close

Вход

Забыли?

вход по аккаунту

?

способ получения трансгенных растений, устойчивых к вирусной инфекции

код для вставки
РОССИЙСКАЯ ФЕДЕРАЦИЯ
RU
(19)
(11)
2 300 567
(13)
C1
(51) МПК
C12N 15/82
C12N 15/11
(2006.01)
(2006.01)
ФЕДЕРАЛЬНАЯ СЛУЖБА
ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ,
ПАТЕНТАМ И ТОВАРНЫМ ЗНАКАМ
(12)
ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ
(21), (22) За вка: 2005130280/13, 28.09.2005
(24) Дата начала отсчета срока действи патента:
28.09.2005
(45) Опубликовано: 10.06.2007 Бюл. № 16
ИНФЕКЦИИ
(57) Реферат:
Изобретение относитс к генной инженерии и
может быть использовано в селекции растений.
ДНК гена секреторной панкреатической нуклеазы,
наход щегос под управлением индуцибельного
MAS2'-промотора, включают в рекомбинантную
плазмиду р27. Сконструированным таким образом
вектором
посредством
Agrobacteriumопосредованной
трансформации
инфицируют
растительный материал, что позвол ет придать
регенерированным из последнего растени м
повышенную устойчивость к широкому кругу
вирусных инфекций. 2 ил., 3 табл.
(56) (продолжение):
CELL, v.6, 1994, P.1583-1592. CAO H. ET AL. CELL, v. 88, 1997, P.57-63. SU 1782991 A, 23.12.1992.
R U
2 3 0 0 5 6 7
(54) СПОСОБ ПОЛУЧЕНИЯ ТРАНСГЕННЫХ РАСТЕНИЙ, УСТОЙЧИВЫХ К ВИРУСНОЙ
Страница: 1
RU
C 1
C 1
Адрес дл переписки:
630090, г.Новосибирск, пр-кт Акад.
Лаврентьева, 10, ИЦиГ СО РАН, патентный отдел
2 3 0 0 5 6 7
(73) Патентообладатель(и):
ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ
СИБИРСКОГО ОТДЕЛЕНИЯ РОССИЙСКОЙ
АКАДЕМИИ НАУК (СО РАН) (RU)
R U
(56) Список документов, цитированных в отчете о
поиске: WATANABE Y. ETAL. FEBS Letters, v.372
(2-3), p.165-168. RU 94045821 A, 27.05.1997.
RU 2252960 С, 27.05.2005. RU 2241749 С,
10.12.2004. RU 2235778 С, 10.09.2004. RU
2103361 С, 27.01.1998. RU 2004110237 A,
20.04.2005. WO 94/16077 A, 21.07.1994. WO
98/06748 A, 19.02.1998. WO 98/26082 A,
18.06.1998. WO 98/29537 A, 09.07.1998. CAO H.
ET AL. THE PLANT (см. прод.)
(72) Автор(ы):
Трифонова Екатерина Александровна (RU),
Кочетов Алексей Владимирович (RU),
Комарова Марина Львовна (RU),
Шумный Владимир Константинович (RU),
Малиновский Владимир Иванович (RU),
Сапоцкий Михаил Владимирович (RU)
RUSSIAN FEDERATION
(19)
RU
(11)
2 300 567
(13)
C1
(51) Int. Cl.
C12N 15/82
C12N 15/11
(2006.01)
(2006.01)
FEDERAL SERVICE
FOR INTELLECTUAL PROPERTY,
PATENTS AND TRADEMARKS
(12)
ABSTRACT OF INVENTION
(21), (22) Application: 2005130280/13, 28.09.2005
(24) Effective date for property rights: 28.09.2005
(45) Date of publication: 10.06.2007 Bull. 16
Mail address:
630090, g.Novosibirsk, pr-kt Akad.
Lavrent'eva, 10, ITsiG SO RAN, patentnyj otdel
conferring enhanced resistance to broad range of
viral
infections
to
plants
regenerated
from
vegetable material used. Invention can be used in
selection of plants.
EFFECT:
improved
preparing
method
of
transgenic plants.
3 tbl, 2 dwg, 3 ex
R U
2 3 0 0 5 6 7
(57) Abstract:
FIELD: genetic engineering, agriculture.
