close

Вход

Забыли?

вход по аккаунту

?

Патент BY12704

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2009.12.30
(12)
(51) МПК (2006)
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
BY (11) 12704
(13) C1
(19)
A 61K 31/7115
КОМБИНАЦИЯ ДВУХ CPG ОЛИГОНУКЛЕОТИДОВ ИЗ ГЕНОМА
БАКТЕРИЙ РОДА KLEBSIELLA, ВЫЗЫВАЮЩАЯ СОЗРЕВАНИЕ IN
VITRO МОНОЦИТАРНЫХ ДЕНДРИТНЫХ КЛЕТОК
(21) Номер заявки: a 20070797
(22) 2007.06.28
(43) 2009.02.28
(71) Заявитель: Государственное учреждение "Научно-исследовательский
институт эпидемиологии и микробиологии" Министерства здравоохранения Республики Беларусь
(BY)
(72) Авторы: Титов Леонид Петрович;
Гончаров Андрей Евгеньевич (BY)
(73) Патентообладатель: Государственное
учреждение "Научно-исследовательский
институт эпидемиологии и микробиологии" Министерства здравоохранения Республики Беларусь (BY)
(56) ГОНЧАРОВ А.Е. и др. Цитология. 2006. - Т. 48, № 9. - С. 740.
BY 12704 C1 2009.12.30
(57)
Комбинация двух CpG олигонуклеотидов из генома бактерии рода Klebsiella, имеющих нуклеотидную последовательность 5'-gccggaaaacagcaaggcgctgcgccgtt и 5'cccgcagatgggcgccgcgccgga, при их объемном соотношении 1:1, вызывающая созревание in
vitro выделенных адгезией на пластике моноцитарных дендритных клеток с усиленной
продукцией интерлейкина-12 и уменьшенной продукцией интерлейкина-10.
Изобретение относится к области медицины, в частности к методам биотехнологии и
клеточной иммунотерапии, и может быть использовано для подготовки дендритных клеток с целью клеточной иммунотерапии.
В последнее десятилетие для индукции иммунного ответа у больных с хроническими
инфекционными и онкологическими заболеваниями используются полученные из моноцитов антигенспецифические моноцитарные дендритные клетки [1]. CD14 + моноциты
культивируются в питательной среде с человеческими рекомбинантными цитокинами:
гранулоцитарно-макрофагальным колониестимулирующим фактором (ГМ-КСФ) и интерлейкином-4 (ИЛ-4), под действием которых происходит дифференцировка моноцитов в
незрелые моноцитарные дендритные клетки. Полученные незрелые дендритные клетки
праймируются антигеном и культивируются с индукторами созревания [1, 2]. В известных
методиках получения зрелых дендритных клеток используют различные индукторы созревания, например рекомбинантный человеческий фактор некроза опухолей - альфа
(ФНО-α), СD40-лиганд (CD40L) или липополисахарид (ЛПС) [2]. О созревании клеток
судят по изменению морфологии клеток, усилению экспрессии костимуляторных молекул
CD40, CD80, CD86, молекулы II класса гистосовместимости HLA-DR, специфического
маркера зрелых дендритных клеток - CD83 [2, 3].
BY 12704 C1 2009.12.30
Недостатками используемых индукторов созревания являются недостаточная продукция провоспалительных цитокинов (в частности интерлейкина-12) под действием ФНО-α
[4], высокая продукция противовоспалительного иммуносупрессивного цитокина - интерлейкина-10 при использовании ЛПС [5].
Для индукции созревания плазмацитоидных дендритных клеток также используются
олигонуклеотиды, содержащие CpG-мотивы (неметилированные последовательности нуклеотидов: пурин-пурин-цитозин-гуанин-пиримидин-пиримидин), имеющие различную
нуклеотидную последовательность. Однако известные олигонуклеотиды оказывают эффект только на плазмацитоидные, но не на миелоидные (моноцитарные) дендритные
клетки [6].
Задачей явилась разработка индуктора созревания in vitro моноцитарных дендритных
клеток, оказывающего эффект на моноцитарные дендритные клетки, с усиленной продукцией интерлейкина-12 и уменьшенной или сравнимой с другими индукторами продукцией
интерлейкина-10.
Задача решается с помощью комбинации двух CpG олигонуклеотидов из генома бактерии
рода
Klebsiella,
имеющих
нуклеотидную
последовательность
