close

Вход

Забыли?

вход по аккаунту

?

Патент BY15868

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2012.06.30
(12)
(51) МПК
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
G 01N 33/48 (2006.01)
C 12Q 1/68 (2006.01)
C 12R 1/90 (2006.01)
СПОСОБ ОПРЕДЕЛЕНИЯ КОНЦЕНТРАЦИИ ДНК TRICHOMONAS
VAGINALIS В БИОЛОГИЧЕСКОМ МАТЕРИАЛЕ
(21) Номер заявки: a 20100471
(22) 2010.03.24
(43) 2011.10.30
(71) Заявитель: Государственное учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(72) Авторы: Костюк Светлана Андреевна; Кулага Ольга Константиновна;
Бадыгина Наталья Александровна;
Полуян Ольга Сергеевна; Руденкова Татьяна Владимировна (BY)
BY 15868 C1 2012.06.30
BY (11) 15868
(13) C1
(19)
(73) Патентообладатель: Государственное
учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(56) Клиника, диагностика и лечение хронического урогенитального трихомониаза у женщин. Методические рекомендации. - Минск: БелМАПО, 2008. С. 23-25.
RU 2348695 C2, 2009.
WO 2005/031005 А2.
КОСТЮК С.А. и др. Весцi Нацыянальнай акадэмii навук Беларусi. Серыя
медыцынскiх навук. - 2006. - № 5. С. 74-76.
КУЛАГА О.К. и др. Медицинские новости. - 2008. - № 5. - С. 76-78.
(57)
Способ определения концентрации ДНК Trichomonas vaginalis в биологическом материале, заключающийся в том, что выделяют ДНК из биологического материала, проводят
с ней полимеразную цепную реакцию в режиме реального времени с использованием
праймеров 5'-GGTGGTGATGGCACAATCGG-3' и 5'-GCACTTCAAGAATGAGC-3'
и
TaqMan
олигонуклеотидной
флуоресцентно
меченой
пробы
5'-(FAM)GTTGACATGGACGGTTAACAGCCGCTTGCTCATAAATAGAGTTGG(TAMRA)-3',
определяют значение цикла амплификации CT, при котором флуоресценция превысит
пороговый уровень, и рассчитывают концентрацию ДНК Trichomonas vaginalis Q1, выраженную в количестве копий на 1 мл биологического материала, по формуле:
Q1 = 10(-0,442×CT + 9,552).
Изобретение относится к области медицины, к разделу клинической лабораторной диагностики.
Известен способ определения концентрации Trichomonas vaginalis в исследуемом клиническом материале на основании культивирования Trichomonas vaginalis на питательных
средах [1]. Аналогов, близких к заявляемому изобретению, прототипа не обнаружено.
Недостатками данного способа являются жесткие требования к транспортировке биологического материала, необходимость длительного периода культивирования.
BY 15868 C1 2012.06.30
Применение метода ПЦР в режиме реального времени позволяет проводить быстрое
определение концентрации ДНК Trichomonas vaginalis с высокими показателями чувствительности и специфичности.
Задачей заявленного способа является определение в короткие сроки концентрации
ДНК возбудителя в биологическом материале.
Поставленная задача решается следующим образом.
Предложен способ определения концентрации ДНК Trichomonas vaginalis в биологическом материале, заключающийся в том, что выделяют ДНК из биологического
материала, проводят с ней полимеразную цепную реакцию в режиме реального времени
с
использованием
праймеров
5'-GGTGGTGATGGCACAATCGG-3',
5'-GCACTTCAAGAATGAGC-3' и TaqMan олигонуклеотидной меченой пробы
5'-(FAM)GTTGACATGGACGGTTAACAGCCGCTTGCTCATAAATAGAGTTGG(TAMRA)-3',
определяют значение цикла амплификации СТ, при котором флуоресценция превысит пороговый уровень, и рассчитывают концентрацию ДНК Trichomonas vaginalis Q1, выраженную в количестве копий на 1 мл биологического материла, по формуле:
Q1 = 10(-0,442xCT + 9,552).
Пример.
Необходимо определить концентрацию ДНК Trichomonas vaginalis в 1 мл биологического материала пациента А.