SUBSTANCE: method involves insertion of gene
DNA encoding secretory pancreatic nuclease under
control
of
inducible
MAS2'-promoter
into
recombinant plasmid p27. Then vegetable material
is infected with this constructed vector using
Agrobacterium-mediated transformation that allows
Страница: 2
EN
C 1
C 1
(54) METHOD FOR PREPARING TRANSGENIC PLANTS RESISTANT TO VIRAL INFECTION
2 3 0 0 5 6 7
(73) Proprietor(s):
INSTITUT TsITOLOGII I GENETIKI SIBIRSKOGO
OTDELENIJa ROSSIJSKOJ AKADEMII NAUK (SO
RAN) (RU)
R U
(72) Inventor(s):
Trifonova Ekaterina Aleksandrovna (RU),
Kochetov Aleksej Vladimirovich (RU),
Komarova Marina L'vovna (RU),
Shumnyj Vladimir Konstantinovich (RU),
Malinovskij Vladimir Ivanovich (RU),
Sapotskij Mikhail Vladimirovich (RU)
RU 2 300 567 C1
5
10
15
20
25
30
35
40
45
50
Изобретение относитс к области биотехнологии, в частности к генетической инженерии
высших растений, и касаетс способа получени трансгенных растений, устойчивых к
вирусной инфекции.
Известен способ получени трансгенных растений с антивирусной устойчивостью,
котора обеспечиваетс с помощью экспрессии сателлитной или специфической вирусной
антисмысловой РНК в трансгенных растени х, а также продукцией в трансгенном растении
вирусных белков [Murant A.F., Mayo M.A. Ann. Rev. Phytopatol., 1982, v.20, p.49-70].
Основными недостатками способа вл ютс специфическа устойчивость только к одному
вирусу (или группе близкородственных вирусов), а также нестабильность вновь созданных
механизмов устойчивости к вирусной инфекции.
Известны способы получени трансгенных растений, содержащих рекомбинантную
плазмидную ДНК, кодирующую синтез альфа-интерферона человека [De Zoeten G.A.,
Pauswick I.R., Horisberger H.A. Virology, 1989, v.172, p.213-222] и бета-интерферона
человека [Патент РФ №2103361, кл. С 12 N 15/82, оп. 27.01.98]. Основным недостатком
данных способов вл етс то, что экспресси альфа-интерферона не ингибирует вирусное
размножение, а экспресси бета-интерферона не обеспечивает посто нного высокого
уровн антивирусной защиты растений.
Наиболее близким к за вл емому способу прототипом вл етс способ получени трансгенных растений табака, экспрессирующих дрожжевую рибонуклеазу, специфически
гидролизующую двуцепочечную РНК, которые про вл ют устойчивость к широкому спектру
растительных вирусов [Yuichiro Watanabe, Toshia Ogawa, Hisae Takahashi et. all, FEBS
Letters, 1995, v.372, p.165-168]. Способ заключаетс в клонировании вышеописанной
рибонуклеазы из дрожжей под контролем конститутивного промотора 35S из вируса
мозаики цветной капусты, передаче полученной рекомбинантной плазмиды рВ1121рас в
штамм Agrobacterium tumefaciens LBA4404 трехродительским скрещиванием и получении
трансгенных растений табака путем трансформации листовых дисков Nicotiana tabacum cv.
Xanthi-nc кокультивацией с Agrobacteria с последующим отбором на селективной среде.
Основными недостатками прототипа вл ютс :
1. Использование рибонуклеазы, специфически гидролизующей двуцепочечную РНК, в
то врем как основна часть растительных вирусов имеет одноцепочечные геномы, что
существенно ограничивает эффективность.
2. Использование несекреторной рибонуклеазы - фермента, известного своей
цитотоксичностью, в то врем как полученные за вл емым способом трансгенные растени секретируют фермент во внеклеточное пространство.
3. Использование сильного конститутивного промотора 35S из вируса мозаики цветной
капусты, что приводит к посто нному накоплению цитотоксичного продукта, тогда как в
за вл емом способе использован промотор MAS2', локально индуцируемый при
поранении, что более физиологично дл экспрессии гена, св занного с защитными
функци ми.
