close

Вход

Забыли?

вход по аккаунту

?

Патент BY17349

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
(46) 2013.08.30
(12)
(51) МПК
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
(54)
C 12Q 1/02 (2006.01)
C 12Q 1/68 (2006.01)
СПОСОБ ОПРЕДЕЛЕНИЯ НАПРАВЛЕНИЯ МУТАЦИОННОГО
ДАВЛЕНИЯ В ГЕНЕ БАКТЕРИИ
(21) Номер заявки: a 20100818
(22) 2010.05.26
(43) 2011.12.30
(71) Заявитель: Государственное учреждение "Республиканский научнопрактический центр эпидемиологии
и микробиологии" (BY)
(72) Авторы: Хрусталев Владислав Викторович; Барковский Евгений Викторович; Колодкина Валентина Леонидовна; Титов Леонид Петрович
(BY)
BY 17349 C1 2013.08.30
BY (11) 17349
(13) C1
(19)
(73) Патентообладатель: Государственное
учреждение "Республиканский научнопрактический центр эпидемиологии и
микробиологии" (BY)
(56) US 2010/0099099 A1.
ХРУСТАЛЕВ В.В. и др. - Медицинский журнал, 2006, № 2, с. 101-105.
ХРУСТАЛЕВ В.В. и др. - Медицинский журнал. - 2006. - № 4. - С. 99-103.
ХРУСТАЛЕВ В.В. и др. - Медицинский журнал. - 2007. - № 1. - С. 92-96.
БУТВИЛОВСКИЙ А.В. и др. - Здравоохранение. - 2005. - № 6. - С. 37-39.
БУТВИЛОВСКИЙ А.В. и др. - Здравоохранение. - 2005. - № 6. - С. 40-43.
(57)
Способ определения направления мутационного давления в гене бактерии, заключающийся в том, что выделяют нуклеотидные последовательности исследуемого гена из
разных штаммов бактерии, проводят их амплификацию, секвенируют полученные нуклеотидные последовательности, рассчитывают в каждой из них процентное содержание P4G,
P4C, P4A и P4T нуклеотидов, соответственно G, C, A и T в четырехкратно вырожденных
сайтах, процентное содержание P2G, P2C, P2A и P2T нуклеотидов, соответственно G, C, A и
T в двукратно вырожденных сайтах, расположенных в третьих положениях кодонов, а
также отношения
P2
R 2 CG = C ,
P2 G
P2
R 2TA = T и
P 2A
P2 C + P2T
R 2 CT / GA =
P2G + P2 A
и определяют, что мутационное давление в исследуемом гене бактерии направлено на
увеличение частоты
трансверсий T или C на G, если P4G достоверно выше P4T, P4С и P4A, или
трансверсий A или G на C, если P4С достоверно выше P4A, P4G и P4T, или
трансверсий C или T на A, если P4A достоверно выше P4С, P4T и P4G, или
трансверсий G или A на T, если P4T достоверно выше P4G, P4A и P4C, или
транзиций T на C, если P2C достоверно выше P2T и R2CG достоверно выше R2CT/GA, или
транзиций C на T, если P2T достоверно выше P2C и R2TA достоверно выше R2CT/GA, или
BY 17349 C1 2013.08.30
транзиций A на G, если P2G достоверно выше P2A и R2CG достоверно ниже R2CT/GA, или
транзиций G на A, если P2A достоверно выше P2G и R2TA достоверно ниже R2CT/GA.
Изобретение относится к медицине, а именно к медицинской микробиологии и молекулярной биологии, может быть использовано для определения основных механизмов мутагенеза в генах патогенных бактерий с целью последующего использования этих данных
для выделения наиболее устойчивых участков бактериальных белков, в том числе для отбора наиболее устойчивых эпитопов.
Известен способ определения точечных нуклеотидных замен (SNP) в ДНК [1]. С помощью данного способа можно определить наличие определенного числа нуклеотидных
мутаций во фрагменте изучаемого гена, предположить их направление и механизм. Способ основан на амплификации фрагмента гена с помощью полимеразной цепной реакции
(ПЦР) с последующей гибридизацией амплифицированной ДНК на биочипе, содержащем
определенный набор олигонуклеотидов, с которыми может происходить комплементарное
связывание образца (связывание распознается по изменению флуоресценции).
Основным недостатком данного способа является то, что набор нуклеотидных мутаций, которые он позволяет выявить, ограничен. Перед применением данного метода и его
аналогов необходимо изготовить набор олигонуклеотидов для идентификации определенных нуклеотидных замен. Судить о направлении и механизме мутации можно путем сопоставления собственных данных с последовательностью гена, принятой за "исходную", что
не всегда соответствует действительности.
Количество мутаций, выявляемых в генах бактерий, как правило, невелико. Судить о
