close

Вход

Забыли?

вход по аккаунту

?

Патент BY14153

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2011.04.30
(12)
(51) МПК (2009)
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
G 01N 33/48
СПОСОБ ДИАГНОСТИКИ
ОСТРОГО ЯЗВЕННО-НЕКРОТИЧЕСКОГО ГИНГИВИТА
(21) Номер заявки: a 20081378
(22) 2008.10.31
(43) 2010.06.30
(71) Заявитель: Государственное учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(72) Авторы: Юдина Наталья Александровна; Костюк Светлана Андреевна; Люговская Анна Викторовна;
Глинкина Татьяна Владимировна;
Полуян Ольга Сергеевна; Руденкова Татьяна Владимировна (BY)
BY 14153 C1 2011.04.30
BY (11) 14153
(13) C1
(19)
(73) Патентообладатель: Государственное
учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(56) ASAI Y. et al. J. Clin.Microbiol. - 2002. V. 40. - No. 9. - P. 3334-3340.
RU 2289305 С2, 2006.
SU 1751678 А1, 1992.
SU 1410951 А1, 1988.
SU 1689854 А1, 1991.
RU 2329509 С2, 2008.
FOSCHI F. et al. J. Dent Res. - 2006. V. 85. - No. 8. - P. 761-765.
ASHIMOTO A. et al. Oral Microbiol
Immunol. - 1996. - V.11. - No. 4. P. 266-273.
(57)
Способ диагностики острого язвенно-некротического гингивита по выявлению Treponema denticola, отличающийся тем, что выделяют из зубного налета сорбционным методом ДНК микроорганизмов и проводят полимеразную цепную реакцию в режиме
реального времени с использованием праймеров для детекции Treponema denticola 5'TAATACCGAATGTGCTCATTTACAT-3' и 5'-CTGCCATATCTCTATGTCATTGCTCTT-3'
и TaqMan олигонуклеотидного меченого зонда 5'(FAM)-GACGGGGGCCCGCACAAGCGG(TAMRA)3' на этапе амплификации ДНК, причем проводят денатурацию ДНК при температуре +94 °С в течение 2 минут, отжиг в количестве 30 циклов сначала при температуре +94 °С в течение 45 секунд, а затем при температуре +62 °С в течение 60 секунд и
элонгацию в количестве 30 циклов при температуре +72 °С в течение 60 секунд, а концентрацию ДНК Q Treponema denticola рассчитывают по формуле:
×
Q = 10(-0,333 Ct + 12,843)/0,7,
где Ct - значение цикла амплификации ДНК при флуоресценции, превышающей пороговый уровень,
и при получении значения Q более 105 копий на 1 мл зубного налета диагностируют
острый язвенно-некротический гингивит.
Изобретение относится к медицине, а именно к стоматологии, и может использоваться
для диагностики острого язвенно-некротического гингивита с целью установления этиологического фактора заболевания.
BY 14153 C1 2011.04.30
Ведущая роль в развитии острого язвенно-некротического гингивита принадлежит
микробному фактору. Среди бактериальной флоры особое значение в этиопатогенезе заболевания играет Treponema denticola. Методы клинической диагностики не позволяют
выявить этиологически значимый возбудитель, что не дает объективную оценку патологическому процессу в тканях периодонта, снижает точность диагностики и эффективность
терапии. В связи с этим, наряду с использованием клинических методов исследования,
необходимо проведение специальных методов, позволяющих выявить этиологически значимый возбудитель и определить его количественную характеристику.
Задачей изобретения является выявление Treponema denticola в зубном налете, что поможет повысить точность диагностики, провести адекватные лечебные мероприятия и
оценить эффективность проведенного лечения.
Поставленная задача решается следующим образом. Предложен способ диагностики
острого язвенно-некротического гингивита по выявлению Treponema denticola, при котором выделяют из зубного налета сорбционным методом ДНК микроорганизмов и проводят полимеразную цепную реакцию в режиме реального времени с использованием
праймеров для детекции Treponema denticola 5'-TAATACCGAATGTGCTCATTTACAT-3'
и 5'-CTGCCATATCTCTATGTCATTGCTCTT-3' и TaqMan олигонуклеотидного меченого
зонда 5'(FAM)-GACGGGGGCCCGCACAAGCGG-(TAMRA)3' на этапе амплификации
ДНК, причем проводят денатурацию ДНК при температуре +94 °С в течение 2 минут, отжиг в количестве 30 циклов сначала при температуре +94 °С в течение 45 секунд, а затем
при температуре +62 °С в течение 60 секунд и элонгацию в количестве 30 циклов при
температуре +72 °С в течение 60 секунд, а концентрацию ДНК Q Treponema denticola рассчитывают по формуле:
Q = 10(-0,333 × Ct + 12,843)/0,7,