На первом этапе из 100 мкл биологического материала пациента выделяют ДНК сорбционным методом. При этом к 100 мкл физиологического раствора, содержащего клинический материал в пробирке объемом 1,5 мл (типа Eppendorf), добавляют 300 мкл
раствора I (лизирующего, 6 М раствор гуанидина изотиоцианата) и 10 мкл суспензии сорбента (SiO2). Пробы инкубируют в течение 10 мин при комнатной температуре, 1-2 раза
перемешивая на микроцентрифуге "Вортекс CV-1500" ("Хеликон", Россия) при
1500 об/мин. Пробы центрифугируют в течение 15 с на центрифуге "Циклотепм-201"
("СТМ", Россия) при 12 тыс. оборотов в минуту, супернатант удаляют. К осадку добавляют 100 мкл раствора II (промывочного, 96 % этанол, содержащий 100 мМ ацетат натрия
(pH 4,8)), встряхивают и центрифугируют. Процедуру отмывки повторяют 2 раза с использованием раствора III (промывочного, 70 % этанол). Пробирки помещают в твердотельный микротермостат (модель 205, "СТМ", Россия) и подсушивают пробы 5 мин при
температуре 50 °С, оставляя пробирки открытыми. В пробирки с осадком добавляют
50 мкл TE буфера (на 1 л буфера: 0,04 М Трис-ацетат (242 г Трис, 57,1 мл ледяной уксусной кислоты), 0,002 М ЭДТА (100 мл 0,5 М ЭДТА pH 8,0) и инкубируют в течение 5 мин
при 50 °С. Пробирки центрифугируют в течение 15 с при 12 тыс. оборотов. Водную фазу
используют в качестве исследуемого образца ДНК для постановки реакции амплификации.
На втором этапе осуществляют амплификацию ДНК, выделенной из биологического
материала, и образцов калибратора ДНК Trichomonas vaginalis, которые необходимы для
определения концентрации ДНК Trichomonas vaginalis при проведении ПЦР в режиме реального времени. Используемые образцы калибратора ДНК Trichomonas vaginalis содержат известные концентрации ДНК Trichomonas vaginalis в диапазоне от 102 до
105 копий/мл.
Проводят подготовку пробирок с ПЦР-смесью-1, в которых под слоем воска содержатся смесь специфических праймеров, позволяющих детектировать специфический
фрагмент ДНК Trichomonas vaginalis, и нуклеотиды.
Размораживают пробирку с ПЦР-смесью-3, которая содержит TaqMan олигонуклеотидные меченые пробы, комплементарные специфическому фрагменту ДНК Trichomonas
vaginalis, и тщательно перемешивают содержимое.
Праймеры для детекции Trichomonas vaginalis и последовательности TaqMan олигонуклеотидных меченых проб были выбраны из однокопийного гена PFOD (Pyruvate: ferre2
BY 15868 C1 2012.06.30
doxin oxidoreductase) Trichomonas vaginalis с использованием Vector NTI программного
обеспечения.
5'-GGTGGTGATGGCACAATCGG-3'-, 5'-GCACTTCAAGAATGAGC-3', TaqMan
олигонуклеотидная меченая проба метится FAM в качестве флуорофора по 5' - концу
и
в
качестве
гасителя
по
3'
концу
TAMRA:
5'-(FAM)GTTGACATGGACGGTTAACAGCCGCTTGCTCATAAATAGAGTTGG(TAMRA)-3'.
Готовят верхнюю ПЦР-смесь из расчета 7 мкл ПЦР-смеси-2 (буфер и полимераза) и
3 мкл ПЦР-смеси-3 на одну реакцию.
В пробирки с ПЦР-смесью-1 на поверхность застывшего воска раскапывают по 10 мкл
верхней ПЦР-смеси, которая не должна проваливаться под воск и смешиваться с ПЦРсмесью-1.
В подготовленные таким образом пробирки вносят образцы ДНК по следующей схеме:
пробирка № 1 - 10 мкл ДНК, выделенной из биологического материла пациента А;
пробирка № 2 - 10 мкл калибратора ДНК Trichomonas vaginalis с концентрацией
102 копий/мл;
пробирка № 3 - 10 мкл калибратора ДНК Trichomonas vaginalis с концентрацией
2
10 копий/мл;
пробирка № 4 - 10 мкл калибратора ДНК Trichomonas vaginalis с концентрацией
3
10 копий/мл;
пробирка № 5 - 10 мкл калибратора ДНК Trichomonas vaginalis с концентрацией
3
10 копий/мл;
пробирка № 6 - 10 мкл калибратора ДНК Trichomonas vaginalis с концентрацией
4
10 копий/мл;
пробирка № 7 - 10 мкл калибратора ДНК Trichomonas vaginalis с концентрацией
104 копий/мл;
пробирка № 8 - 10 мкл калибратора ДНК Trichomonas vaginalis с концентрацией
105 копий/мл;
пробирка № 9 - 10 мкл калибратора ДНК Trichomonas vaginalis с концентрацией
105 копий/мл;
пробирка № 10 - 10 мкл отрицательного контрольного образца.
Помещают пробирки в ячейки ротора термоциклера "Rotor-Gene-6000" ("Corbette research", Австралия). Задают следующую программу для одновременной амплификации
ДНК Trichomonas vaginalis: 95 °С - 10 мин; 50 циклов: 95 °С - 10 с, 60 °С - 35 с, 72 °С - 15 с.
Этап амплификации при проведении полимеразной цепной реакции в режиме реального времени (реал-тайм ПЦР) с использованием TaqMan олигонуклеотидных меченых
проб основан на использовании 5'-экзонуклеазной активности полимеразы. В реакционную смесь добавляют ДНК-пробы, меченные на 5'-конце флуоресцентным красителем, а
на 3'-конце - фосфатной группой и гасителем флуоресценции. Пробы комплементарны
участку амплифицируемой области. Гаситель поглощает испускаемое флуоресцентной
меткой излучение, а фосфатная группа в 3'-положении блокирует полимеразу. При отжиге
праймеров олигонуклеотидная меченая проба количественно связывается с комплементарным участком ДНК. Во время стадии элонгации полимераза синтезирует комплементарную цепь ДНК и, дойдя до участка, гибридизованного с пробой, начинает расщеплять
пробу за счет 5'-экзонуклеазной активности. В результате флуоресцентная метка отделяется от гасителя, и ее свечение может детектироваться. Увеличение флуоресценции прямо
пропорционально количеству наработанного ПЦР-продукта. Кинетика накопления продуктов амплификации связана с исходной концентрацией матрицы, что дает возможность
точно оценить концентрацию ДНК в биологическом материале. Цикл (Ct), при котором
флуоресценция превышает пороговый уровень, задаваемый автоматически, используют
для расчета концентрации ДНК Trichomonas vaginalis.
3
BY 15868 C1 2012.06.30
Итоговое уравнение, характеризующее взаимосвязь порогового цикла флуоресценции
(CT) и количества амплифицированной ДНК Trichomonas vaginalis, а именно
Q1 = 10(-0,442xCT + 9,552),
используется для расчета концентраций ДНК Trichomonas vaginalis в 1 мл биологического
материла.
При определении концентрации ДНК Trichomonas vaginalis методом количественной
полимеразной цепной реакции в режиме реального времени с использованием смеси
TaqMan олигонуклеотидных меченых проб и смеси праймеров для проведения у данного
пациента значение порогового цикла CT = 18,85, поэтому
Q1 = 10(-0,442x18,85 + 9,552) = 16,61.
В биологическом материале данного пациента обнаружена концентрация ДНК Trichomonas vaginalis, равная 16,61 копий/мл, что позволяет судить об активности и выраженности инфекционного процесса и необходимости назначения соответствующего протокола
лечения.
Таким образом, заявляемый способ позволяет получить следующие преимущества:
возможность определения концентрации Trichomonas vaginalis в биологическом материале в течение 1 дня, мониторинг ПЦР-активности в реальном времени, исключение риска
контаминации, сокращение трудоемкости исследования.
Источники информации:
1. Клиника, диагностика и лечение хронического урогенитального трихомониаза у
женщин. Методические рекомендации. - Минск: БелМАПО, 2008. - С. 23-25.
2. RU 2348695 C2, 2009.
3. WO 2005/031005 A2.
4. КОСТЮК С.А. и др. Весцi Нацыянальнай акадэмii навук Беларусi: Серыя медыцынскiх навук. - 2006. - № 5. - С. 74-76.
5. КУЛАГА О.К. и др. Медицинские новости. - 2008. - № 5. - С. 76-78.
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
4
Документ
Категория
Без категории
Просмотров
1
Размер файла
77 Кб
Теги
патент, by15868
1/--страниц
Пожаловаться на содержимое документа