close

Вход

Забыли?

вход по аккаунту

?

Патент РФ 2335541

код для вставки
–ќ——»…— јя ‘≈ƒ≈–ј÷»я
RU
(19)
(11)
2 335 541
(13)
C1
(51) ћѕ C12N 15/00
(2006.01)
‘≈ƒ≈–јЋ№Ќјя —Ћ”∆Ѕј
ѕќ »Ќ“≈ЋЋ≈ “”јЋ№Ќќ… —ќЅ—“¬≈ЌЌќ—“»,
ѕј“≈Ќ“јћ » “ќ¬ј–Ќџћ «Ќј јћ
(12)
ќѕ»—јЌ»≈ »«ќЅ–≈“≈Ќ»я ѕј“≈Ќ“”
(21), (22) «а†вка: 2007115659/13, 17.04.2007
(72) јвтор(ы):
ƒжемилева Ћил† ”сеиновна (RU),
“азетдинов јндрей ћаулетз†нович (RU),
’иди†това »рина ћихайловна (RU),
’уснутдинова Ёльза амилевна (RU)
(24) ƒата начала отсчета срока действи† патента:
17.04.2007
(45) ќпубликовано: 10.10.2008 Ѕюл. є 28
(57) –еферат:
»зобретение относитс† к медицине, а именно к
медицинской генетике и оториноларингологии.
ѕредложен новый способ определени† мутаций
гена MTRNR1, позвол†ющий сократить врем†
исследовани† до 2-х суток. »зобретение может
быть использовано дл† диагностики острых форм
тугоухости. 2 ил., 1 табл.
(56) (продолжение):
Apr; 86(8):2766-70. CIRCIR Y.E., INCESULU A., TEKIN M. [Screening of the mitochondrial 12S rRNA
(MTRNR1) gene in probands with sensorineural hearing loss] Kulak Burun Bogaz Ihtis Derg. 2007; 17(2):
75-80. Turkish. ZANG H.J., et al. Sequence analysis of the mitochondrial genome from a large family
with maternally inherited nonsyndromic deafness. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2005 Aug; 22(4):
368-71. FERRARIS A., et al. Pyrosequencing for detection of mutations in the connexin 26 (GJB2) and
mitochondrial 12S RNA (MTRNR1) genes associated with hereditary hearing loss. Hum Mutat. 2002 Oct;
20(4):312-20.
C 1
R U
2 3 3 5 5 4 1
“”√ќ”’ќ—“», ¬џ«¬јЌЌќ… ѕ–»ћ≈Ќ≈Ќ»≈ћ јЌ“»Ѕ»ќ“» ќ¬ »« √–”ѕѕџ
јћ»Ќќ√Ћ» ќ«»ƒќ¬
—траница: 1
RU
C 1
(54) —ѕќ—ќЅ ќѕ–≈ƒ≈Ћ≈Ќ»я ћ”“ј÷»… √≈Ќј MTRNR1 ѕ–» ќ—“–ќ… Ќ≈…–ќ—≈Ќ—ќ–Ќќ…
2 3 3 5 5 4 1
јдрес дл† переписки:
450000, г.”фа-÷ентр, Ћенина, 3,
ЅјЎ√ќ—ћ≈ƒ”Ќ»¬≈–—»“≈“, ѕатентный отдел
(73) ѕатентообладатель(и):
»Ќ—“»“”“ Ѕ»ќ’»ћ»» » √≈Ќ≈“» »
”‘»ћ— ќ√ќ Ќј”„Ќќ√ќ ÷≈Ќ“–ј
–ќ——»…— ќ… ј јƒ≈ћ»» Ќј” (»Ѕ√ ”Ќ÷
–јЌ) (RU),
√осударственное образовательное учреждение
высшего профессионального образовани†
"ЅјЎ »–— »… √ќ—”ƒј–—“¬≈ЌЌџ…
ћ≈ƒ»÷»Ќ— »… ”Ќ»¬≈–—»“≈“
‘≈ƒ≈–јЋ№Ќќ√ќ ј√≈Ќ“—“¬ј ѕќ
«ƒ–ј¬ќќ’–јЌ≈Ќ»ё » —ќ÷»јЋ№Ќќћ”
–ј«¬»“»ё" (√ќ” ¬ѕќ Ѕ√ћ” –ќ—«ƒ–ј¬ј) (RU)
R U
(56) —писок документов, цитированных в отчете о
поиске: FISCHEL-GHODSIAN N., PREZANT T.R.,
BU X., OZTAS S.Mitochondrial ribosomal RNA
gene mutation in a patient with sporadic
aminoglycoside ototoxicity. Am J Otolaryngol.
