close

Вход

Забыли?

вход по аккаунту

?

Патент BY12214

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2009.08.30
(12)
(51) МПК (2006)
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
BY (11) 12214
(13) C1
(19)
C 12N 15/61
ПЛАЗМИДА pET24bxylA, ОБЕСПЕЧИВАЮЩАЯ СИНТЕЗ
КСИЛОЗОИЗОМЕРАЗЫ В КЛЕТКАХ РЕКОМБИНАНТНОГО
ШТАММА ESCHERICHIA COLI БИМ В-427 Д,
И РЕКОМБИНАНТНЫЙ ШТАММ ESCHERICHIA COLI
БИМ В-427 Д - ПРОДУЦЕНТ КСИЛОЗОИЗОМЕРАЗЫ
(21) Номер заявки: a 20070802
(22) 2007.07.11
(43) 2009.02.28
(71) Заявитель: Государственное научное
учреждение "Институт микробиологии Национальной академии наук
Беларуси" (BY)
(72) Авторы: Шляхотко Екатерина Александровна; Сапунова Леонида Ивановна;
Лобанок Анатолий Георгиевич; Евтушенков Анатолий Николаевич (BY)
(73) Патентообладатель: Государственное
научное учреждение "Институт микробиологии Национальной академии наук
Беларуси" (BY)
(56) RU 2201455 C2, 2003.
RU 2224797 C2, 2004.
BY 12214 C1 2009.08.30
(57)
1. Плазмида pET24bxylA, содержащая встроенную по сайтам рестрикции NdeI и EcoRI
в область полилинкера плазмиды pET24b нуклеотидную последовательность, кодирующую
ген ксилозоизомеразы Arthrobacter nicotianae БИМ В-391 Д, которая фланкирована промотором и терминатором фага Т7, обеспечивающая синтез ксилозоизомеразы в клетках рекомбинантного штамма Escherichia coli BL-21(DE3)/pET24bxylA БИМ В-427 Д.
2. Рекомбинантный штамм Escherichia coli BL-21(DE3)/pET24bxylA БИМ В-427 Д, содержащий плазмиду по п. 1, продуцирующий ксилозоизомеразу.
Изобретение относится к микробиологии и биотехнологии, в частности к генной и
белковой инженерии, и может быть использовано для получения новых рекомбинантных
штаммов и препаратов ксилозоизомеразы, применяемой в промышленности для производства из осахаренного крахмалсодержащего сырья натуральных подсластителей - глюкозо-фруктозных сиропов и кристаллической фруктозы.
Для получения глюкозо-фруктозного сиропа и фруктозы используется микробная ксилозоизомераза, производство которой занимает лидирующие позиции в области биотехнологии ферментных препаратов. Основу рентабельности коммерческого производства
продуктов микробного синтеза, включая препараты ксилозоизомеразы, составляют высокоактивные штаммы-продуценты. Главенствующая роль в их создании на современном
этапе развития науки принадлежит технологиям рекомбинантных ДНК.
Синтез ксилозоизомеразы микроорганизмами обусловливается наличием в их геноме
гена xylA. Согласно имеющимся в научно-технической литературе данным, при условии,
что клонированный ген xylA находится под контролем lac-, tac-, pL- и других сильных
BY 12214 C1 2009.08.30
промоторов, на долю ксилозоизомеразы, продуцируемой генетически модифицированными штаммами, приходится от 20 до 60 % совокупного внутриклеточного белка [1-6].
Известен продуцент термоустойчивой ксилозоизомеразы - рекомбинантный штамм
Bacillus brevis, наследующий плазмидную ДНК, в которой ген ксилозоизомеразы из
Clostridium thermohydrosulfuricum ATCC 33223 клонирован под контролем промотора бациллярного гена, ответственного за синтез белка клеточной стенки [7]. Новый рекомбинантный штамм характеризовался в 100 раз более высокой, чем исходный штамм Clostridium
thermohydrosulfuricum ATCC 33223, продуктивностью. Однако использованная при конструировании штамма система контроля экспрессии гена не позволяет ему достичь продуктивности, обеспечивающей рентабельность производства ферментного препарата.