5'gccggaaaacagcaaggcgctgcgccgtt и 5'-cccgcagatgggcgccgcgccgga, при их объемном соотношении 1 : 1 вызывающих созревание in vitro выделенных адгезией на пластике моноцитарных дендритных клеток с усиленной продукцией интерлейкина-12 и уменьшенной
продукцией интерлейкина-10.
Данные олигонуклеотиды могут быть синтезированы автоматическим твердофазным
методом с последующей очисткой PAGE-электрофорезом и жидкостной хроматографией.
Новизна изобретения заключается в использовании комбинации двух нуклеотидных
последовательностей, содержащих CpG-мотивы из генома бактерий рода Klebsiella для
индукции созревания моноцитарных дендритных клеток, полученных из моноцитов, выделенных адгезией на пластике.
Сущность изобретения иллюстрируется следующими примерами.
Пример 1
Исследование фенотипа зрелых моноцитарных дендритных клеток.
Эксперименты проводились на незрелых моноцитарных дендритных клетках, полученных из моноцитов, выделенных адгезией на пластике. Из крови здоровых доноров
(n = 9) центрифугированием на градиенте плотности фиколл-пака (Amersham, США) выделяли фракцию мононуклеаров, затем из полученной суспензии клеток выделяли моноциты методом адгезии на пластике (Sarstedt, Германия). Для получения незрелых
дендритных клеток моноциты культивировали 7 суток в питательной среде RPMI-1640 с
10 % телячьей эмбриональной сыворотки, L-глютамином, пируватом натрия и HEPES (все
производства Sigma-Aldrich, США), содержащей рекомбинантные человеческие цитокины
(50 нг/мл ГМ-КСФ и 25 нг/мл ИЛ-4 производства StemCell Technologies, Канада). Затем в
лунку с 5×105 незрелых ДК в 1 мл среды, содержащей рекомбинантные человеческие цитокины (25 нг/мл ГМ-КСФ и 12,5 нг/мл ИЛ-4), добавляли индукторы созревания: 1-я лунка: ФНО-α 25 нг/мл (StemCell Technologies, Канада), 2-я лунка: олигонуклеотиды,
содержащие CpG-мотивы CPG1 и CPG2 по 10 мкг/мл каждого ("Актех", Минск). Клетки
культивировали при 37 °С в увлажненной атмосфере с 5 % CO2 в течение 2 суток.
После культивирования изучали фенотип полученных дендритных клеток методом
проточной цитофлюориметрии с использованием моноклональных антител к следующим
маркерам: CD80 (Becton Dickenson, США), CD83 (Beckman-Coulter, США), HLA-DR (Caltag, США). Учитывался процент экспрессии маркеров клетками, а также средняя интенсивность флюоресценции. При делении средних уровней флюоресценции
экспериментального образца и неокрашенного контроля получали значения относительной интенсивности флюоресценции, которая характеризует количество молекул на клетку.
2
BY 12704 C1 2009.12.30
В результате исследований установлено, что зрелые моноцитарные дендритные клетки, индукция созревания которых проводилась как при помощи ФНО-α, так и с использованием предложенной комбинации олигонуклеотидов, экспрессировали сравнимые
количества молекул CD80, CD83 и HLA-DR (фиг. 1, фиг. 2).
На фиг. 1 показан процент экспрессии маркеров CD80, CD83 и HLA-DR моноцитарными дендритными клетками, индукция созревания которых проводилась при помощи
ФНО-α или заявляемой комбинации олигонуклеотидов CpG1 и CpG2.
На фиг. 2 показана относительная интенсивность флюоресценции маркеров CD80,
CD83 и HLA-DR на моноцитарных дендритных клетках, индукция созревания которых
проводилась при помощи ФНО-α или заявляемой комбинации олигонуклеотидов CpG1 и
CpG2.
Пример 2
Исследование экспрессии мРНК интерлейкина-10 и интерлейкина-12 зрелыми моноцитарными дендритными клетками.
Эксперименты проводились на незрелых моноцитарных дендритных клетках, полученных из моноцитов, выделенных адгезией на пластике. Из крови здоровых доноров
(n = 9) центрифугированием на градиенте плотности фиколл-пака (Amersham, США) выделяли фракцию мононуклеаров, затем из полученной суспензии клеток выделяли моноциты методом адгезии на пластике (Sarstedt, Германия). Для получения незрелых