1993 Nov-Dec; 14(6):399-403. ORITA M. et al.
Detection of polymorphisms of human DNA by
gel electrophoresis as single-strand
conformation polymorphisms. Proc Natl Acad
Sci USA. 1989 (см. прод.)
RUSSIAN FEDERATION
(19)
RU
(11)
2 335 541
(13)
C1
(51) Int. Cl.
C12N 15/00
(2006.01)
FEDERAL SERVICE
FOR INTELLECTUAL PROPERTY,
PATENTS AND TRADEMARKS
(12)
ABSTRACT OF INVENTION
(21), (22) Application: 2007115659/13, 17.04.2007
(72) Inventor(s):
Dzhemileva Lilja Useinovna (RU),
Tazetdinov Andrej Mauletzjanovich (RU),
Khidijatova Irina Mikhajlovna (RU),
Khusnutdinova Ehl'za Kamilevna (RU)
(24) Effective date for property rights: 17.04.2007
(45) Date of publication: 10.10.2008 Bull. 28
LOSS CAUSED BY USAGE OF ANTIBIOTICS FROM GROUP OF AMINOGLYCOSIDES
2 3 3 5 5 4 1
(57) Abstract:
FIELD: medicine; otorhinolaryngology.
SUBSTANCE: new method of definition of
mutations of gene MTRNR1 is offered. The
C 1
(73) Proprietor(s):
INSTITUT BIOKhIMII I GENETIKI UFIMSKOGO
NAUChNOGO TsENTRA ROSSIJSKOJ AKADEMII
NAUK (IBG UNTs RAN) (RU),
Gosudarstvennoe obrazovatel'noe uchrezhdenie
vysshego professional'nogo obrazovanija
"BAShKIRSKIJ GOSUDARSTVENNYJ
MEDITsINSKIJ UNIVERSITET FEDERAL'NOGO
AGENTSTVA PO ZDRAVOOKhRANENIJu I
SOTsIAL'NOMU RAZVITIJu" (GOU VPO BGMU
ROSZDRAVA) (RU)
invention can be used for diagnostics of acute
forms of perceptive hearing loss.
EFFECT: reduction of research time.
2 dwg, 1 tbl, 2 ex
R U
2 3 3 5 5 4 1
C 1
(54) METHOD DEFINING MUTATIONS OF GENE MTRNR1 AT ACUTE PERCEPTIVE HEARING
—траница: 2
EN
R U
Mail address:
450000, g.Ufa-Tsentr, Lenina, 3,
BAShGOSMEDUNIVERSITET, Patentnyj otdel
RU 2 335 541 C1
5
10
15
20
25
30
35
40
45
50
»зобретение относитс† к медицине, а именно к медицинской генетике и
оториноларингологии, может быть использовано дл† диагностики острых форм тугоухости
на фоне применени† антибиотиков из группы аминогликозидов у человека.
јнтибиотики группы аминогликозидов широко примен†ютс† в медицинской практике как
бактерицидные препараты при различных т†желых, в том числе анаэробных, инфекци†х.
ѕрименение ототоксических антибиотиков, таких как канамицин, гентамицин, неомицин и
др. приводит к возникновению острой нейросенсорной тугоухости у 12% пациентов.