Известен рекомбинантный штамм Escherichia coli BL-21, у которого ген xylA, кодирующий термостабильную ксилозоизомеразу Thermoanaerobacter yonseii KB-1 (KFCC-11116), и
контролирующий его промотор фага Т7 локализован на плазмиде pTYGI [8]. Необходимым условием экспрессии гена в клетках рекомбинантного штамма, ограничивающим его
широкое использование для коммерческого получения ксилозоизомеразы, является обязательное наличие в питательной среде дорогостоящего индуктора - изопропил-1-тио-β-Dгалактопиранозида.
Известен рекомбинантный штамм Bacillus subtilis, содержащий гибридную плазмиду
pWH15OO с геном ксилозоизомеразы Bacillus megaterium DSM 319. Уровень продукции
ксилозоизомеразы трансформантом, в отличие от исходного штамма, повышен в 2,7 раза,
однако удельная активность фермента составила только 0,148 ед/мг белка [9].
Известно существенное повышение уровня синтеза фермента рекомбинантным штаммом Escherichia coli JM109/pUS12XI при клонировании в нем гена ксилозоизомеразы
Thermus thermophilus, котролируемого tac-промотором. Продуктивность нового штамма
была в 45 раз более высокой, чем исходного, но при этом составляла лишь 450 µМ/мин⋅л
среды [10].
Известно, что экспрессия в клетках рекомбинанта Escherichia coli BL-21(DE3)/pSYL10
гена ксилозоизомеразы Thermoanaerobacterium sp JM/SL-YS 489, находящегося под контролем промотора фага Т7/lас, индуцируется изопропил-1-тио-β-D-галактопиранозидом, и
доля фермента в объеме синтезируемого бактериями белка составляет 15 % [11].
Известны также рекомбинантные штаммы Escherichia coli BL-21(DE3)/рЕТ23аТТХI и
Escherichia coli BL-21(DE3)/pET23aTNXI, которые несут индуцируемые изопропил-1-тиоβ-D-галактопиранозидом гены xylA бактерий Thermoanaerobacterium thermosulfurigenes и
Termotoga neapolitana. Удельная активность ксилозоизомеразы частично очищенных бесклеточных экстрактов рекомбинантов составляет соответственно 9,3 и 15,1 ед/мг [12].
Наиболее близким предлагаемому по технической сущности и достигаемому результату является рекомбинантный штамм Streptomyces lividans TК 24 [13]. Для его конструирования сначала ген xylA из Streptomyces rubiginosus ATCC21175 в составе плазмиды
pRDW200 под контролем промотора бактериофага Т7 клонирован в Escherichia coli. Затем
сконструирована плазмида pRDW300 путем субклонирования гена xylA размером 1,2 kb
из плазмиды pRDW200 в плазмиду pIJ4090, содержащую селективные маркеры, сайт инициации репликации и еrmЕ-промотор. Далее гибридная плазмида путем трансформации
протопластов передается в Streptomyces lividans TK 24.
Рекомбинантный штамм Streptomyces lividans[pRDW300] характеризуется высоким
уровнем синтеза внутриклеточной ксилозоизомеразы, составляющим соответственно 6-17
и 10-24 ед/г биомассы, и продуктивностью, достигающей 1570-2440 µМ/мин⋅л.
К недостаткам указанного штамма следует отнести:
длительность процесса периодического выращивания продуцента, составляющего как
минимум 96 ч, включая 48 ч, необходимых для приготовления посевного материала, и как
минимум 48 ч собственно процесса культивирования, необходимых для биосинтеза ксилозоизомеразы;
2
BY 12214 C1 2009.08.30
обязательность введения в среду для приготовления посевного материала селективного
агента - антибиотика тиострептона (5 мг/мл), обеспечивающего преобладание в популяции глубинной культуры клеток рекомбинантного штамма, которые наследуют детерминирующую синтез ксилозоизомеразы гибридную плазмиду;
нуждаемость штамма в интенсивной (1,6 л/л⋅мин) аэрации для реализации высокого
уровня продукции фермента;
необходимость введения в емкости для культивирования штамма механических отбойников с целью гомогенизации и частичного разрушения растущей биомассы;
сложность процедуры выделения ксилозоизомеразы, включающей:
деструкцию клеток штамма-продуцента с использованием дорогостоящего фермента
лизоцима в количестве 2 мг/мл, что требует дальнейшей очистки фермента, предназначенного для использования в пищевой промышленности, от балластного белка;
экстракцию фермента в буферном растворе, содержащем ЭДТА и MgSO4, при перемешивании в течение 30 мин при 37 °С;
ультрацентрифугирование экстракта ксилозоизомеразы при 16000 g в течение 30 мин
при комнатной температуре для удаления нерастворимых остатков клеточных стенок
штамма-продуцента.
