close

Вход

Забыли?

вход по аккаунту

?

Патент BY14148

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2011.04.30
(12)
(51) МПК (2009)
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
G 01N 33/48
СПОСОБ ДИАГНОСТИКИ ЮВЕНИЛЬНОГО ПЕРИОДОНТИТА
(21) Номер заявки: a 20081344
(22) 2008.10.24
(43) 2010.06.30
(71) Заявитель: Государственное учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(72) Авторы: Юдина Наталья Александровна; Костюк Светлана Андреевна; Люговская Анна Викторовна;
Глинкина Татьяна Владимировна;
Полуян Ольга Сергеевна; Руденкова Татьяна Владимировна (BY)
BY 14148 C1 2011.04.30
BY (11) 14148
(13) C1
(19)
(73) Патентообладатель: Государственное
учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(56) ORRÙ G. et al. BMC Infectious Diseases,
2006. - V.6. - No. 98. Найдено на http://
www.biomedcentral.com/1471-2334/6/98.
RU 2329509 С2, 2008.
RU 2307592 С1, 2007.
SU 1445684 А1, 1988.
HARASZTHY V.I. et al. J. Periodontol. 2000. - V. 71. - No. 6. - P. 912-922.
TINOCO E.M. et al. J. Clin. Periodontol.,
1998. - V. 25. - No. 2. - P. 99-105.
ZAMBON J.J. J. Clin. Periodontol. - 1985. V. 12. - No. 1. - P. 1-20.
(57)
Способ диагностики ювенильного периодонтита по выявлению Aggregatibacter actinomycetemcomitans, отличающийся тем, что выделяют из содержимого периодонтального
кармана сорбционным методом ДНК микроорганизмов и проводят полимеразную цепную
реакцию в режиме реального времени с использованием праймеров для детекции Aggregatibacter
actinomycetemcomitans
5'-CATTCTCGGCGAAAAAACTA-3'
и
5'CCCATAACCAAGCCACATAC-3' и TaqMan олигонуклеотидного меченого зонда
5'(FAM)-TAATAATTACTCTCTACCCCAAGGATAACG-(TAMRA)3' на этапе амплификации ДНК, причем проводят денатурацию ДНК при температуре + 95 °С в течение 1 минуты, отжиг в количестве 50 циклов сначала при температуре + 95 °С в течение 10 секунд, а
затем при температуре + 60 °С в течение 30 секунд и элонгацию в количестве 50 циклов
при температуре + 72 °С в течение 15 секунд, а концентрацию ДНК Q Aggregatibacter actinomycetemcomitans рассчитывают по формуле:
Q = 10(-0,357*Ct+11,723)/0,7,
где Ct - значение цикла амплификации ДНК при флуоресценции, превышающей пороговый уровень,
и при получении значения Q более 105 копий на 1 мл содержимого периодонтального
кармана диагностируют ювенильный периодонтит.
Изобретение относится к медицине, а именно к стоматологии, и может использоваться
для диагностики ювенильного периодонтита с целью установления этиологического фактора заболевания.
BY 14148 C1 2011.04.30
Важную роль в этиопатогенезе ювенильного периодонтита играет Aggregatibacter actinomycetemcomitans. Методы клинической диагностики не позволяют выявить этиологически значимый возбудитель, что не дает объективную оценку патологическому процессу в
тканях периодонта, снижает точность диагностики и эффективность терапии.
Задачей изобретения является выявление Aggregatibacter actinomycetemcomitans в содержимом периодонтального кармана, что поможет повысить точность диагностики, провести адекватные лечебные мероприятия и оценить эффективность проведенного лечения.
Поставленная задача решается следующим образом. Предложен способ диагностики
ювенильного периодонтита по выявлению Aggregatibacter actinomycetemcomitans, при котором выделяют из содержимого периодонтального кармана сорбционным методом ДНК
микроорганизмов и проводят полимеразную цепную реакцию в режиме реального времени с использованием праймеров для детекции Aggregatibacter actinomycetemcomitans
5'-CATTCTCGGCGAAAAAACTA-3' и 5'-CCCATAACCAAGCCACATAC-3' и TaqMan олигонуклеотидного меченого зонда 5'(FAM)-TAATAATTACTCTCTACCCCAAGGATAACG(TAMRA)3' на этапе амплификации ДНК, причем проводят денатурацию ДНК при температуре + 95 °С в течение 1 минуты, отжиг в количестве 50 циклов сначала при температуре + 95 °С в течение 10 секунд, а затем при температуре + 60 °С в течение 30 секунд и
элонгацию в количестве 50 циклов при температуре + 72 °С в течение 15 секунд, а концентрацию ДНК Q Aggregatibacter actinomycetemcomitans рассчитывают по формуле:
Q = 10(-0,357*Ct + 11,723)/0,7,
где Ct - значение цикла амплификации ДНК при флуоресценции, превышающей пороговый уровень;
и при получении значения Q более 105 копий на 1 мл содержимого периодонтального
кармана диагностируют ювенильный периодонтит.
На фигуре представлена стандартная кривая, определяющая взаимосвязь концентрации ДНК Aggregatibacter actinomycetemcomitans и цикла CT, при котором пороговая линия
и кривая данных флуоресценции каждого амплифицированного продукта пересекаются.
