close

Вход

Забыли?

вход по аккаунту

?

Патент BY17331

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2013.08.30
(12)
(51) МПК
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
A 01K 67/02
C 12Q 1/68
(2006.01)
(2006.01)
СПОСОБ ОПРЕДЕЛЕНИЯ СТРЕССОВОЙ ЧУВСТВИТЕЛЬНОСТИ
СВИНЕЙ
(21) Номер заявки: a 20091910
(22) 2009.12.30
(43) 2011.08.30
(71) Заявитель: Государственное научное
учреждение "Институт биофизики и
клеточной инженерии Национальной академии наук Беларуси" (BY)
(72) Авторы: Баранова Людмила Александровна; Емельянова Валентина
Павловна; Минов Александр Михайлович; Волотовский Игорь Дмитриевич (BY)
BY 17331 C1 2013.08.30
BY (11) 17331
(13) C1
(19)
(73) Патентообладатель: Государственное
научное учреждение "Институт биофизики и клеточной инженерии Национальной академии наук Беларуси"
(BY)
(56) ROJAS J.E. et al. Rev. Col. Anest,
2008. - V. 36. - Р.11-18.
UA 85791 С2, 2009.
RU 2181000 С2, 2002.
KAMIŃSKI S. et. al. J. Appl. Genet. 2002. - V. 43. - No. 3. - P.331-335.
(57)
Способ определения стрессовой чувствительности свиньи, включающий выявление
мутации в гене рианодинового рецептора, отличающийся тем, что выделяют геномную ДНК свиньи, получают ДНК-ампликоны путем проведения полимеразной цепной
реакции в реальном времени с использованием праймеров TmRYR1(C)MSP-F-5′GCGGGCAGGGCGGCGTCCTGTGTTCCCTGTGTGTACGCAATGGTGTGGCCGGGC-3′ и
TmRYR1(T)MSP-F-5′-GTGCAATGGTGTGGCCGTCT-3′, проводят плавление полученных
ДНК-ампликонов с регистрацией кривой плавления и пиков на ней и определяют, что
свинья является стрессустойчивой при наличии на кривой плавления одного пика в интервале температур 85-86 °С, или стрессчувствительной при наличии на кривой плавления
одного пика в интервале температур 79-81 °С, или стрессустойчивой со скрытым носительством мутации в гене рианодинового рецептора при наличии на кривой плавления
двух пиков в интервале температур 79-86 °С.
Изобретение относится к области молекулярной биологии и может быть использовано
для идентификации аллельного полиморфизма генарианодинового рецептора (RYR1), ассоциированного со стрессовой чувствительностью свиней.
Синдром злокачественной гипертермии у свиней (Malignant Hyperthermia - MH) является одним из проявлений стрессчувствительности и индуцируется галотановой анестезией,
а также стрессовыми факторами, обусловливая ухудшение хозяйственно-важных признаков и качества свинины. МН - фармакогенетическое расстройство скелетной мускулатуры
человека и некоторых видов млекопитающих. Заболевание обусловлено мутацией гена
RYR1, приводящей к нарушению функции рианодин-чувствительного кальциевого канала
саркоплазматического ретикулума скелетных мышц.
Известен способ диагностики злокачественной гипертермии у свиней с помощью метода электронного парамагнитного резонанса. Он основан на применении спиновых зон-
BY 17331 C1 2013.08.30
дов для мечения мембран эритроцитов крови свиней. Метод трудоемкий и требует использования дорогостоящего оборудования [1].
Известен способ определения стрессовой чувствительности свиней, основанный на
иммунологическом тестировании свиней на стрессовую чувствительность с использованием моноклональных антител к нормальному и мутантному белку RYR1 [2]. Данный
способ является трудоемким и недостаточно чувствительным.
Наиболее близким по своей сущности к предлагаемому изобретению является способ
определения стрессовой чувствительности по мутации в гене RYR1, основанный на полимеразной цепной реакции и анализе полиморфизма длины рестрикционных фрагментов
(ПЦР-ПДРФ). Способ включает следующие этапы: выделение геномной ДНК, ее рестрикцию
специфической эндонуклеазой, электрофоретическое разделение образующихся фрагментов
ДНК и идентификацию фрагментов ДНК, содержащих полиморфный сайт рестрикции [3].