Задачей изобретения является конструирование плазмиды, детерминирующей синтез
ксилозоизомеразы в клетках содержащих их рекомбинантных бактерий, и создание нового
высокоактивного штамма - продуцента ксилозоизомеразы, характеризующегося низким
значением времени генерации, непродолжительным временем культивирования, стабильным наследованием инкорпорированной плазмиды в неселективных условиях, высоким
уровнем экспрессии клонированного гена и, следовательно, высокой продуктивностью,
умеренной зависимостью роста и синтеза фермента от аэрации питательной среды, простотой выделения фермента из клеток бактерий.
Плазмида и штамм, соответствующие указанным критериям, получены в результате
генно-инженерных манипуляций, включающих:
конструирование гибридной плазмиды pET24bxylA, имеющей размер 6439 п.н. и состоящей из NdeI/EcoRI фрагмента ДНК плазмиды рЕТ24b+, содержащего промотор, терминатор транскрипции РНК-полимеразы бактериофага Т7 и ген устойчивости к канамицину, а
также из NdeI/EcoRI фрагмента ДНК, содержащего ген ксилозоизомеразы актинобактерий
Arthrobacter nicotianae БИМ В-392 Д (фиг. 1 и 2);
перенос гибридной плазмиды pET24bxylA в клетки Escherichia coli BL-21(DE3) с получением рекомбинантного штамма Е. coli BL-21(DE3)/pET24bxylA, обеспечивающего
продукцию ксилозоизомеразы в количестве не менее 50 % синтезированного клеткой белка (фиг. 3).
Полученный штамм Escherichia coli BL-21(DE3)/pET24bxylA прошел проверку на безвредность и депонирован в Коллекции непатогенных микроорганизмов ГНУ "Институт
микробиологии НАН Беларуси" под регистрационным номером БИМ В-427 Д. Штамм также
поддерживается в лаборатории ферментов ГНУ "Институт микробиологии НАН Беларуси".
Штамм без потери культурально-морфологических и физиолого-биохимических свойств,
в том числе и ксилозоизомеразной активности, хранится при 4-6 °С нижеуказанными способами:
ежемесячными периодическими пересевами на агаризованную среду Луриа-Бертани
(LB), содержащую (в г/л): пептон - 10,0, дрожжевой экстракт - 5,0, NaCl - 10,0, агар-агар 15,0, в которую добавлено 20 ед/мл канамицина;
ежегодными периодическими пересевами на агаризованную LB-среду под слой минерального (вазелинового) масла;
лиофилизацией бактериальных клеток, выращенных на LB-aгape при 37 °С в течение
1-2 сут;
криоконсервацией при -70 °С клеток бактерий, суспендированных в 10 %-ном растворе
глицерина.
3
BY 12214 C1 2009.08.30
Культурально-морфологические свойства. Штамм относится к группе энтеробактерий.
На LB-aгape образует полупрозрачные светло-серые колонии округлой формы диаметром
2-3 мм. Поверхность колоний гладкая, блестящая, край ровный, структура гомогенная.
При росте в жидкой LB-среде образуют интенсивную ровную муть.
Клетки палочковидной формы, грамотрицательные, неспороносные.
Физиолого-биохимические признаки. Факультативный анаэроб, оптимальные условия
роста - рН 7,0 и температура 37 °С.
Хемоорганотроф. В качестве источника азота использует минеральные соединения в
аммонийной форме, а также органические вещества - пептон, триптон, дрожжевой экстракт, аминокислоты и т.д. В качестве источника углерода использует аминокислоты,
глицерин, углеводы.