Пример 1.
Пациент В., 15 лет. Жалобы на неприятный запах изо рта, кровоточивость десны во
время чистки. Клинически десна бледно-розовая, при зондировании кровоточит, в области
зубов: 16, 26, 36, 46, 31, 32, 41, 42 периодонтальные карманы глубиной 6-7 мм. На ортопантомограмме вокруг зубов 16, 26, 36, 46 наблюдается билатеральная вертикальная резорбция на 1/2 длины корня зуба, горизонтальная деструкция на 1/3 длины корня в
области резцов нижней челюсти.
Для выявления у пациента В. ДНК Aggregatibacter actinomycetemcomitans в качестве
биологического материала используют содержимое периодонтального кармана, так как
здесь данный микроорганизм проявляет свою наибольшую активность. Забор биологического материала осуществляют из самого глубокого кармана в каждом из шести зубных
секстантов. При этом наддесневую поверхность зуба очищают от налета, изолируют место
забора материала стерильными ватными тампонами, просушивают. Стерильный бумажный
штифт размером № 35 вводят до дна кармана и оставляют в нем на 10 секунд, забранный
материал погружают в герметично закрытый стерильный контейнер для транспортировки
с транспортной средой.
С выделенной сорбционным методом из биологического материала периодонтального
кармана ДНК Aggregatibacter actinomycetemcomitans проводят полимеразную цепную
реакцию в режиме реального времени, при этом осуществляют амплификацию ДНК
Aggregatibacter actinomycetemcomitans общим объемом 100 мкл и ДНК Aggregatibacter
actinomycetemcomitans стандартов, которые необходимы для определения концентрации
ДНК при проведении ПЦР в режиме реального времени. Используемыми стандартами
для определения концентрации Aggregatibacter actinomycetemcomitans служат 10-кратно
2
BY 14148 C1 2011.04.30
разведенные серии генома Aggregatibacter actinomycetemcomitans известных концентраций
в диапазоне от 104 до 107 копий/мл.
Проводят подготовку пробирок с ПЦР-смесью 1, содержащей смесь специфических
праймеров, позволяющих детектировать специфический фрагмент ДНК Aggregatibacter
actinomycetemcomitans, и нуклеотиды, раскапанные под воск.
Размораживают пробирку с ПЦР-смесью 3, содержащую TaqMan олигонуклеотидный
меченый зонд, который комплементарен специфическому фрагменту ДНК Aggregatibacter
actinomycetemcomitans, и тщательно перемешивают содержимое.
Праймеры для детекции Aggregatibacter actinomycetemcomitans и последовательность
TaqMan олигонуклеотидного меченого зонда были выбраны из промоторного региона
лейкотоксинового оперона (номер в GeneBank S68133) с использованием Primer Express
программного обеспечения:
5'-CATTCTCGGCGAAAAAACTA-3'-(forward-праймер),
5-CCCATAACCAAGCCACATAC-3'-(reverse-праймер)
определяют границы фрагмента промоторного региона лейкотоксинового оперона длиной
195 пар нуклеотидов Aggregatibacter actinomycetemcomitans (номер в GeneBank S68133);
TaqMan олигонуклеотидный меченый зонд 5'(FAM) TAATAATTACTCTCTACCCCAAGGATAACG (TAMRA)3' метится FAM в качестве флуорофора по 5' концу и TAMRA по
3' концу в качестве гасителя.
Готовят ПЦР-смесь из расчета 7 мкл ПЦР-смеси 2 (буфер и полимераза) и 3 мкл ПЦРсмеси 3 на одну реакцию. В пробирки с ПЦР-смесъю 1 на поверхность застывшего воска
раскапывают по 10 мкл приготовленной ПЦР-смеси, которая не должна проваливаться
под воск и смешиваться с ПЦР-смесью 1.
В подготовленные таким образом пробирки вносят ДНК по следующей схеме:
пробирка № 1 - 5 мкл ДНК, выделенной из биологического материала;
пробирка № 2 - 5 мкл стандарт 1 Aggregatibacter actinomycetemcomitans (конц. 104 копий/мл);
пробирка № 3 - 5 мкл стандарт 1 Aggregatibacter actinomycetemcomitans (конц. 104 копий/мл);
пробирка № 4 - 5 мкл стандарт 2 Aggregatibacter actinomycetemcomitans (конц. 105 копий/мл);
пробирка № 5 - 5 мкл стандарт 2 Aggregatibacter actinomycetemcomitans (конц. 105 копий/мл);
пробирка № 6 - 5 мкл стандарт 3 Aggregatibacter actinomycetemcomitans (конц. 106 копий/мл);
пробирка № 7 - 5 мкл стандарт 3 Aggregatibacter actinomycetemcomitans (конц. 106 копий/мл);
пробирка № 8 - 5 мкл стандарт 4 Aggregatibacter actinomycetemcomitans (конц. 107 копий/мл;
пробирка № 9 - 5 мкл стандарт 4 Aggregatibacter actinomycetemcomitans (конц. 107 копий/мл);
пробирка № 10 - 5 мкл отрицательного контрольного образца.
Помещают пробирки в ячейки ротора термоциклера "Rotor-Gene-3000" ("Corbette
research", Австралия). Задают следующую программу для амплификации ДНК Aggregatibacter actinomycetemcomitans:
1. Денатурация ДНК (расплетение двойной спирали) + 95 °С - 1 мин;
2. Отжиг (присоединение праймеров) + 95 °С - 10 с;