Недостатками данного способа являются: низкая чувствительность, возможность контаминации образца неспецифическими продуктами, длительность процедуры из-за проведения электрофоретической детекции.
Задачей изобретения является создание быстрого, чувствительного и высокоспецифичного способа определения стрессовой чувствительности свиней по мутации в гене RYR1.
В известном способе определения стрессовой чувствительности свиньи выявляют мутации в гене рианодинового рецептора. Отличие заключается в том, что выделяют геномную
ДНК свиньи, получают ДНК- ампликоны путем проведения полимеразной цепной реакции в
реальном времени с использованием праймеров TmRYR1(C)MSP-F-5'-GCGGGCAGGGCGGCGTCCTGTGTTCCCTGTGTGTACGCAATGGTGTGGCCGGGC-3' и TmRYR1(T)MSP-F-5'GTGCAATGGTGTGGCCGTCT-3'. Проводят плавление полученных ДНК-ампликонов с регистрацией кривой плавления и пиков на ней. После этого определяют стрессовую чувствительность свиньи. Свинья является стрессустойчивой при наличии на кривой
плавления одного пика в интервале температур 85-86 °С, или стрессчувствительной - при
наличии на кривой плавления одного пика в интервале температур 79-81 °С, или стрессустойчивой со скрытым носительством мутации в гене рианодинового рецептора при наличии на кривой плавления двух пиков в интервале температур 79-86 °С.
Существенными отличиями заявляемого способа является то, что для проведения полимеразной цепной реакции (ПЦР) в реальном времени были разработаны специальные аллельспецифические праймеры: TmRYR1(C)MSP-F-5'-GCGGGCAGGGCGGCGTCCTGTGTTCCCTGTGTGTACGCAATGGTGTGGCCGGGC-3' и TmRYR1(T)MSP-F-5'-GTGCAATGGTGTGGCCGTCT-3' для построения кривых плавления. За основу взято свойство специфического
отжига аллельспецифичных праймеров на ДНК. Рассчитанные праймеры представляют
собой пару схожих олигонуклеотидов, различающихся по своему 3'-концу. Первый праймер полностью комплементарен нормальному аллелю, второй, в свою очередь, полностью
комплементарен мутантному аллелю. Это изменение 3'-конца препятствует отжигу неспецифичного праймера на несоответствующей ему ДНК-последовательности, что позволяет
повысить специфичность. Кроме того, для улучшения детекции продуктов в праймер на
нормальный аллель в 5'-положении была введена последовательность богатая GC-основаниями, которая позволяет увеличить чувствительность. Это изменение приводит к увеличению температуры плавления продукта такого праймера. Данная модификация ПЦР
наряду с высокой специфичностью и чувствительностью реакции позволяет проводить
качественный и количественный анализ процесса, благодаря прямой связи между исходным количеством ДНК-мишени и конечным количеством продуктов амплификации. Использование специально рассчитанных праймеров и дополнительное исследование характеристик плавления полученных ампликонов в виде кривых плавления позволяет
исключить ложные сигналы, связанные с накоплением в процессе ПЦР побочных продуктов амплификации (праймеры-димеры, неспецифические полосы и шмеры), и провести
детекцию продуктов ПЦР по температуре плавления.
2
BY 17331 C1 2013.08.30
Кроме того, при проведении ПЦР в реальном времени исключение электрофоретической детекции как дополнительного этапа анализа позволяет: устранить возможность контаминации образца неспецифическими продуктами реакции, снизить строгие требования к
организации лабораторного процесса, сократить трудозатраты и время анализа.
Сущность изобретения поясняется фиг. 1-4, где 1, 2, 3 - образцы ДНК.
На фиг. 1 изображена кривая плавления ПЦР-продукта, соответствующего доминантной гомозиготе дикого типа, с праймером TmRyR1(C)MSP-F. Пики на кривых плавления
соответствуют температуре плавления (Tпл.) ампликона в интервале 85-86 °С.
На фиг. 2 изображена кривая плавления ПЦР-продукта, соответствующего рецессивной гомозиготе по мутации, с праймером TmRyRl(T)MSP-F. Пики на кривых плавления
соответствуют Тпл. ампликона в интервале 79-81 °С.
