close

Вход

Забыли?

вход по аккаунту

?

Патент BY16353

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2012.10.30
(12)
(51) МПК
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
C 12Q 1/68
(2006.01)
СПОСОБ СОЗДАНИЯ КАЛИБРАТОРА ДНК TRICHOMONAS
VAGINALIS
(21) Номер заявки: a 20100118
(22) 2010.01.29
(43) 2011.08.30
(71) Заявитель: Государственное учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(72) Авторы: Костюк Светлана Андреевна; Бадыгина Наталья Александровна; Полуян Ольга Сергеевна;
Руденкова Татьяна Владимировна
(BY)
BY 16353 C1 2012.10.30
BY (11) 16353
(13) C1
(19)
(73) Патентообладатель: Государственное
учреждение образования "Белорусская
медицинская академия последипломного образования" (BY)
(56) BY 11635 C1, 2009.
BY 10314 C1, 2008.
RU 2358013 C2, 2009.
RU 2350650 C2, 2009.
JP 11089597 A, 1999.
КОСТЮК С.А. и др. Весцi Нацыянальнай акадэмii навук Беларусi. Серыя
медыцынскiх навук. - 2006. - № 5. - С.
74-76.
(57)
Способ создания калибратора ДНК Trichomonas vaginalis, заключающийся в том, что
выделяют ДНК человека из лейкоцитов периферической крови и определяют ее концентрацию по концентрации однокопийного гена NAGK, выделяют ДНК Trichomonas vaginalis и определяют ее концентрацию по концентрации однокопийного гена
пируват:ферредоксин-оксидоредуктазы, с учетом определенных концентраций готовят
растворы в деионизированной воде ДНК человека и ДНК Trichomonas vaginalis с концентрациями 105, 104, 103 и 102 копий/мл и смешивают растворы ДНК человека и ДНК
Trichomonas vaginalis, взятые в одинаковых концентрациях, в объемном соотношении 1:1.
Изобретение относится к области медицины, а именно к способам создания калибратора ДНК Trichomonas vaginalis для построения калибровочных кривых, относительно которых проводят определение концентрации ДНК искомого возбудителя в биологическом
материале методом полимеразной цепной реакции (ПЦР) в режиме реального времени.
Разработанный способ создания калибратора ДНК Trichomonas vaginalis для проведения ПЦР в режиме реального времени позволяет получить калибратор с известной концентрацией ДНК Trichomonas vaginalis, который по своим молекулярно-биологическим
свойствам и составу максимально приближен к биологическому материалу, полученному
от пациента.
Аналогов прототипа не обнаружено.
Задачей заявленного способа является получение калибратора ДНК Trichomonas
vaginalis с известной концентрацией ДНК Trichomonas vaginalis, содержащего ДНК человека, для построения калибровочной кривой при определении относительной концентрации ДНК Trichomonas vaginalis в биологическом материале методом ПЦР в режиме
BY 16353 C1 2012.10.30
реального времени с показателями корреляции (R2) между CT и log 10 концентрации ДНК
в мл ≥ 0,9, эффективностью реакции (E) ≥ 0,89.
Поставленная задача достигается следующим образом.
Предложен способ создания калибратора ДНК Trichomonas vaginalis, заключающийся
в том, что выделяют ДНК человека из лейкоцитов периферической крови и определяют ее
концентрацию по концентрации однокопийного гена NAGK, выделяют ДНК Trichomonas
vaginalis и определяют ее концентрацию по концентрации однокопийного гена пируват:ферредоксин-оксидоредуктазы, с учетом определенных концентраций готовят растворы в деионизированной воде ДНК человека и ДНК Trichomonas vaginalis с
концентрациями 105, 104, 103, 102 и смешивают растворы ДНК человека и ДНК Trichomonas vaginalis, взятые в одинаковых концентрациях, в объемном соотношении 1:1.
Предложенный способ поясняется графическим материалом.
На фигуре представлено CT - значение цикла, при котором пороговая линия и кривая
данных флуоресценции каждого амплификационного продукта пересекаются, где 1 - пороговая линия, 2 - кривая данных флуоресценции каждого амплификационного продукта.
Для приготовления калибратора ДНК Trichomonas vaginalis из питательной среды
СВТ-ж (НИИЭМ им. Пастера, РФ) ДНК Trichomonas vaginalis выделяли с использованием
сорбентного метода. Расчет концентрации ДНК Trichomonas vaginalis проводили по формулам 1 и 2:
(1)
C = A260 × k,
где C - концентрация ДНК в растворе (мкг/мл);
A260 - значение спектрофотометрии раствора ДНК при A260
k - коэффициент пересчета для двухцепочечной молекулы ДНК;
(2)
C× N
Ck =
,
GS × M W
где Ck - концентрация однокопийного гена;
C - концентрация ДНК возбудителя в растворе (мкг/мл), рассчитанная по формуле 1;
GS - размер генома;
MW - средняя масса нуклеотида (321,44 × 106 мкг);
N - число Авогадро (6,02E + 23).
Затем разводили полученный раствор ДНК Trichomonas vaginalis деионизированной