+ 60 °С - 30 с;
3. Элонгация (достраивание цепей ДНК) + 72 °С - 15 с.
Отжиг и элонгацию проводят в количестве 50 циклов.
Этап амплификации при проведении полимеразной цепной реакции в режиме реального времени (реал-тайм ПЦР) с использованием TaqMan меченого олигонуклеотидного
зонда основан на использовании 5'-экзонуклеазной активности полимеразы. В реакционную смесь добавляют зонд, меченный на 5'-конце флуоресцентным красителем, а на
3'-конце фосфатной группой и гасителем флуоресценции. Зонд комплементарен участку
амплифицируемой области. Гаситель поглощает испускаемое флуоресцентной меткой излучение, а фосфатная группа в 3'-положении блокирует полимеразу. При отжиге праймеров меченый зонд количественно связывается с комплементарным участком ДНК. Во
3
BY 14148 C1 2011.04.30
время стадии элонгации полимераза синтезирует комплементарную цепь ДНК и, дойдя до
участка, гибридизованного с зондом, начинает расщеплять зонд за счет 5'-экзонуклеазной
активности. В результате флуоресцентная метка отделяется от гасителя, и ее свечение
может детектироваться. Увеличение флуоресценции прямо пропорционально количеству
наработанного ПЦР-продукта. Кинетика накопления продуктов амплификации связана с
исходной концентрацией матрицы, что дает возможность точно оценить концентрацию
ДНК в биологическом материале.
Для определения концентрации Q ДНК Aggregatibacter actinomycetemcomitans в биологическом материале периодонтального кармана строится стандартная кривая в следующих координатах: X - концентрация стандартов, Y - пороговый цикл CT (пороговый цикл значение цикла, при котором пороговая линия и кривая данных флуоресценции каждого
амплифицированного продукта пересекаются). Значения CT предсказываются, исходя из
оценки входного уровня TaqMan меченого олигонуклеотидного зонда, то есть в стандартных условиях реакции, чем больше начальная концентрация образца, тем меньше CT (фигура).
Образец считается положительным, если в таблице результатов пороговых циклов по
каналу FAM для него определяется значение порогового цикла, не превышающее 33. Отсутствие исследуемой ДНК ведет к отсутствию пересечения кривой флуоресценции порогового значения.
Итоговое уравнение, характеризующие взаимосвязь порогового цикла флуоресценции
Ct и количества амплифицированной ДНК Aggregatibacter actinomycetemcomitans:
Q = 10(-0,357*Ct+11,723)/0,7
используется для расчета концентрации ДНК Aggregatibacter actinomycetemcomitans в 1 мл
биологическом материале периодонтального кармана, где 0,7 - коэффициент k, соответствующий эффективности выделения ДНК Aggregatibacter actinomycetemcomitans сорбционным методом,
При определении концентрации ДНК Aggregatibacter actinomycetemcomitans путем количественной полимеразной цепной реакции в режиме реального времени с использованием TaqMan олигонуклеотидного меченого зонда и смеси праймеров для проведения
амплификации ДНК Aggregatibacter actinomycetemcomitans у данного пациента значение
порогового цикла Ct = 18,55, поэтому Q = 10(-0,357*18,55t+11,723)/0,7 = 180116 копий на 1 мл
биологического материала периодонтального кармана.
Диагностически значимой считается концентрация Q ДНК Aggregatibacter actinomycetemcomitans более 105 копий на 1 мл биологического материала периодонтального
кармана. Если полученная концентрация ДНК Aggregatibacter actinomycetemcomitans
соответствует диагностически значимой, то ставят диагноз "ювенильный периодонтит".
У пациента В обнаружена диагностически значимая концентрация Aggregatibacter actinomycetemcomitans в биологическом материале периодонтального кармана, что позволяет поставить данному пациенту диагноз ""ювенильный периодонтит.
Проведена профессиональная гигиена, антисептическая обработка полости рта, назначена соответствующая этиологическому фактору антибактериальная терапия.
При повторном обследовании выявлена ДНК Aggregatibacter actinmomycetemcomitans
в концентрации 103 копий на 1 мл биологического материала периодонтального кармана,
что отражает эффективность проведенного лечения.
Таким образом, заявленный способ позволяет диагностировать ювенильный периодонтит, выбрать тактику лечения, а также оценить эффективность проведенной терапии за
счет установления преимущественной роли патогена Aggregatibacter actinomycetemcomitans в развитии ювенильного периодонтита.
4
BY 14148 C1 2011.04.30
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
5
Документ
Категория
Без категории
Просмотров
1
Размер файла
119 Кб
Теги
by14148, патент
1/--страниц
Пожаловаться на содержимое документа