Устойчивость к антибиотикам. Клетки проявляют устойчивость к канамицину в концентрации 20 ед/мл, обусловленную наличием локализованного на плазмиде гена устойчивости.
Продукт экспрессии гена xylA из Arthrobacter nicotianae БИМ В-391 Д в клетках Е. coli
BL-21(DE3)/pET24bxylA в условиях индукции изопропил-1-тио-β-D-галактопиранозидом
(1 мМ) или лактозой (0,001 %) составляет не менее 50 % совокупного синтезированного
белка.
Реакционная смесь для определения ксилозоизомеразы содержала: 0,2 мл 1 М раствора субстрата, 0,5 мл 0,2 М К,Nа-фосфатного буфера, рН 7,8; 0,1 мл 0,1 М MgSO4⋅7H2O;
20 мг клеток или 0,2 мл бесклеточного экстракта и дистиллированную воду до объема
2 мл. Длительность реакции изомеризации - 1 ч при 70 °С.
За единицу ксилозоизомеразной активности принимали такое количество фермента,
которое за 1 мин трансформирует 1 мкмоль альдосахара в его кетоформу в описанных
выше условиях. Продуктивность штамма выражали в единицах активности в расчете на
1 л культуральной жидкости (ед/л, или µМ/мин⋅л), удельную активность фермента - в единицах на 1 мг белка (ед/мг).
Количественное определение альдосахаров проводили цистеин-карбазольным методом [14].
Суть изобретения иллюстрируется следующими примерами.
Пример 1.
Конструирование плазмиды pET24bxylA и создание рекомбинантного штамма Escherichia coli BL-21(DE3)/pET24bxylA осуществляли следующим способом.
Фрагменты рестрицированной ферментом EcoRI хромосомной ДНК Arthrobacter nicotianae
БИМ В-391 Д размером 2-6 т.п.н. выделяли и лигировали с вектором pUC18, обработанным
тем же ферментом. Полученной смесью трансформировали компетентные клетки Е. coli
НВ101 (xуlA-). Отбирали клоны, которые наследовали гибридную плазмиду pUC18xylA и
после трех последовательных рассевов до изолированных колоний сохраняли способность
к росту на минимальной среде, содержащей (в г/л): цитрат натрия - 0,55, ксилоза - 5,0,
К2НРO4 - 10,5, КН2РO4 - 4,5, (NH4)2SO4 - 1,0, MgSO4⋅7H2O - 0,5, ампициллин - 0,1. Исходный рН питательных сред - 6,8.
Согласно результатам рестрикционного анализа, плазмидная ДНК отобранных клонов
содержала вставочный фрагмент размером 2,5 т.п.н., а клетки рекомбинантных бактерий
Е. coli HB101, наследующие плазмиды со вставкой, приобретали свойство синтезировать
каталитически активный ферментный белок. Полученные результаты свидетельствуют о
наличии гена xylA из Arthrobacter nicotianae БИМ В-391 Д в составе клонированного в
клетках Е. coli HB101 фрагмента ДНК.
На первом этапе клонирования в векторе рЕТ24b ген ксилозоизомеразы бактерий
Arthrobacter nicotianae БИМ В-391 Д амплифицирован с использованием следующих праймеров:
EcoRI (xylA-end: GCGAATTCTCAGCGGGCGCCCAGCA)
NdeI (xylA-start: CATCATATGACTCTTCAGCCAACCC).
4
BY 12214 C1 2009.08.30
Амплифицированный фрагмент для исключения вероятности клонирования неактивного гена встраивали в вектор pUC18 по сайтам рестрикции EcoRI и NdeI с получением
плазмиды рРr4. После установления методом секвенирующего анализа идентичности нуклеотидных последовательностей амплифицированного фрагмента ДНК и xylA из Arthrobacter nicotianae БИМ В-391 Д ген ксилозоизомеразы переклонировали по указанным
сайтам в вектор экспрессии рЕТ24b.