Технической задачей насто щего изобретени вл етс повышение устойчивости
растений к вирусным инфекци м путем трансгенеза.
Поставленна техническа задача достигаетс предлагаемым способом,
заключающимс в следующем. Конструируют рекомбинантную плазмидную ДНК путем
выделени гена панкреатической секреторной рибонуклеазы быка из геномной ДНК с
использованием метода ПЦР с последующим клонированием полученного фрагмента в
векторе рС27 под управлением индуцибельного MAS2' - промотора. Полученна рекомбинантна плазмида PC27BN состоит из следующих элементов:
- ДНК векторной плазмиды размером 12.5 т.п.н.
- фрагмента ДНК, содержащего ген панкреатической нуклеазы размером 455 п.н.
Описанную выше рекомбинантную плазмиду pC27BN, несущую ген панкреатической
секреторной нуклеазы быка, перенос т в штаммы Agrobacterium tumefaciens pGV2260 и
AGLO, осуществл ют трехродительское скрещивание с использованием плазмидыпомощника pRK2013 или пр мую трансформацию, затем полученной таким образом
Страница: 3
DE
RU 2 300 567 C1
5
10
15
20
25
30
35
40
45
50
агробактерией провод т трансформацию листовых дисков Nicotiana tabacum SRI
кокультивацией с Agrobacteria с последующим отбором трансгенных растений на
селективной среде.
Определ ющими отличительными признаками за вл емого способа по сравнению с
прототипом вл ютс :
- в качестве векторной плазмиды используют дл трансформации вектор рС27, в
котором встроен индуцибельный поранением промотор MAS2', что позвол ет резко
увеличивать наработку трансгенного продукта при необходимости, что вл етс более
физиологичным дл растени , в то врем как в прототипе был использован вектор рВI121
с конститутивным промотором 35S дл посто нной экспрессии трансгенного продукта.
- в качестве целевого гена используют панкреатическую секреторную рибонуклеазу
быка, что позвол ет эффективно защищать растени от широкого спектра растительных
вирусов, имеющих одноцепочечные РНК-геномы, в то врем как рибонуклеаза из дрожжей
(прототип) специфично гидролизует только двуцепочечную РНК; кроме этого,
панкреатическа рибонуклеаза быка локализуетс в межклеточном пространстве и
известна своей низкой цитотоксичностью дл эукариотических клеток по сравнению с
другими рибонуклеазами.
Изобретение по сн етс следующими примерами конкретного выполнени способа.
Пример 1.
Конструирование плазмидной ДНК, содержащей ген панкреатической секреторный
нуклеазы быка. Ген панкреатической рибонуклеазы быка был выделен методом
полимеразной цепной реакции из геномной ДНК [Carcana A., Confalone E., Libonati M et
al., Nucl. Acids Res., 1988, v.16, р.5491-5502], поскольку это относительно короткий
ген, не содержащий интронов. В конструировании этот ген также был использован с
последовательностью собственного лидерного пептида, поскольку была показана
возможность продукции корректно процессированных белков человека в трансгенных
растени х [Sijmons Р.С., Dekker B.M., Schrammeijer В. et al., Biotechnology, 1990,
v.8, р.217-221]. Дл полимеразной цепной реакции использовали праймеры:
П3:5?ATCATGGCTCTGAAGTTCCC и П4:5?CCTACACAGTAGCATCAAAG. Фрагмент ДНК,
полученный в результате амплификации, был клонирован в полилинкере плазмиды
pBlueScript KS (Stratagene? ) по сайту рестрикции EcoRV. Затем ген был перенесен в
вектор рС27 по сайтам Clal и EcoRI под контроль промотора MAS2?. Таким образом была
получена конструкци pC27BN. Схема Т-области полученного вектора приведена на фиг.1,
где LB, RB - повторы, ограничивающие Т-область в бинарных векторах; pan. nuclease ген панкреатической нуклеазы быка; РТ1/РТ2 - двунаправленный промотор гена
маннопинсинтазы; npt II - ген неомицинфосфотрансферазы II E.coli; Smal, EcoRI, PstI,
Clal - сайты рестрикции, использованные при конструировании и анализе вектора.