дендритных клеток моноциты культивировали 7 суток в питательной среде RPMI-1640 с
10 % телячьей эмбриональной сыворотки, L-глютамином, пируватом натрия и HEPES (все
производства Sigma-Aldrich, США), содержащей рекомбинантные человеческие цитокины
(50 нг/мл ГМ-КСФ и 25 нг/мл ИЛ-4 производства StemCell Technologies, Канада). Затем в
лунку с 5×105 незрелых ДК в 1 мл среды, содержащей рекомбинантные человеческие цитокины (25 нг/мл ГМ-КСФ и 12,5 нг/мл ИЛ-4), добавляли индукторы созревания: 1-я лунка: ФНО-α 25 нг/мл (StemCell Technologies, Канада), 2-я лунка: олигонуклеотиды,
содержащие CpG-мотивы CPG1 и CPG2 по 10 мкг/мл каждого ("Актех", Минск). Клетки
культивировали при 37 °С в увлажненной атмосфере с 5 % СО2 в течении 2 суток.
После культивирования проводилось выделение общей РНК, синтез кДНК и изучение
экспрессии мРНК цитокинов интерлейкина-10 и интерлейкина-12р40 методом полуколичественной ПЦР с детекцией в режиме реального времени.
В результате исследований установлено, что зрелые дендритные клетки, полученные
из моноцитов, выделенных адгезией, индукция созревания которых проводилась при помощи предложенной комбинации олигонуклеотидов, при сравнимой с ФНО-α экспрессии
мРНК иммуносупрессивного цитокина интерлейкина-10 экспрессируют на порядок больше мРНК иммунорегуляторного про-Tx1 цитокина интерлейкина-12 (фиг. 3).
На фиг. 3 показана экспрессия мРНК цитокинов интерлейкина-10 и интерлейкина12р40 моноцитарными дендритными клетками, индукция созревания которых проводилась при помощи ФНО-α или комбинации заявляемых олигонуклеотиов CpG1 и CpG2.
Как видно из примеров 1 и 2, предложенная комбинация олигонуклеотидов CpG1 и
CpG2 индуцирует созревание моноцитарных дендритных клеток, полученных из моноцитов, выделенных адгезией. При сравнимом с ФНО-α фенотипе предложенные олигонуклеотиды обладают преимуществом по сравнению с известными индукторами созревания.
Так, зрелые дендритные клетки, индукция созревания которых проводилась при помощи
предложенной комбинации олигонуклеотидов, экспрессируют на порядок больше мРНК
иммунорегуляторного про-Tx1 цитокина интерлейкина-12. Экспрессия мРНК иммуносупрессивного цитокина интерлейкина-10 сравнима при использовании в качестве индукторов созревания как ФНО-α, так и предложенной комбинации олигонуклеотидов.
3
BY 12704 C1 2009.12.30
Использованные источники:
1. Berger C.L., Xu An-Lin, Hanlon D. Induction of human tumor-loaded dendritic cells. Int.
J. Cancer: 91, 438-447 (2001).
2. Schuurhuis D.H., Fu N., Ossendorp F., Melief C. Ins and Outs of Dendritic Cells. Int Arch
Allergy Immunol 2006; 140:53-72.
3. Mohamadzadeh M., Luftig R. Dendritic Cells: In the Forefront Of Immunopathogenesis
And Vaccine Development. // J Immune Based Therapies And Vaccines. 2004. 2:1-7.
4. Pedersen A. E., Thorn M., Gad M. et al. Phenotypic and Functional Characterization of
Clinical Grade Dendritic Cells Generated from Patients with Advanced Breast Cancer for Therapeutic Vaccination. // Scandinavian Journal of Immunology 61 (2). - P. 151.
5. Corinti S., Albanesi C., la Sala A., Pastore S., Girolomoni G. Regulatory Activity of
Autocrine IL-10 on Dendritic Cell Functions. // The Journal of Immunolog. - 2001. - № 166. P. 4312.
6. Bauer M., Redecke V., Ellwart J.W. et al. Bacterial CpG-DNA Triggers Activation and
Maturation of Human CD11с-, CD123+ Dendritic Cells. // The Journal of Immunology. - 2001. № 166. - P. 5002.
Фиг. 1
Фиг. 2
4
BY 12704 C1 2009.12.30
Фиг. 3
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
5
Документ
Категория
Без категории
Просмотров
0
Размер файла
451 Кб
Теги
by12704, патент
1/--страниц
Пожаловаться на содержимое документа