Трансформацию штамма Е. coli BL-21(DE3) осуществляли согласно общепринятым
методам. Для этого бактериями культивировали в LB-среде при 37 °С до достижения величины оптической плотности (ОП600) в пределах 0,3-0,4. Отделенные центрифугированием
клетки бактерий ресуспендировали в охлажденном 0,1 М растворе СаС12. Плазмидную
ДНК добавляли к суспензии компетентных клеток, смесь аккуратно смешивали, разбавляли
LB-средой, содержащей 20 мМ глюкозы, и, аэрируя, инкубировали при 37 °С в течение 1 ч
для экспрессии плазмидных генов антибиотикорезистентности. Смесь высевали на LB-агар,
содержащий 20 ед/мл канамицина, и инкубировали до появления бактериальных колоний.
Ксилозоизомеразную активность рекомбинантных клонов оценивали после их глубинного выращивания в LB-среде, содержащей в качестве индуктора изопропил-1-тио-βD-галактопиранозид (1 мМ) и в качестве селективного агента канамицин (20 мг/мл).
Посевным материалом служила 18-часовая культура бактерий, выращенных в LBсреде с канамицином (20 мг/мл), в количестве 1 об. %.
Условия культивирования: скорость вращения качалки - 180-200 об/мин; температура 37 °С, длительность культивирования - 6 ч.
В описанных условиях продуктивность рекомбинантного штамма Е. coli BL21(DE3)/pET24bxylA по ксилозоизомеразе составляет 1150 µМ/мин⋅л при удельной активности неочищенного фермента 2,25 ед/мг белка.
Для достижения уровня синтеза ксилозоизомеразы, сравнимого с уровнем продукции
фермента штаммом-прототипом, общая продолжительность стадии культивирования рекомбинантного штамма, включая время приготовления посевного материала (18 ч), составляет 24 ч, что, по меньшей мере, в 4 раза меньше, чем для этого необходимо штаммупрототипу.
Пример 2.
При исследовании времени генерации и стабильности наследования плазмиды
pET24bxylA рекомбинантный штамм Escherichia coli BL-21(DE3)/pET24bxylA выращивали, как указано в примере 1, до достижения стационарной фазы роста. Затем культуру
бактерий стократно разбавляли LB-средой, содержащей и не содержащей канамицин, и продолжали культивирование в вышеуказанных условиях, ежечасно определяя величину ее
оптической плотности при длине волны 600 нм. Из построенного в полулогарифмических
координатах графика зависимости оптической плотности культуры от времени культивирования находили время удвоения плотности культуры, определяемое как время генерации.
Этот показатель у рекомбинантного штамма Е. coli BL-21(DE3)/pET24bxylA при росте на
LB-среде как в присутствии антибиотика, так и в его отсутствие составляет 35 мин.
Определение стабильности наследования плазмиды pET24bxylA проводили на 20-й, 40-й,
60-й, 80-й, 100-й и 120-й генерациях клеток рекомбинантного штамма Е. coli BL-21(DE3) /
pET24bxylA путем их рассева на поверхность агаризованной LB-среды, содержащей и не
содержащей канамицин в вышеуказанной концентрации. Стабильно высокий уровень
наследования исследуемой плазмиды pET24bxylA в клетках рекомбинантного штамма
выявляется, по меньшей мере, в 120-й генерации клеток, независимо от присутствия в
среде селективного агента - канамицина. Косвенным подтверждением отмеченного факта
является высокая продуктивность различных генераций клеток по ксилозоизомеразе 1100-1500 µМ/мин⋅ч.
Клетки штамма-прототипа, в отличие от предлагаемого нами рекомбинантного штамма, поддерживают плазмиду в течение 17 генераций, после чего наступает их лизис.
5
BY 12214 C1 2009.08.30
Пример 3.
Глубинное выращивание рекомбинантного штамма Escherichia coli BL-21(DE3) /
pET24bxylA проводят, как описано в примере 1, за исключением того, что вместо изопропил-1-тио-β-D-галактопиранозида (1 мМ) в качестве индуктора гена xylA используют менее дефицитный и дорогой аналог - лактозу в количестве 0,001 %, а из среды для
приготовления посевного материала исключают селективный агент - канамицин.
