
pneumoniae и Mycoplasma pneumonia, и нуклеотиды, раскапанные под воск.
Размораживают пробирку с ПЦР-смесью-3, содержащую смесь TaqMan олигонуклеотидных меченых проб, которые комплементарны специфическим фрагментам ДНК Chlamydophila pneumoniae и Mycoplasma pneumonia, и тщательно перемешивают содержимое.
Праймеры для детекции Chlamydophila pneumoniae и последовательности олигонуклеотидных меченых проб были выбраны из Pst-1 фрагмента, кодирующего протеин клеточной адгезии (номер в GeneBank AE001593) с использованием Primer Express программного обеспечения.
Chl.pn. 1 - 5'-CATGGTGTCATTCGCCAAGT-3' - (forward-праймер), Chl.pn. 2 - 5'CGTGTCGTCCAGCCATTTTA-3' - (reverse-праймер) определяют границы Pst-1 фрагмента
длиной 82 п.н. Chlamydophila pneumoniae, кодирующего протеин клеточной адгезии (номер в GeneBank АЕ001593).
TaqMan олигонуклеотидная меченая проба 5'(FAM)TCTACGTTGCCTCTAAGAGAAAACTTCAAGTTGGA(TAMRA)3' метится FAM в качестве флуорофора по 5' концу и
TAMRA по 3' концу в качестве гасителя.
Праймеры для детекции Mycoplasma pneumoniae и последовательности олигонуклеотидных меченых проб были выбраны из Р-1 фрагмента, кодирующего протеин клеточной
адгезии (номер в GeneBank X07191) с использованием Primer Express программного обеспечения.
M.pn. 1 - 5'-CCAACCAAACAACAACGTTCA-3' - (forward-праймер);
M.pn. 2 - 5'-ACCTTGACTGGAGGCCGTTA-3' - (reverse-праймер), ограничивают участок в 76 пар оснований Р1 фрагмента, кодирующий Р1 протеин клеточной адгезии (номер
в GeneBank X07191).
TaqMan олигонуклеотидная меченая проба 5'(FAM)TCAATCCGAATAACGGTGACTTCTTACCACTG(TAMRA)3' метится FАМ в качестве флуорофора по 5' концу и
TAMRA по 3' концу в качестве гасителя.
Праймеры и олигонуклеотидные меченые пробы для Chlamydophila pneumoniae, Mycoplasma pneumoniae смешивают. Во избежание конкуренции используют ограниченные
концентрации праймеров, в этом случае чрезмерное количество реагентов доступно для
амплификации ДНК другого, потенциально присутствующего в небольшом количестве
патогена.
Готовят верхнюю ПЦР-смесь из расчета 7 мкл ПЦР-смеси-2 (буфер и полимераза) на
одну реакцию. В пробирки с ПЦР-смесью-1 на поверхность застывшего воска раскапывают по 10 мкл верхней ПЦР-смеси, которая не должна проваливаться под воск и смешиваться с ПЦР-смесью-1.
В подготовленные таким образом пробирки вносят ДНК (Vпцр) по следующей схеме:
пробирка № 1-5 мкл ДНК, выделенной из клинического образца,
пробирка № 2-5 мкл смеси Стандарт 1 Chlamydophila pneumoniae (конц. 102 копий/мл)
и Стандарт 1 Mycoplasma pneumoniae (конц. 102 копий/мл),
пробирка № 3-5 мкл смеси Стандарт 1 Chlamydophila pneumoniae (конц. 102 копий/мл)
и Стандарт 1 Mycoplasma pneumoniae (конц. 102 копий/мл),
4
BY 10908 C1 2008.08.30
пробирка № 4-5 мкл смеси Стандарт 2 Chlamydophila pneumoniae (конц. 103 копий/мл)
и Стандарт 2 Mycoplasma pneumoniae (конц. 103 копий/мл),
пробирка № 5-5 мкл смеси Стандарт 2 Chlamydophila pneumoniae (конц. 103 копий/мл)
и Стандарт 2 Mycoplasma pneumoniae (конц. 103 копий/мл),
пробирка № 6-5 мкл смеси Стандарт 3 Chlamydophila pneumoniae (конц. 104 копий/мл)
и Стандарт 3 Mycoplasma pneumoniae (конц. 104 копий/мл),
пробирка № 7-5 мкл смеси Стандарт 3 Chlamydophila pneumoniae (конц. 104 копий/мл)
и Стандарт 3 Mycoplasma pneumoniae (конц. 104 копий/мл),
пробирка № 8-5 мкл отрицательного контрольного образца.
Помещают пробирки в ячейки ротора термоциклера "Rotor-Gene-3000" ("Corbette research", Австралия). Задают следующую программу для одновременной амплификации
ДНК Chlamydophila pneumoniae и ДНК Mycoplasma pneumoniae
1. Денатурация ДНК (расплетение двойной спирали) + 95 °С... 5 мин.
2. Отжиг (присоединение праймеров) + 50 °С...2 мин.
+ 95 °С...10 мин.