На фиг. 3 изображена кривая плавления ПЦР-продукта, соответствующего гетерозиготе по мутации, с праймерами TmRyR1(C)MSP-F и TmRyR1(T)MSP-F. Пики на кривых
плавления соответствуют Тпл. ампликонов в интервалах 85-86 °С и 79-81 °С.
На фиг. 4. изображена контрольная кривая плавления без ДНК-ампликонов.
Примеры конкретного осуществления заявленного способа.
Способ определения мутации в гене RYR1, ассоциированной со стрессчувствительностью свиней включает следующие стадии.
1. Получение образцов хрящевой ткани свиней. Хрящевая ткань ушей была получена
методом выщипа.
2. Выделение геномной ДНК.
Для выделение геномной ДНК образцы ткани (0,1 г) измельчали и помещали в пробирки объемом 1,5 мл. Туда же добавляли 200 мкл 1 × STE буфера (0,1М NaCl, 10 мМ Tris
HCl, pH 8,0, 1 мМ EDTA), 75 мкл 10 % SDS и 10 мкл протеиназы К. Перемешивали на
встряхивателе. Пробу инкубировали при 37 °С в течение 12 ч. Затем к лизату добавляли
8 мкл РНКазы и инкубировали 1 ч при 37 °С, после чего в пробирку добавляли 50 мкл 5М
раствора перхлората натрия и 300 мкл хлороформа. Перемешивали и центрифугировали
10 мин при 13000 об/мин. Верхнюю ДНК-содержащую фазу переносили в чистую пробирку. Повторно добавляли хлороформ и центрифугировали. В пробирку с ДНК-содержащей фазой добавляли 600 мкл 96 % этанола для визуализации "медузы" ДНК. "Медузу"
ДНК переносили в чистую пробирку и добавляли 300 мкл 70 % этанола. Через 5-10 мин
спирт удаляли и пробирку высушивали, после чего высушенную ДНК растворяли в 70 мкл
буфера для ДНК. Хранили препарат при – 20 °С.
3.1. ПЦР в реальном времени с последующим построением кривых плавления.
Для проведения ПЦР в реальном времени были разработаны специфические праймеры. Для повышения чувствительности данного метода нами была проведена дополнительная модификации аллельспецифических праймеров на ген RYR1. Рассчитанные праймеры
представляют собой пару схожих олигонуклеотидов, различающихся по своему 3'-концу.
Первый праймер полностью комплементарен нормальному аллелю, второй, в свою очередь, полностью комплементарен мутантному аллелю. Эти изменения 3'-конца в положении 3, 19 и 20 препятствуют отжигу неспецифичного праймера на несоответствующей ему
ДНК-последовательности. Кроме того, для улучшения идентификации продуктов в праймер
на нормальный аллель в 5'-положении была введена последовательность богатая GC-оснований, эта модификация приводит к увеличению температуры плавления продукта такого
праймера. Размер праймера на дикий тип на 34 нуклеотида больше праймера на мутантный аллель, что также увеличивает температуру плавления продукта данного праймера.
Праймер gRYR-R - обратный.
Подобранные праймеры приведены в таблице.
1. TmRYR1(C)MSP-F
2. TmRYR1(T)MSP-F
3. gRYR-R
GCGGGCAGGGCGGCGTCCTGTGTTCCCTGTGTGTACGCAATGGTGTGGCCGGGC
GTGCAATGGTGTGGCCGTCT
CTGGTGACATAGTTGATGAGGTTTG
3
BY 17331 C1 2013.08.30
3.2. Для проведения ПЦР в реальном времени использовали смесь, содержащую буфер
1 × High Fidelity PCR Buffer (Fermentas), 50-150 нг гДНК, 4 мМ dNTP, 4,5 мМ MgCl2, а
также 1-2 ед. Tag-полимеразы, к которой добавляли одновременно по 0,3 пмоль/мкл специфических праймеров TmRYR1(C)MSP-F, TmRYR1(T)MSP-F и gRYR-R, и флуоресцентный краситель 0,5 Ч ZUBR GREEN-1 (PrimeTech). Реакцию и анализ проводили на
приборе MJ MiniTm Personal Thermal Cycler (BioRad) с приставкой Mini OpticonTm Realtime PCR System (BioRad) по следующей схеме: начальная инкубация - 95 °С, 4 мин, затем
40 циклов (денатурация - 95 °С, 30 с, отжиг - 60 °С, 30 с, элонгация 72 °С, 1 мин; считывание пробы), затем инкубация - 72 °С 5 мин. Анализ плавления полученного фрагмента
проводили в диапазоне 70- 95 °С каждые 0,2 °С. Конечная температура инкубации 72 °С,
5 мин.