Пример 2.
Получение трансгенных растений табака. Полученна по примеру 1 конструкци pC27BN, несуща ген панкреатической секреторной нуклеазы быка, была использована дл трансформации клеток Agrobacterium tumefaciens штаммов pGV2260 и AGL0 путем
трехродительского скрещивани с использованием плазмиды-помощника pRK2013 или
путем пр мой трансформации. Дл агробактериальной трансформации в качестве
исходных эксплантов были использованы листь трехнедельных растений табака Nicotiana
tabacum SRI. Были получены 11 первичных трансформантов, устойчивых к канамицину (100
мг/л). Неомицинфосфотрансферазу (NPTII) в проростках тестировали по методу Рейса и
соавторов [Reiss В., Sprendel R., Will Н. et al., Gene.1984, v.30, p.211-218]. Далее
использовали только растени , устойчивые к канамицину и активно экспрессирующие
неомицинфосфотрасферазу II (NPTII). На фиг.2 представлены результаты ПЦР анализа
геномной ДНК проростков на наличие полноразмерной встройки целевого гена с
праймерами П3-П4. Нанесени по дорожкам: 1 - нетрансгенный табак SR1; 2 - трансгенный
табак SR1, экспрессирующий ген панкреатической нуклеазы быка; 3 - вектор pC27BN; 4 маркерна ДНК.
Страница: 4
RU 2 300 567 C1
5
10
15
20
25
30
35
40
45
50
Далее провели селекцию трансформированных растений по признаку высокого уровен нуклеазной активности. Дл измерени нуклеазной активности использовались растени одного возраста, выращенные стерильно в услови х климакамеры или в стандартных
услови х теплицы. Листь отбирались приблизительно одного размера с одного уровн растений в каждом эксперименте. Нуклеазна активность листовых экстрактов оценивалась
путем измерени изменени количества кислоторастворимого материала в суммарной РНК
дрожжей [Blank А., McKeon Т.А. Proc. Natl Acad. Sci. USA 1989, v.86, р.3169-3173].
Результаты измерений нуклеазной активности приведены в таблице 1. В качестве контрол при измерении оптической плотности использовали реакционную смесь без добавлени листового экстракта, врем гидролиза в опыте составл ло 60 минут [Galiana E., Bonnet
P., Conrod S. et al., Plant Physiol., 1997, v.115, p.1557-1567]. Из представленных в
таблице 1 данных видно, что уровень нуклеазной активности грубых листовых экстрактов
трансгенных растений табака, полученных с использованием конструкции pC27BN, выше
уровн активности контрольных растений. Так, нуклеазна активность экстрактов линий
pC27BN-5 и pC27BN-8 более чем в 10 раз превышает активность экстрактов контрольных
растений. Таким образом, за вл емый способ позвол ет получать трансгенные растени ,
экспрессирующие ген панкреатической нуклеазы быка и эффективно повышать уровень
нуклеазной активности в листь х трансгенных растений.
В таблице 2 представлены данные по тестированию устойчивости трансгенных растений
табака линий 11-2, 11-3, 11-8, 11-10 к вирусной инфекции. По вление фенотипических
симптомов и содержание антигена (мкг/мл) ВТМ в листь х контрольных (SR1) и
трансгенных растений Nicotiana tabacum через 3 недели после инфекции демонстрирует
повышенную устойчивость трансгенных растений к вирусу табачной мозаики вплоть до
полной вирусоустойчивости при низких концентраци х вируса в иноку люме.
Пример 3.
С помощью конструкции pC27BN, описанной в примере 1, были получены трансгенные
растени картофел сортов Бело рский ранний и Каприз. Трансформаци клубневых
дисков проводилась по модифицированному методу [Snyder G.W., Belknap W.R. Plant Cell
Repts, 1993, v.12, p.324-328]. Клубни промывали, обжигали в спирте и из камбиальной
зоны вырезали диски толщиной 2-2,5 мм. Клубневые диски инкубировали с культурой A.
tumefaciens в течение двух суток, затем отмывали в дистиллированной воде и помещали в
среду MS с клафораном (200 мг/л) на 2 дн дл отмывки от агробактерии. Излишки влаги
удал ли с помощью фильтровальной бумаги и переносили диски на твердую
агаризованную среду с гормонами и антибиотиками. Состав среды: соли MS (Sigma),
сахароза (20 мг/л), витамины MS с добавлением тиамина (2.5 мг/л), пиридоксина (12.5
мг/л), никотиновой кислоты (12.5 мг/л), глицина (50 мг/л), фолиевой кислоты (0.5
мг/л) и биотина (0.05 мг/л), ормоны: 10 мкМ зеатин, 0.3 мкМ индолилуксусна кислота.