Продуктивность рекомбинантных бактерий по ксилозоизомеразе составила 1500 µМ/мин⋅л,
удельная активность фермента - 2,0 ед/мг белка.
Пример 4.
Масштабирование процесса культивирования рекомбинантного штамма Е. coli BL21(DE3)/pET24bxylA осуществляют в 30 л ферментере при соблюдении следующих условий: коэффициент заполнения - 0,5; скорость подачи воздуха - 1 л/л среды в минуту; скорость вращения мешалки - 200 об/мин; температура культивирования - 37 °С.
Составы питательных сред для получения инокулюма и выращивания штамма, а также
условия индукции гена xylA и длительность культивирования аналогичны указанным в
примере 3.
Через 1 ч после добавления лактозы в среду культивирования у рекомбинантного
штамма инициируется синтез ферментного белка, а его максимальная продуктивность
достигает 2540 µМ/мин⋅л через три часа, что соответствует ранней стационарной фазе
роста (фиг. 4). Через 7,5-8 ч от начала культивирования наступает практически полный
лизис культуры.
Следовательно, выделение фермента из клеток предлагаемого рекомбинантного штамма Escherichia coli BL-21(DE3)/pET24bxylA, в отличие от штамма-прототипа, осуществляется спонтанно и не требует дополнительной ферментативной деструкции клеток.
Пример 5.
Проводят культивирование рекомбинантного штамма, как описано в примере 4, за исключением того, что интенсивность аэрации питательной среды увеличивают до 1,6 л/л
среды, что соответствует оптимальным условиям для образования ксилозоизомеразы
штаммом-прототипом.
Продуктивность рекомбинантного штамма Escherichia coli BL-21(DE3)/pET24bxylA no
ксилозоизомеразе в условиях повышенной в 1,6 раза аэрации составила 2520 µМ/мин⋅л,
что равнозначно этому показателю у культуры, выращенной в условиях ее невысокого
снабжения кислородом.
Пониженный уровень аэрации среды, необходимый для достижения предлагаемым
штаммом-продуцентом такого же уровня продуктивности, как у штамма-прототипа, обеспечивает первому экономические преимущества.
Пример 6.
Проводят культивирование рекомбинантного штамма, как описано в примере 4, и
получают 18 л культуральной жидкости, содержащей лизированные клетки Е. соli
BL-21(DE3)/pET24bxylA, с суммарной ксилозоизомеразной активностью 45540 ед.
Для получения бесклеточного препарата ксилозоизомеразы культуральную жидкость
нагревают при 70 °С в течение 10 мин для удаления термолабильных белков, центрифугируют (8000 g, 10 мин) и 20-кратно концентрируют через мембранные фильтры УПМ-20
("Владипор", Россия).
Получают бесклеточный концентрат ксилозоизомеразы в количестве 0,89 л с выходом
по ферментативной активности 95 %.
Таким образом, заявляемый рекомбинантный штамм Escherichia coli BL-21(DE3) /
pET24bxylA БИМ В-427Д, в течение, по меньшей мере, 120 генераций стабильно наследующий заявляемую плазмиду, по важнейшим показателям (ферментативной активности,
продуктивности, технологическим свойствам) превосходит известные аналоги, что позволяет рекомендовать его для получения микробной ксилозоизомеразы, востребованной в
производстве глюкозо-фруктозных сиропов и кристаллической фруктозы.
6
BY 12214 C1 2009.08.30
Источники информации:
1. Lawlis V.B., Dennis M.S., Chen E.Y., Smith D.H., Henner D.J. Cloning and sequencing
of the xylose isomerase and xylulose kinase genes of Escherichia coli // Appl. Environ. Microbiol. 1984. - Vol. 47. - P. 15-21.
2. Batt C.A., O'Neill E., Novak S.R., Ко J., Sinskey A. Hyperexpression of Escherichia coli
xylose isomerase // Biotechnol. Prog. - 1986. - Vol. 2. - P. 140-144.
3. Lastick S.M., Tucker M.V., Mackedomski V., Grohman K. Overproduction of Escherichia
coli xylose isomerase // Biotechnol. Lett. - 1986. - Vol. 8. - P. 1-6.