направлении мутационного давления на основании анализа нескольких мутаций представляется некорректным.
Наиболее близким способом, принятым за прототип, является способ выявления мутаций
при помощи гибридизации на олигонуклеотидных микроматрицах [2]. Сущность способа
заключается в том, что производят выделение нуклеотидных последовательностей исследуемого гена из образцов клинического материала, который подвергается амплификации
при помощи ПЦР, а затем происходит фрагментация (случайным образом ДНК нарезается
на участки одинаковой длины). После этого полученный набор участков ДНК связывается
с мечеными флуоресцентными зондами олигонуклеотидными последовательностями, закрепленными на специальной микроматрице. На матрице должны присутствовать все
возможные комбинации из восьми нуклеотидов (всего 65536 олигонуклеотидов). Комплементарное связывание одного из участков изучаемого гена с каким-либо олигонуклеотидом распознается по изменению флюоресценции. Получение данных о мутагенезе
исследуемого микроорганизма производят путем сравнения с последовательностью гена,
принятой за "исходную".
Известный способ имеет ряд недостатков. Чем длиннее анализируемый участок гена,
тем ниже процент выявления мутаций в нем данным методом (для последовательности
длиной 5400 нуклеотидов - только 74 %). На качестве анализа также отрицательно сказывается наличие прямых и инвертированных повторяющихся последовательностей в изучаемом фрагменте ДНК или РНК (образуются вторичные структуры, препятствующие
связыванию с олигонуклеотидами).
Всех этих недостатков можно избежать при использовании прямого секвенирования
для последующего анализа механизмов и направлений мутаций в генах бактерий. Кроме
того, для анализа путем гибридизации на олигонуклеотидной микроматрице какой-либо
вариант бактериального гена необходимо принимать за "исходный", чтобы по отношению
к нему определять направление мутации.
В предложенном нами способе этот недостаток устраняется путем анализа значений
оригинальных показателей, позволяющих определить преимущественное направление
2
BY 17349 C1 2013.08.30
нуклеотидных замен. Данные показатели отражают частоты использования нуклеотидов,
достигшие определенного уровня (в четырехкратно и двукратно вырожденных сайтах) в
течение долгого процесса мутагенеза.
Задачей заявляемого способа является увеличение точности определения основных
направлений мутационного давления в генах бактерий, а следовательно, определения биохимических механизмов, вызывающих мутационное давление.
Поставленная задача решается с помощью предлагаемого способа определения
направления мутационного давления в гене бактерии, заключающегося в том, что выделяют нуклеотидные последовательности исследуемого гена из разных штаммов бактерии,
проводят их амплификацию, секвенируют полученные нуклеотидные последовательности,
рассчитывают в каждой из них процентное содержание P4G, P4C, P4A и P4T нуклеотидов,
соответственно G, C, A и T в четырекратно вырожденных сайтах, процентное содержание
P2G, P2C, P2A и P2T нуклеотидов, соответственно G, C, A и T в двукратно вырожденных
сайтах, расположенных в третьих положениях кодонов, а также отношения
P2
R 2 CG = C ,
P2 G
P2 T
R 2 TA =
и
P2A
P2 C + P2 T
R 2 CT / GA =
P2G + P2 A
и определяют, что мутационное давление в исследуемом гене бактерии направлено на
увеличение частоты
трансверсий T или C на G, если P4G достоверно выше P4T, P4C и P4A, или
трансверсий A или G на C, если P4C достоверно выше P4A, P4G и P4T, или
трансверсий C или T на A, если P4A достоверно выше P4C, P4T и P4G, или
трансверсий G или A на T, если Р4Т достоверно выше P4G, P4A и P4C, или
транзиций T на C, если P2C достоверно выше P2T и R2CG достоверно выше R2CT/GA, или
транзиций C на T, если P2T достоверно выше P2C и R2TA достоверно выше R2CT/GA, или
транзиций A на G, если P2G достоверно выше P2A и R2CG достоверно ниже R2CT/GA, или
транзиций G на A, если P2A достоверно выше P2G и R2TA достоверно ниже R2CT/GA.
Пример. Определение направления и механизмов мутационного давления в гене dtxR
Corynebacterium diphtheriae.
Были просеквенированы 16 нуклеотидных последовательностей кодирующего участка