где Ct - значение цикла амплификации ДНК при флуоресценции, превышающей пороговый уровень,
и при получении значения Q более 105 копий на 1 мл зубного налета диагностируют
острый язвенно-некротический гингивит.
На фиг. 1 представлена стандартная кривая, определяющая взаимосвязь концентрации
ДНК Treponema denticola и цикла CT, при котором пороговая линия и кривая данных флуоресценции каждого амплифицированного продукта пересекаются.
Пример.
Пациент Н., 21 год. Жалобы на болезненность десны и неприятный запах изо рта, повышение температуры тела до 37,1 °С. При осмотре десна гиперемирована, кровоточит, вершины межзубных сосочков некротизированы, покрыты серым, плохо снимающимся налетом.
При пальпации десна резко болезненна. Индекс гигиены OHI S = 2,6 (гигиена плохая).
Для выявления у пациента Н. ДНК Treponema denticola в качестве биологического материала используют зубной налет, так как здесь данный микроорганизм проявляет свою
наибольшую активность. Забор биологического материала осуществляют из десневой борозды в различных секстантах. Стерильный бумажный штифт размером № 35 вводят в
десневую борозду и оставляют на 10 секунд, забранный материал погружают в герметично закрытый стерильный контейнер для транспортировки с транспортной средой.
С выделенной сорбционным методом из зубного налета ДНК Treponema denticola проводят полимеразную цепную реакцию в режиме реального времени, при этом осуществляют амплификацию ДНК Treponema denticola общим объемом 100 мкл и ДНК Treponema
denticola стандартов, которые необходимы для определения концентрации ДНК при проведении ПЦР в режиме реального времени. Используемыми стандартами для определения
концентрации Treponema denticola служат 10-кратно разведенные серии генома Treponema
denticola известных концентраций в диапазоне от 104 до 107 копий/мл.
Проводят подготовку пробирок с ПЦР-смесью-1, содержащей смесь специфических
праймеров, позволяющих детектировать специфический фрагмент ДНК Treponema denticola, и нуклеотиды, раскапанные под воск.
2
BY 14153 C1 2011.04.30
Размораживают пробирку с ПЦР-смесью-3, содержащую TaqMan олигонуклеотидный
меченый зонд, который комплементарен специфическому фрагменту ДНК Treponema
denticola, и тщательно перемешивают содержимое.
Праймеры для детекции Treponema denticola и последовательность TaqMan олигонуклеотидного меченого зонда были выбраны из гена 16S pРНК (номер в GeneBank D85438) с
использованием Primer Express программного обеспечения:
5'-TAATACCGAATGTGCTCATTTACAT-3' - (forward-праймер),
5'-CTGCCATATCTCTATGTCATTGCTCTT-3'-(reverse-праймер) определяют границы
фрагмента гена 16S pРНК длиной 860 пар нуклеотидов Treponema denticola (номер в
GeneBank D85438);
TaqMan олигонуклеотидный меченый зонд 5'(FАМ)GACGGGGGCCCGCACAAGCGG
(PAMRA)3' метится FAM в качестве флуорофора по 5' концу и TAMRA по 3' концу в качестве гасителя.
Готовят ПЦР-смесь из расчета 7 мкл ПЦР-смеси-2 (буфер и полимераза) и 3 мкл ПЦРсмеси-3 на одну реакцию. В пробирки с ПЦР-смесью-1 на поверхность застывшего воска
раскапывают по 10 мкл приготовленной ПЦР-смеси, которая не должна проваливаться
под воск и смешиваться с ПЦР-смесью-1.
В подготовленные таким образом пробирки вносят ДНК по следующей схеме:
пробирка № 1-5 мкл ДНК, выделенной из биологического материала,
пробирка № 2-5 мкл Стандарт 1 Treponema denticola (конц. 104 копий/мл),
пробирка № 3-5 мкл Стандарт 1 Treponema denticola (конц. 104 копий/мл),
пробирка № 4-5 мкл Стандарт 2 Treponema denticola (конц. 105 копий/мл),
пробирка № 5-5 мкл Стандарт 2 Treponema denticola (конц. 105 копий/мл),
пробирка № 6-5 мкл Стандарт 3 Treponema denticola (конц. 106 копий/мл),
пробирка № 7-5 мкл Стандарт 3 Treponema denticola (конц. 106 копий/мл),
пробирка № 8-5 мкл Стандарт 4 Treponema denticola (конц. 107 копий/мл),
пробирка № 9-5 мкл Стандарт 4 Treponema denticola (конц. 107 копий/мл),
пробирка № 10-5 мкл отрицательного контрольного образца.
Помещают пробирки в ячейки ротора термоциклера "Rotor-Gene-3000" ("Corbette research", Австралия). Задают следующую программу для амплификации ДНК Treponema
denticola:
1. Денатурация ДНК (расплетение двойной спирали)
+94 °С…2 мин
2. Отжиг (присоединение праймеров)
+94 °С…45 сек