При анализе полученных результатов исследовали такие характеристики ампликонов,
как кривые плавления.
Температурой плавления называется температура, при которой происходит разрушение двойной спирали (денатурация) ДНК и образование из нее двух одноцепочечных молекул ДНК. Плавление ДНК происходит в узком температурном интервале, и локализацие
температуры плавления в шкале температур определяется строением ДНК (ее нуклеотидным составом). После проведения цикла ПЦР пробирки медленно нагревают от 55 °С до
95 °С, регистрируя при этом интенсивность флуоресценции через каждые 0,1-0,5 °С. При
достижении температуры плавления продукта ПЦР происходит его денатурация, сопровождаемая диссоциацией молекул ДНК и интеркалирующего красителя под действием температуры, что ведет к резкому уменьшению интенсивности измеряемой флуоресценции.
Специфический продукт амплификации ДНК имеет температуру плавления, отличную
от температуры плавления неспецифических продуктов ПЦР или праймер-димеров. При
отсутствии в пробе исследуемой ДНК пики плавления не будут регистрироваться. Присутствие неспецифических продуктов амплификации приведет к появлению пиков с другой температурой плавления, отличающейся от температуры плавления специфических
ампликонов. Каждое резкое уменьшение интенсивности флуоресценции на кривой соответствует разным типам ампликонов. Наличие мутаций приводит к изменению температуры плавления ампликона и изменениям формы кривых плавления.
Основным и наиболее наглядным параметром анализа кривой плавления является
приращение снижения интенсивности испускания ДНК-связывающегося красителя к увеличению температуры.
Для стрессустойчивых животных гомозиготного дикого типа при отсутствии мутации
на кривой плавление регистрируется изменение (уменьшение) флуоресценции в интервале
температур 83-88 °С с пиком плавления при 85-86 °С (фиг. 1, пики 1, 2, 3).
Для стрессчувствительных носителей мутации на кривой плавления гомозиготного
ампликона по мутации С1843Т регистрируется изменение флуоресценции в интервале
температур 77-82 °С с пиком плавления при 79-81 °С (фиг. 2, пики 1, 2, 3).
Для стрессустойчивых скрытых носителей мутации на кривой плавления гетерозиготного ампликона регистрируются оба пика плавления, так как в гетерозиготе присутствуют
ампликоны обоих аллелей (фиг. 3, пики А и Б на кривых 1, 2).
Таким образом, можно заключить, что определенным образом рассчитанные аллельспецифические праймеры для проведения ПЦР в реальном времени и анализ кривой плавления
ДНК-ампликонов позволяют быстро и с высокой степенью чувствительности определить
генотип исследуемых образцов ДНК по гену RYR1, т.е. установить тип стрессчувствительности свиней.
Предложенный способ позволяет повысить достоверность полученных данных, учесть
наличие в образце возможных контаминаций, а также приводит к снижению строгих требований к организации лабораторного процесса, сокращению трудозатрат и времени анализа.
4
BY 17331 C1 2013.08.30
Источники информации:
1. Заявка JP 1158353, МПК A 61B 10/00, A 61D 13/00, 1989.
2. Патент СА 2079702, МПК A 61K 39/395, C 12P 21/08, 1992.
3. Fujii J., Otsu K., Zorzato F. et al. / Science. - 1991. - Vol. 253. - P. 448-451.
Фиг. 1
Фиг. 2
Фиг. 3
Фиг. 4
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
5
Документ
Категория
Без категории
Просмотров
0
Размер файла
194 Кб
Теги
by17331, патент
1/--страниц
Пожаловаться на содержимое документа