гена dtxR Corynebacterium diphtheriae длиной 681 нуклеотид.
Последовательности были получены амплификацией в ПЦР фрагмента гена регулярного dtxR-белка с использованием праймеров DtxR1F (GGGACTACAACGCAACAAGAA)
и DtxR1R (ATCTAATTTGCCGCCTTTAGT). ДНК клинических изолятов Corynebacterium
diphtheriae в объеме 2 мкл добавляли к 48 мкл реакционной смеси, содержащей: 5 мкл 10x
ПЦР буфера (100 мМ Tris-HCl [pH 8,4], 500 мМ KCl, 6 мкл 25 мМ MgCl2, 1 мкл смеси дезоксинуклеотидтрифосфатов (10 мМ каждый), 2,5 ед. Taq ДНК полимеразы (Perkin-Elmer)
и 1 мкл (25 pmol) каждого праймера. Стерильную Mili-Q воду добавляли до объема 50 мкл.
В ДНК-амплификаторе проводили 35 автоматических циклов: 30 сек. денатурация при
95 °С, 30 сек - отжиг при 55 °С, 1 мин - элонгация при 72 °С. В последнем цикле амплификации элонгация продолжалась 10 мин при 72 °С.
Ампликоны элюировали из геля и очищали, используя коммерческий набор GFX PCR
DNA and Gel Purification Kit производства Amersham Bioscience. Каждый очищенный ампликон растворяли в 40 мкл деионизированной воды и 5 или 7 мкл использовали в
сиквенс-реакции с Thermo Sequenase Cy5 Dye Terminator Cycle Sequencing Kit (Amersham
Bioscience). Сиквенс нуклеиновых кислот выполняли на обеих цепях ДНК, используя
праймеры, которые применялись в ПЦР.
3
BY 17349 C1 2013.08.30
Расчеты, произведенные по формуле 1, показали, что четырехкратно вырожденные
сайты нуклеотидных последовательностей гена dtxR обогащены цитозином (уровень
P4C варьировался от 38,8 до 36,5 %), уровень гуанина в них является наиболее низким
(P4G варьировался от 9,4 до 8,6 %), в то время как уровень аденина (P4A) варьировался от
21,6 до 20,9 %, уровень тимина (P4T) варьировался от 33,9 до 31,0 %.
Например, для определения P4C в одной из нуклеотидных последовательностей dtxR,
был произведен следующий расчет по формуле 1:
43
n 4C
P4C =
⋅100% =
⋅100 = 33,9 % .
43 + 11 + 37 + 25
n 4C + n 4G + n 4A + n 4 U
Частоты использования нуклеотидов в двукратно вырожденных сайтах, рассчитанные
по формуле 2, варьировали в следующих пределах: P2C - от 23,9 до 20,5 %; P2G - от 18,2 до
17,0 %; P2A - от 34,1 до 33,0 %; P2T - от 28,4 до 25,0 %.
Согласно результатам применения метода парных разностей P2T достоверно превышает P2C, а P2A достоверно превышает P2G.
Значение показателя R2CG, вычисленное по формуле 3, варьировалось среди 16 последовательностей от 1,4 до 1,2.
Значение показателя R2TA, вычисленное по формуле 4, варьировалось среди 16 последовательностей от 0,8 до 0,7.
Значение показателя R2CG/TA, вычисленное по формуле 5, было постоянным (0,98)
среди 16 последовательностей.
Показатель R2CG статистически достоверно превышает показатель R2CG/TA. Показатель
R2TA имеет более низкие значения, чем показатель R2CG/TA.
Мутационное давление в гене dtxR Corynebacterium diphtheriae можно охарактеризовать следующим образом. Наиболее частым направлением трансверсий следует признать
G на C и G на T. Транзиции G на A происходят чаще, чем транзиции C на T, при этом их
частоты существенно превышают частоты возникновения транзиций A на G и T на C соответственно. Однако транзиции T на C происходят значительно чаще, чем транзиции A
на G. Эти данные позволяют предположить, что наиболее устойчивыми участками в белке
dtxR являются те, которые кодируются фрагментами ДНК с наименьшим относительным
содержанием гуанина.
Предложенный способ позволяет повысить точность определения направления мутационного давления в бактериальных генах, причем отдельно для трасверсий и для транзиций; сведения, полученные данным способом, могут быть использованы для борьбы с
бактериальными заболеваниями путем повышения эффективности отбора наименее подверженных мутациям эпитопов для создания вакцин и иммунологических диагностических наборов.
Источники информации:
1. Заявка США на патент на изобретение 20080448208 20080205, МПК C 12Q 1/68,
2010.
2. Патент на изобретение 20090559252 20090914, МПК C 12Q 1/68, 2010.
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
4
Документ
Категория
Без категории
Просмотров
0
Размер файла
83 Кб
Теги
by17349, патент
1/--страниц
Пожаловаться на содержимое документа