3. Элонгация (достраивание цепей ДНК) + 95 °С...15 сек. - 50 циклов
+ 60 °С...1 мин.
Этап амплификации при проведении полимеразной цепной реакции в режиме реального времени (реал-тайм ПЦР) с использованием TaqMan олигонуклеотидных меченых
проб основан на использовании 5'-экзонуклеазной активности полимеразы. В реакционную смесь добавляют ДНК-пробы, меченные на 5'-конце флуоресцентным красителем, а
на 3'-конце - фосфатной группой и гасителем флуоресценции. Пробы комплементарны
участку амплифицируемой области. Гаситель поглощает испускаемое флуоресцентной
меткой излучение, а фосфатная группа в 3'-положении блокирует полимеразу. При отжиге
праймеров олигонуклеотидная меченая проба количественно связывается с комплементарным участком ДНК. Во время стадии элонгации полимераза синтезирует комплементарную цепь ДНК и, дойдя до участка, гибридизованного с пробой, начинает расщеплять
пробу за счет 5'-экзонуклеазной активности. В результате флуоресцентная метка отделяется от гасителя, и ее свечение может детектироваться. Увеличение флуоресценции прямо
пропорционально количеству наработанного ПЦР-продукта. Кинетика накопления продуктов амплификации связана с исходной концентрацией матрицы, что дает возможность
точно оценить концентрацию ДНК в биологическом материале. Цикл (Ct), при котором
флуоресценция превышает пороговый уровень, задаваемый автоматически, используют
для расчета концентрации ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae.
Итоговые уравнения, характеризующие взаимосвязь порогового цикла флуоресценции
(Ct) и количества амплифицированной ДНК Chlamydophila pneumoniae, а именно
V
1
⋅10 ( −0,338⋅Ct +11,378) ,
Q1 = днк ⋅
Vпцр Vэкстр
и взаимосвязь порогового цикла флуоресценции (Ct) и количества амплифицированной ДНК Mycoplasma pneumoniae, а именно
V
1
Q 2 = днк ⋅
⋅10 ( −0,340⋅ Ct +12,678) ,
Vпцр Vэкстр
используются для расчета концентраций ДНК Chlamydophila pneumoniae и Mycoplasma pneumoniae в 1 мл мокроты.
При определении концентрации ДНК Chlamydophila pneumoniae путем мультиплексной количественной полимеразной цепной реакции в режиме реального времени с использованием смеси TaqMan олигонуклеотидных меченых проб и смеси праймеров для
проведения одновременной амплификации ДНК Chlamydophila pneumoniae и Mycoplasma
pneumoniae у данного пациента значение порогового цикла Ct = 25,75, поэтому
5
BY 10908 C1 2008.08.30
50 1
⋅
⋅10( −0,338⋅25, 75+11,378) = 47,26 (копий / мл мокроты).
5 100
При определении концентрации ДНК Mycoplasma pneumoniae путем мультиплексной
количественной полимеразной цепной реакции в режиме реального времени с использованием смеси TaqMan олигонуклеотидных меченых проб и смеси праймеров для проведения одновременной амплификации ДНК Chlamydophila pneumoniae и Mycoplasma
pneumoniae у данного пациента значение порогового цикла Ct = 32,48, поэтому
50 1
Q2 =
⋅
⋅10 ( −0,340⋅32, 48+12,678) = 43,13 (копий / мл мокроты).
5 100
У данного пациента обнаружены этиологически значимые концентрации обоих возбудителей (Chlamydophila pneumoniae и Mycoplasma pneumoniae) в мокроте, что позволяет
судить о смешенной инфекции и необходимости назначения соответствующего протокола
лечения.
Таким образом, по сравнению с прототипом заявляемый способ позволяет получить
следующее преимущество мультиплексной полимеразной цепной реакции в режиме реального времени (реал-тайм ПЦР) с использованием смеси TaqMan олигонуклеотидных
меченых проб и смеси праймеров для проведения одновременной амплификации ДНК
Chlamydophila pneumoniae и Mycoplasma pneumoniae определяют концентрацию ДНК
Chlamydophila pneumoniae, Mycoplasma pneumoniae в высокостандартизированном формате в течение 4-5 ч, что чрезвычайно экономично для образцов малого количества, без обработки ПЦР продуктов, что снижает риск ложноположительных результатов, которые
могут иметь место при манипуляциях с ампликонами.
Q1 =
Источники информации:
1. Maria Lucia С. Tondella, Deborah F. Talkington, Brian P. Holloway, Scott F. Dowell,
Karyn Cowley, Montse Soriano-Gabarro, Mitchell S. Elkind, and Barry S. Fields. Development
and Evaluation of Real-Time PCR-Based Fluorescence Assays for Detection of Chlamydia
pneumoniae//Journal of Clinical Microbiology. - 2002. - Vol. 40. - № 2. - P. 575-583 (прототип).
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
6
Документ
Категория
Без категории
Просмотров
0
Размер файла
96 Кб
Теги
by10908, патент
1/--страниц
Пожаловаться на содержимое документа