+62 °С…60сек
3. Элонгация (достраивание цепей ДНК)
+72 °С…60 сек
Отжиг и элонгацию проводят в количестве 30 циклов.
Этап амплификации при проведении полимеразной цепной реакции в режиме реального времени (реал-тайм ПЦР) с использованием TaqMan меченого олигонуклеотидного
зонда основан на использовании 5'-экзонуклеазной активности полимеразы. В реакционную смесь добавляют зонд, меченный на 5'-конце флуоресцентным красителем, а на 3'конце - фосфатной группой и гасителем флуоресценции. Зонд комплементарен участку
амплифицируемой области. Гаситель поглощает испускаемое флуоресцентной меткой излучение, а фосфатная группа в 3'-положении блокирует полимеразу. При отжиге праймеров меченый зонд количественно связывается с комплементарным участком ДНК. Во
время стадии элонгации полимераза синтезирует комплементарную цепь ДНК и, дойдя до
участка, гибридизованного с зондом, начинает расщеплять зонд за счет 5'-экзонуклеазной
активности. В результате флуоресцентная метка отделяется от гасителя, и ее свечение
может детектироваться. Увеличение флуоресценции прямо пропорционально количеству
наработанного ПЦР-продукта. Кинетика накопления продуктов амплификации связана с
исходной концентрацией матрицы, что дает возможность точно оценить концентрацию
ДНК в биологическом материале.
3
BY 14153 C1 2011.04.30
Для определения концентрации Q ДНК Treponema denticola в зубном налете строится
стандартная кривая в следующих координатах: X - концентрация стандартов, Y - пороговый цикл CT (пороговый цикл - значение цикла, при котором пороговая линия и кривая
данных флуоресценции каждого амплифицированного продукта пересекаются). Значения
CT предсказываются, исходя из оценки входного уровня TaqMan меченого олигонуклеотидного зонда, то есть в стандартных условиях реакции, чем больше начальная концентрация образца, тем меньше CT (фиг. 1).
Образец считается положительным, если в таблице результатов пороговых циклов по
каналу FAM для него определяется значение порогового цикла, не превышающее 33. Отсутствие исследуемой ДНК ведет к отсутствию пересечения кривой флуоресценции порогового значения.
Итоговые уравнения, характеризующие взаимосвязь порогового цикла флуоресценции
Ct и количества амплифицированной ДНК Treponema denticola
Q = 10(-0,333 × Ct + 12,843)/0,7
используется для расчета концентрации ДНК Treponema denticola в 1 мл зубного налета, где 0,7 - коэффициент k, соответствующий эффективности выделения ДНК Treponema
denticola сорбционным методом.
При определении концентрации ДНК Treponema denticola путем количественной полимеразной цепной реакции в режиме реального времени с использованием TaqMan олигонуклеотидного меченого зонда и смеси праймеров для проведения амплификации ДНК
Treponema denticola у данного пациента значение порогового цикла Ct = 19,00, поэтому
Q = 10∧(-0,333 × 19,00 + 12,843)/0,7 = 4687076 копий на 1 мл биологического материала зубного налета.
Диагностически значимой считается концентрация Q ДНК Treponema denticola более
5
10 копий на 1 мл зубного налета. Если полученная концентрация ДНК Treponema denticola соответствует диагностически значимой, то ставят диагноз острый язвеннонекротический гингивит.
У пациента Н. обнаружена диагностически значимая концентрация Treponema denticola в зубном налете, что позволяет поставить данному пациенту диагноз острый язвеннонекротический гингивит.
Проведено комплексное этиопатогенетическое лечение, которое включало назначение
антибактериального препарата, антисептическую обработку, проведение профессиональной гигиены.
При повторном обследовании выявлена ДНК Treponema denticola в концентрации
103 копий на 1 мл зубного налета, что отражает эффективность проведенного лечения.
Таким образом, заявленный способ позволяет диагностировать острый язвеннонекротический гингивит, выбрать тактику лечения, а также оценить эффективность проведенной терапии за счет установления преимущественной роли патогена Treponema
denticola в развитии острого язвенно-некротического гингивита.
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
4
Документ
Категория
Без категории
Просмотров
0
Размер файла
123 Кб
Теги
патент, by14153
1/--страниц
Пожаловаться на содержимое документа