Антибиотики: 50 мг/л канамицин, 200 мг/л клафоран.
Культуры выращивали при температуре воздуха 23°С с 16-часовым фотопериодом при
освещенности 4-6 килолюкс.Через 2 недели часть дисков зазеленела, затем по вились
первичные каллусы, и через 7 недель были отобраны побеги, которые пересадили на среду
без гормонов с канамицином (100 мг/л) дл укоренени . В результате было получено 11
укорененных растений - трансформантов сорта Бело рский ранний и 3 растени сорта
Каприз. После замера нуклеазной активности оставлено 5 растений сорта Бело рский
ранний и два растени сорта Каприз. Неомицинфосфотрансферазу (NPTII) в проростках
тестировали по методу Рейса и соавторов (см. пример 2). Пробирочные растени ,
выращенные в стандартных услови х, тестировали на уровень нуклеазной активности по
методике, описанной выше в примере 2. В таблице 3 приведены результаты измерений
уровн нуклеазной активности в листовых экстрактах трансгенных растений картофел . В
среднем уровень нуклеазной активности в экстрактах трансгенных растений в 2-3 раза
выше, чем в экстрактах контрольных растений.
Использование предлагаемого способа позволит повысить устойчивость растений к
вирусным инфекци м путем трансгенеза.
Страница: 5
RU 2 300 567 C1
Таблица 1
Линии растений Средн OD Стандартна ошибка
5
10
Контроль
0.8333
0.0667
pC27BN-1
2.7833
0.3556
pC27BN-2
1.0333
0.0444
pC27BN-3
2.1333
0.1111
pC27BN-4
1.6667
0.1111
pC27BN-5
9.0000
0.6667
pC27BN-6
1.2000
0.0667
pC27BN-7
5.1333
0.5111
pC27BN-8
9.6667
0.4444
pC27BN-9
1.8333
0.1111
pC27BN-10
7.5667
0.1556
pC27BN-ll
8.1000
0.0667
Таблица 2
Лини 15
Концентраци ВТМ в инокулюме, мкг/мл
0.001
0.01
0.1
SRI
0-
29.3+
146.5+
125.8+ 191.1+
11-2
0-
0-
0-
103.1+ 136.9+
11-3
0-
0-
0-
87.6+ 149.7+
11-8
0-
0-
0-
74.8+ 133.8+
11-10
0-
0-
0-
95.5+
20
1
10
121+
Таблица 3
Линии растений Средн OD Стандартна ошибка
25
Контроль
0.9798
0.1251
PC27BN-b4
2.9995
0.3688
PC27BN-b5
3.0350
0.3560
PC27BN-b7
3.1227
0.2431
PC27BN-b8
2.6547
0.1722
PC27BN-b11
2.6497
0.0736
PC27BN-k1
1.8633
0.3271
PC27BN-k2
2.3383
0.4311
30
35
Формула изобретени Способ получени трансгенных растений, устойчивых к вирусной инфекции,
включающий передачу вектора, содержащего ген, экспресси которого в растении придает
ему устойчивость к поражению вирусом, в штамм Agrobacterium и инфицирование
последним растительного материала, отличающийс тем, что вектор конструируют на
основе рекомбинантной плазмиды рС27, при этом ген, экспресси которого придает
растению устойчивость к поражению вирусом, включает фрагмент ДНК, содержащий
последовательность гена секреторной панкреатической нуклеазы размером 455 п.н.,
наход щегос под управлением индуцибельного МАS2'-промотора.
40
45
50
Страница: 6
CL
RU 2 300 567 C1
Страница: 7
DR
Документ
Категория
Без категории
Просмотров
2
Размер файла
458 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа