close

Вход

Забыли?

вход по аккаунту

?

Патент BY11062

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2008.08.30
(12)
(51) МПК (2006)
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
BY (11) 11062
(13) C1
(19)
G 01N 33/48
C 12Q 1/68
СПОСОБ ДИАГНОСТИКИ РЕСПИРАТОРНОГО ХЛАМИДИОЗА
(21) Номер заявки: a 20060668
(22) 2006.07.05
(43) 2008.02.28
(71) Заявитель: Государственное учреждение образования "Белорусская медицинская академия последипломного образования" (BY)
(72) Авторы: Хулуп Геннадий Яковлевич; Костюк Светлана Андреевна;
Скороход Геннадий Алексеевич;
Силич Татьяна Владимировна; Полуян Ольга Сергеевна (BY)
(73) Патентообладатель: Государственное
учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(56) LIU G. et al. Diagnostic Microbiology
and Infectious Disease. - 2005. - V. 52. P. 7-14.
RU 2205876 C1, 2003.
RU 2241042 C1, 2004.
BY 11062 C1 2008.08.30
(57)
Способ диагностики респираторного хламидиоза, при котором проводят полимеразную цепную реакцию в режиме реального времени с биологическим материалом из респираторного тракта больного, при этом используют праймеры 5'-GATGCCTGGCATTGATAGGCGATGAAGGA-3' и 5'-TGGCTCTCATGCAAAAGGCA-3' и TaqMan меченый олигонуклеотид 5'-FAM AACTGATCGATAGATCGATGATCGATAATCGATAAT
TAMRA-3' спейсерного фрагмента гена 23S рРНК возбудителя семейства Chlamydiaceae, а
респираторный хламидиоз диагностируют при выявлении указанного олигонуклеотида в
концентрации 102-104 копий в расчете на 1 мл биологического материала.
Изобретение относится к медицине, к разделу клинической лабораторной диагностики.
Известен способ выявления возбудителей заболеваний различных отделов респираторного тракта хламидиальной природы, таких как Chlamydia trachomatis и Chlamydophila
pneumoniae методом полимеразной цепной реакции в режиме реального времени, при котором определяют вид возбудителя и его количественные характеристики. Данный способ
является прототипом по отношению к заявляемому способу [1].
Общим признаком для заявляемого способа и прототипа является определение возбудителей хламидиальной природы в биологическом материале пациентов путем проведения полимеразной цепной реакции в режиме реального времени с количественной схемой
детекции продуктов амплификации.
Однако известный способ обладает следующими недостатками: при проведении полимеразной цепной реакции в режиме реального времени одновременно может определяться только один вид возбудителя семейства Chlamydiaceae. Вследствие того что
течение инфекционного процесса, индуцированного представителями семейства Chlamydiaceae, схоже и протоколы лечения респираторных хламидиозов одинаковы, существующий способ выявления возбудителей в биологическом материале пациентов с
BY 11062 C1 2008.08.30
заболеваниями различных отделов респираторного тракта малоэффективен по причине
длительности проведения данного вида исследования и, как следствие, несвоевременного
назначения этиопатогенетической терапии.
Задачей заявляемого способа является повышение вероятности выявления возбудителей респираторных хламидиозов в биологическом материале пациентов с заболеваниями
различных отделов респираторного тракта за счет определения общего для нескольких
видов возбудителей семейства Chlamydiaceae молекулярного маркера.
Поставленная задача осуществляется следующим образом.
Предложен способ диагностики респираторного хламидиоза, при котором проводят полимеразную цепную реакцию в режиме реального времени с биологическим материалом из
респираторного тракта больного, при этом используют Chl.1 5'-GATGCCTGGCATTGATAGGCGATGAAGGA-3' и Chl.2 5'-TGGCTCTCATGCAAAAGGCA-3' и TaqMan меченый олигонуклеотид 5 FAM AACTGATCGATAGATCGATGATCGATAATCGATAAT
TAMRA-3' спейсерного фрагмента 23S рРНК возбудителя семейства Chlamydiaceae, a респираторный хламидиоз диагностируют при выявлении указанного олигонуклеотида в концентрации 102-104 копий в расчете на 1 мл биологического материала.
В качестве биологического материала возможно использование назофарингеальных
соскобов эпителиальных клеток, материала из среднего носового хода (пазухи), забранного интраоперационно, а также мокроты.
Пример 1.
Необходимо выявить наличие или отсутствие возбудителей семейства Chlamydiaceae в
мокроте пациента А с клиническим диагнозом "двухсторонняя интерстициальная пневмония".
Для выявления данных видов микроорганизмов применяют Chlamydiaceae-специфичные
праймеры и TaqMan олигонуклеотидные пробы, выбранные из гена, кодирующего 23S рРНК.
Они имеют следующие консервативные нуклеотидные последовательности Chl.1 5'-GATGCCTGGCATTGATAGGCGATGAAGGA-3' и Chl.2 5'-TGGCTCTCATGCAAAAGGCA-3',
TaqMan олигонуклеотидная меченая проба имеет нуклеотидную последовательность 5-FАМ
AACTGATCGATAGATCGATGATCGATAATCGATAAT TAMRA-3.
Для проведения количественного анализа специфических фрагментов ДНК представителей семейства Chlamydiaceae, т.е. для определения концентрации фрагмента гена 23S
рРНК в биологическом материале, применяется полимеразная цепная реакция в режиме
реального времени с использованием термоциклера "Rotor-Gene-3000" ("Corbette research",
Австралия) и программного обеспечения на базе компьютера Intel Pentium-4.
Для определения концентрации возбудителей в биологическом материале строится
стандартная кривая в следующих координатах: X - концентрация стандартов, Y - пороговый цикл СТ (пороговый цикл - значение цикла, при котором пороговая линия и кривая
данных флуоресценции каждого амплифицированного продукта пересекаются). Значения
СТ предсказываются, исходя из оценки входного уровня пробы, то есть в стандартных условиях реакции, чем больше начальная концентрация образца, тем меньше СТ (фигура).
Образец считается положительным, если в таблице результатов пороговых циклов по
каналу FАМ для него определяется значение порогового цикла, не превышающее 33. Отсутствие исследуемой ДНК ведет к отсутствию пересечения кривой флуоресценции порогового значения.
Диагностически значимой считается концентрация фрагмента гена 23S рРНК семейства Chlamydiaceae 102-104 копий в расчете на 1 мл биологического материала. Таким образом, если полученная концентрация фрагмента гена соответствует диагностически
значимой, то можно утверждать о преимущественной роли этих видов микроорганизмов в
развитии данной патологии.
Определение концентрации фрагмента гена 23S рРНК семейства Chlamydiaceae в исследуемом биологическом материале проводится по следующей формуле:
2
BY 11062 C1 2008.08.30
Q = 10∧(-0,333*22,03 + 12,843) = 92047 копий в расчете на 1 мл биологического материала,
где Q - концентрация фрагмента гена 23S рРНК,
22,03 - значение порогового цикла СТ.
Полученное значение концентрации позволяет судить о присутствии в респираторном
тракте пациента А возбудителей семейства Chlamydiaceae.
Пример 2.
Необходимо выявить наличие или отсутствие возбудителей семейства Chlamydiaceae в
назофарингеальном соскобе эпителиальных клеток пациента В с клиническим диагнозом
"хронический синусит".
Аналогичным образом для выявления данных видов микроорганизмов применяют
Chlamydiaceae-специфичные праймеры и TaqMan олигонуклеотидные пробы, выбранные
из гена, кодирующего 23S рРНК. Для определения концентрации возбудителей в биологическом материале строится стандартная кривая согласно примеру 1.
Определение концентрации фрагмента гена 23S рРНК семейства Chlamydiaceae в биологическом материале проводится по следующей формуле:
Q = 10∧(-0,333*39,48 + 12,843) = 0,48 копий в расчете на 1 мл биологического материала,
где Q - концентрация фрагмента гена 23S рРНК,
39,48 - значение порогового цикла СТ.
Полученное значение концентрации позволяет судить об отсутствии в респираторном
тракте пациента В возбудителей семейства Chlamydiaceae.
Таким образом, по сравнению с прототипом заявляемый способ позволяет получить
следующее преимущество: использование Chlamydiaceae-специфичных праймеров способствует повышению частоты выявления возбудителей респираторных хламидиозов в
биологическом материале пациентов с заболеваниями различных отделов респираторного
тракта за счет определения молекулярного маркера возбудителей семейства Chlamydiaceae, что, в свою очередь, сокращает время проведения исследования и дает возможность своевременного назначения этиопатогенетической терапии.
Источники информации:
1. Liu G., Talkington D.F., Fields B.S., Levine O.S., Yang Y., Tondella M. - L.C. Chlamydia pneumoniae and Mycoplasma pneumoniae in young children from China with communityacquired pneumonia // Diagn Microb Infect Dis. - 2005. - Vol.52. - P. 7-14. - прототип.
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
3
Документ
Категория
Без категории
Просмотров
0
Размер файла
112 Кб
Теги
by11062, патент
1/--страниц
Пожаловаться на содержимое документа