водой до концентраций 105, 104, 103, 102 копий/мл.
Геномную ДНК человека выделяли из лейкоцитов периферической крови с использованием набора GenEluteTM Mammalian Genomic DNA Miniprep Kit (Sigma, США) в соответствии с инструкцией производителя. Расчет концентрации ДНК человека проводили по
формулам 1 и 2, а затем разводили полученный раствор ДНК человека деионизированной
водой до концентраций 105, 104, 103, 102 копий/мл.
Конечным этапом при создании калибратора ДНК Trichomonas vaginalis было смешивание в соотношении 1:1 образцов с соответствующими концентрациями однокопийного
гена PFOD Trichomonas vaginalis и однокопийного гена человека NAGK, таким образом,
получили калибратор, состоящий из четырех образцов, содержащих: 1) 105 копий/мл гена
PFOD Trichomonas vaginalis и 105 копий/мл гена человека NAGK; 2) 104 копий/мл гена
PFOD Trichomonas vaginalis и 104 копий/мл гена человека NAGK; 3) 103 копий/мл гена
PFOD Trichomonas vaginalis и 103 копий/мл гена человека NAGK; 4) 102 копий/мл гена
PFOD Trichomonas vaginalis и 102 копий/мл гена человека NAGK.
Пример апробации калибратора ДНК Trichomonas vaginalis.
Методом мультиплексной ПЦР в режиме реального времени проведена амплификация
в дублях четырех образцов калибратора, содержащих: 1) 105 копий/мл гена PFOD
Trichomonas vaginalis и 105 копий/мл гена человека NAGK; 2) 104 копий/мл гена PFOD
Trichomonas vaginalis и 104 копий/мл гена человека NAGK; 3) 103 копий/мл гена PFOD
2
BY 16353 C1 2012.10.30
Trichomonas vaginalis и 103 копий/мл гена человека NAGK; 4) 102 копий/мл гена PFOD
Trichomonas vaginalis и 102 копий/мл гена человека NAGK.
Для амплификации гена PFOD Trichomonas vaginalis и гена человека NAGK в пробирки типа Eppendorf объемом 0,2 мл добавляли 15 мкл амплификационной смеси, состоящей
из 6,85 мкл деионизованной воды, 2,5 мкл реакционной смеси (100 мМ Tris-HCl (pH 8,4),
50 мМ в KCl), 4 мкл 25 мМ MgCl2, 0,2 мкл 25 мМ dNTP и 1,25 смеси, содержащей 20кратную концентрацию праймеров и TagMan-проб (конечная концентрация - 300 нМ
праймеров и 200 нМ зондов) и 0,2 мкл Taq-полимеразы. Добавляли 25 мкл минерального
масла. Под слой масла вносили по 10 мкл анализируемого образца, содержащего определенную концентрацию однокопийного гена PFOD Trichomonas vaginalis и однокопийного гена человека NAGK, а в пробирку отрицательного контроля - 10 мкл деионизированной воды.
Амплификацию проводили с использованием термоциклера "Rotor-Gene-6000" ("Corbette research", Австралия) по следующей программе: 95 °С - 10 мин; 50 циклов: 95 °С - 10 с,
60 °С - 35 с, 72 °С - 15 с.
Для амплификации гена PFOD Trichomonas vaginalis использовали следующие последовательности праймеров и зондов: 5'-GGTGGTGATGGCACAATCGG-3'(PFOD-праймер1), 5'-GCACTTCAAGAATGAGC-3'(PFOD-праймер-2), 5'(FAM)GTTGACATGGACGGTTAACAGCCGCTTGCTCATAAATAGAGTTGG(TAMRA)3' (TaqMan-зонд). Для амплификации гена человека NAGK использовали следующие последовательности праймеров и
зондов: 5'-TGGGCAGACACATCGTAGCA-3'(NAGK-праймер-1), 5'-CACCTTCACTCCCACCTCAAC-3' (NAGK-праймер-2), 5'(VIC)TGTTGCCCGAGATTGACCCGGT(TAMRA)3'(TaqMan-зонд).
Каждый образец был проамплифицирован в дублях вместе с двумя NTC (No Template
Control). NTC реактив состоял из сложной ДНК амплификационной смеси, где мишень
ДНК-стандарта была заменена водой.
После амплификации ДНК Trichomonas vaginalis и ДНК человека кинетика амплификации NTC-проб не детектировалась.
Средний уровень корреляции (R2) между CT и log 10 концентрации гена PFOD
Trichomonas vaginalis (копий/мл) и между CT и log 10 концентрации гена человека NAGK
(мкг/мл), содержащихся в созданном калибраторе ДНК Trichomonas vaginalis, составил
0,99 и 0,98 соответственно. Средняя эффективность реакции составила 0,91 для ДНК
Trichomonas vaginalis и 0,89 для гена человека NAGK.
Таким образом, заявленный способ позволяет получить следующие преимущества: создать калибратор с известной концентрацией ДНК Trichomonas vaginalis, по своим молекулярно-биологическим свойствам и составу максимально приближенный к
биологическому материалу, полученному от пациента, что позволит при его использовании построить калибровочную кривую с показателями корреляции (R2) между CT и log 10
концентрации ДНК в мл ≥ 0,9 и эффективностью реакции (E) ≥ 0,89 и получить достоверную
информацию об относительной концентрации ДНК возбудителя в биологическом материале.
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
3
Документ
Категория
Без категории
Просмотров
0
Размер файла
130 Кб
Теги
by16353, патент
1/--страниц
Пожаловаться на содержимое документа