4. Cui H., Liu X., Li C., Wang Y., Wang C., Niu L., Xu X., Cui T. Overexpression of Streptomyces diastaticus No. 7 strain M1033 glucose isomerase in Escherichia coli//Gaojishu
Tongxun. - 1993. - Vol. 3. - No. 7. - P. 9-12.
5. Wuxiang L., Jeyaseelan K. High level expression of thermostable Bacillus xylose (glucose) isomerase in Escherichia coli // Biotechnol. Lett. - 1993. - Vol. 15. - P. 1101-1106.
6. Park H.-D., Joo G.-J., Rhee I.-K. Overproduction of Escherichia coli D-xylose isomerase
using λpL promoter//J. Microbiol. Biotechnol. - 1997. - Vol. 7. - No. 1. - P. 812.
7. Патент JP 4126080, МПК С 12N 15/9; С 12N 9/90; С 12N 15/61, 1992.
8. Патент KR 20010077016, МПК C 12N 15/00; C 12N 15/00; (IPC1-7): C 12N 15/00, 2001.
9. Rygus Т., Scheler A., Allmansberger R., Hillen W. Molecular cloning, structure, promoters and regulatory elements for transcription of the Bacillus megaterium encoded regulon for
xylose utilization // Arch. Microbiol. - 1991. - Vol. 155. - No. 6. - P. 535-542.
10. Dekker K., Sugiura A., Yamagata H., Sakaguchi K., Udaka S. Cloning and expression of
the xylose (glucose) isomerase gene from the thermophile Thermus thermophilus
HB8//Biochemical Engineering for 2001 (Proceedings of Asia-Pacific Biochemical Conference
1992). Ed. By S. Furusaki, I. Endo, R. Matsuno. Springer-Verlag: Tokyo - Berlin - Heidelberg New York - London - Paris - Hong Kong - Barcelona, 1992.- P. 53-55.
11. Liu S.Y., Wiegel J., Gherardini F.C. Purification and cloning of a thermostable xylose
(glucose) isomerase with an acidic pH optimum from Thermoanaerobacterium strain JW/SL-YS
489 // J. Bacteriol. - 1996. - Vol. 178. - No. 20. - P. 5938-5945.
12. Sriprapundh D., Vieille C., Zeikus J.G. Molecular determinants of xylose isomerase thermal stability and activity: analysis of thermozymes by site-directed mutagenesis // Protein Engineering. - 2000. - Vol. 13. - No. 4. - P. 259-265.
13. Wang F., Whitaker R.D., Batt C.A. Production of glucose isomerase in a recombinant
strain of Streptomyces lividans // Appl. Microbiol. Biotechnol. - 1998. - V. 50. - No. 1. - P. 65-70.
14. Dische Z., Borenfreund E. A new spectrophotometric method for the detection and determination of ketosugars and trioses // J. Biol. Chem. - 1951. - Vol. 192. - P. 583-587.
7
BY 12214 C1 2009.08.30
Фиг. 1
Карта плазмиды pET24bxylA
Фиг. 2
Индукция изопропил-1-тио-β-D-галактопиранозидом (ИПТГ)
и лактозой синтеза ксилозоизомеразы рекомбинантным штаммом
Е. coli BL-21(DE3)/pET24bxylA.
1 - маркер молекулярной массы
2 - белок клеток до внесения индуктора,
синтез фермента клетками через один, два и четыре
ч а с а и н д ук ц и и ИП Т Г (3 , 4 , 5 , с оо т в е т с т в ен н о )
лактозой (6,7, 8, соответственно)
Рост рекомбинантного штамма Е. coli BL21(DE3)/pET24bxylA и синтез ксилозоизомеразы в ферментере.
1 - биомасса, ОП600,
2 - ксилозоизомераза, ед./мл.
Стрелка указывает на время внесения лактозы в среду культивирования
Фиг. 3
Фиг. 4
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
8
Документ
Категория
Без категории
Просмотров
0
Размер файла
1 363 Кб
Теги
by12214, патент
1/--страниц
Пожаловаться на содержимое документа