ѕреобладает, как правило, т†жела† степень нейросенсорной тугоухости (III степень
потери слуха наблюдаетс† в 44% случаев, IV - в 35%).
ќстра† нейросенсорна† тугоухость относитс† к числу наиболее распространенных и
т†желых заболеваний, как среди детей, так и среди взрослых. ¬ысока†
распространенность и неуклонный рост в последние дес†тилети† данной патологии, а
также высока† степень инвалидизации больных с внезапными формами потери слуха
определ†ют важное социально-экономическое и медицинское значение этой проблемы,
необходимость исследовани† механизмов развити† данного заболевани† с целью
разработки эффективных методов диагностики, профилактики и патогенетической терапии
с учетом этнической принадлежности и генетической предрасположенности каждого
больного. Ќесмотр† на острую социальную значимость проблемы, до сих пор не
разработаны способы ранней диагностики и система профилактических меропри†тий
острой нейросенсорной тугоухости на фоне лечени† антибиотиками из группы
аминогликозидов.
ќстра† нейросенсорна† тугоухость, развивающа†с† на фоне приема аминогликозидов,
относитс† к тем заболевани†м, в которых анамнестические и клинические данные
представл†ют довольно скудный материал дл† постановки правильного диагноза с
определением этиологии заболевани†. ¬месте с тем, своевременна† и точна† диагностика
этого наследственного дефекта позволит избежать потери слуха у пациента при
своевременной отмене терапии аминогликозидами, а при возникновении ототоксического
эффекта от лечени† позволит наиболее качественно и в самые ранние сроки начинать
реабилитационные меропри†ти† дл† обеспечени† полноценной социальной адаптации лиц
с повреждением процесса звуковоспри†ти†.
ѕреимущества предлагаемой разработки перед существующими аналогами
заключаютс† в оптимальности разрабатываемых подходов ƒЌ -диагностики заболеваний,
основанных на вы†влении существующего своеобрази† генофонда народов ¬олго”ральского региона. –†д генов митохондриального генома принимает участие в
функционировании процесса звуковоспри†ти† у человека. Ёто гены MTRNR1, tRNALeu,
tRNALys, MTTS1, tRNAGlu, отвечающие за различные р–Ќ и т–Ќ (del Castillo et al.,
2002; Campos et al., 2002). ќтотоксичность антибиотиков аминогликозидового р†да дл†
человека обусловлена р†дом изменений митохондриального генома. ћутаци† A1555G гена
ћ“RNR1 была впервые идентифицирована Prezant et al. в 1993 году в многочисленной
арабской семье с наследственной несиндромальной глухотой, возникающей после
применени† антибиотиков из группы аминогликозидов. „астота данной мутации среди
больных несиндромальной сенсоневральной глухотой в состо†нии гомоплазмии
составл†ет, в среднем, 0,05, тогда как в попул†ци†х ита† и японии в состо†нии
гетероплазмии A1555G наблюдаетс† у 1 из 200 слышащих индивидов (Hutchin et al.,
1993). “акже мутаци† A1555G достаточно часто встречаетс† во многих европейских и
азиатских попул†ци†х. Bacino с соавторами в 1995 году обнаружили мутацию
del961T(ins)n гена MTRNR1 в 35 китайских семь†х с глухотой, возникающей после приема
антибиотиков-аминогликозидов. ѕо литературным данным, частота данной мутации от 10
до 50% у больных с острой нейросенсорной тугоухостью, возникающей на фоне
антибиотикотерапии. “акже в некоторых этнических группах (китайцы, †понцы, монголы,
индонезийцы) у больных острой нейросенсорной тугоухостью на фоне антибиотикотерапии
аминогликозидами идентифицируетс† мутации —1494“ и “1095— гена MTRNR1,
встречающиес† с частотой около 1%.
—траница: 3
DE
RU 2 335 541 C1
5
10
15
20
25
30
35
40
45
50
»звестен способ детекции мутации A1555G гена MTRNR1 посредством рестрикционного
анализа с помощью рестриктазы HaeIII (Prezant “. R., Agapian J. V., Bohlman M. —.et
al. Mitochondrial ribosomal RNA mutation associated with both antibiotic-induced and
non-syndromic deafness. 1993. Nature Genet. V.4. P.289-294). ќднако данный метод
позвол†ет вы†вить только мутацию A1555G, а мутации del961T(ins)n, C1494T и “1095—
остаютс† за пределами амплифицируемого участка, остава†сь недос†гаемыми дл†
детекции.
ѕрототипом изобретени† †вл†етс† работа Orita M. с соавторами, предложенна† в 1989
году (Orita M., Iwahana H., Kanazawa H., Sekya “. Detection of polymorphism of human
DNA by gel electrophoresis as single cell conformation polymorphism. // Protocols
Natl. Acad. Sci. - 1989. - V.86. - P.2766-2770). –азработанный Orita M. с соавторами
метод вы†влени† однонуклеотидных замен и делеций позвол†ет идентифицировать
различные мутации в ƒЌ . ¬рем† исследовани† составл†ет 4 дн†.
“ехническим результатом изобретени† †вл†етс† сокращение времени исследовани† до
2-х суток.
”казанный технический результат достигаетс† тем, что в способе, включающем
выделение ƒЌ из лимфоцитов периферической крови, проведение полимеразной цепной
реакции, идентификацию мутаций A1555G, del961T(insCn), C1494T, “1095—, амплификацию
провод†т с помощью специфических олигонуклеотидов:
A1555G (F) 5' gctcagcctatataccgccatcttcagcaa 3'
A1555G (R) 5' tttccagtacacttaccatgttacgactgg 3'
del961T(F) 5' ccaccgcggtcacacgattaa 3'
del961T(R) 5' ttctggcgagcagttttgttga 3', после чего дл† идентификации данных
мутаций провод†т анализ конформации одноцепочечных фрагментов (SSCP-анализ).
—пособ осуществл†етс† следующим образом.
ƒЌ выдел†ют из лимфоцитов периферической крови. ¬ качестве консерванта
используют раствор следующего состава: 0,48% лимонной кислоты, 1,32% цитрата натри†,
1,47% глюкозы. ѕри заборе крови к 1 мл консерванта добавл†ют 4 мл венозной крови и
хорошо перемешивают.
ƒл† получени† ƒЌ необходимой степени чистоты и достаточного молекул†рного веса
используют метод выделени† ƒЌ из крови фенольно-хлороформной экстракцией,
описанный ћетью (Mathew C.C. The isolation of high molecular weight eucariotic DNA.
// Methods in Molecular Biology /Ed. Walker J.M.Y.L.: Human Press. 1984. - V.2. - P.31-34).
1. ровь в пробирке с консервантом тщательно перемешивают и переливают в
центрифужный стакан объемом 50 мл, туда же добавл†ют 30 мл охлажденного
лизирующего буфера, содержащего 320 мћ сахарозы, 1% раствор тритона ’-100, 5 мћ
MgCl2, 10 мћ трис HCl (рЌ 7,6).
2. —месь центрифугируют 20 мин при 4000 об/мин.
3. Ќадосадочную жидкость сливают, к получившемус† осадку приливают 0,4 мл 10% SDS
и протеиназу (концентраци† 10 мг/мл). —месь дл† лизиса оставл†ют на 16 часов в
термостате при температуре 37∞—. Ёкстракцию ƒЌ осуществл†ют в следующем пор†дке:
4. лизату добавл†ют 0,5 мл фенола, насыщенного 1ћ трисHCl до рЌ 7,8.
5. —месь встр†хивают на шейкере и центрифугируют 10 мин при 6000 об/мин.
6. ќтбирают водную фазу, содержащую ƒЌ и неденатурированные белки.
7. ќтобранную фазу обрабатывают смесью фенол-хлороформа (1:1), а затем
хлороформом.
8. ѕрепараты осаждают двум† объемами охлажденного этанола 96%.
9. ќбразовавшийс† осадок ƒЌ раствор†ют в 1,5 мл деионизированной Ќ2ќ; раствор
хран†т при -20∞—.
¬ дальнейшем полученную ƒЌ используют в качестве матрицы дл† полимеразной
цепной реакции (ѕ÷–) дл† амплификации нужного фрагмента кодирующего региона гена
MTRNR1. —пецифические последовательности олигонуклеотидных праймеров дл†
детекции мутаций del961T(ins)n и “1095— гена MTRNR1 и их оптимальные концентрации в
—траница: 4
RU 2 335 541 C1
5
10
15
20
25
30
35
40
45
50
реакционной смеси подобраны с помощью пакета биологических программ DNASTAR
(Primer select 5.05 1993-2002). ѕоследовательности олигонуклеотидных праймеров,
используемые дл† рестрикционного анализа мутации A1555G, предложенные Prezant “. R.
с соавторами (1993), также могут быть использованы дл† детекции мутаций —1494“ и
A1555G гена MTRNR1 посредством SSCP анализа. »спользуют следующие
последовательности олигонуклеотидов:
A1555G (F) 5' gctcagcctatataccgccatcttcagcaa 3'
A1555G (R) 5' tttccagtacacttaccatgttacgactgg 3'
del961T(F) 5' ccaccgcggtcacacgattaa 3'
del961T(R) 5' ttctggcgagcagttttgttga 3'.
—остав реакционной смеси: 0,8 мкг геномной ƒЌ , соответствующее кол-во каждого
олигонуклеотида (“аблица), 125 мкћ каждого дезоксинуклеозидтрифосфата (Promega,
USA) помещают в 12,5 мкл однократного буфера дл† ѕ÷– следующего состава: 67 mM TrisHCl, pH 8.8, 6.7 mM MgCl2, 16,6 mM (NH4)2SO4, 0.01% Tween-20. полученной смеси
прибавл†ют 5 единиц термофильной ƒЌ -полимеразы, 20-30 мкл стерильного
минерального масла. –ежим амплификации: предварительна† денатураци† 4 минуты при
94∞—, затем 30 циклов со следующими параметрами - 94∞— - 45 секунд, 58∞— - 45 секунд,
72∞— - 1 минута. ѕосле 30-го цикла провод†т инкубацию при 72∞— в течение 7 минут.
ѕосле проведени† ѕ÷– 10 мкл амплификата смешивают с 3,3 мкл 0,5ћ NaOH и 0,3 мкл
0,5ћ Ёƒ“ј и нагревают в течение 15 минут при 43∞—. ѕосле этого к амплификатам
добавл†ют 3 мкл формамида, смешанного с 0,5% раствором бромфенолового синего и
0,5% раствором ксиленцианола, и нанос†т на 10% полиакриламидный гель (исходное
соотношение акриламида и метиленбисакриламида 29:1, 49:1) с 5% глицерином (Savov et
al., 1992; Spinardi et al., 1991).
¬ качестве электрофорезного буфера используют 0,5х“¬≈. Ёлектрофорез в геле длиной
23 см, толщиной 1 мм проходит при температуре +4∞— (в холодильной камере) при
напр†жении 100 ¬ в течение 48 часов. «атем фрагменты ƒЌ в геле фиксируют в 10%
растворе уксусной кислоты в течение 30 минут при непрерывном покачивании на шейкере.
ѕосле этого гель промывают три раза дистиллированной водой в течение двух минут,
инкубируют в 0,1% водном растворе AgNO3, содержащем 0,15% формалин и 0,02%
тиосульфата натри†. ѕосле про†влени† гель заливают 10% раствором уксусной кислоты
дл† остановки окраски. ¬рем† исследовани† составл†ет 2 дн†. »дентификацию генотипов
провод†т по критерию присутстви† или отсутстви† дополнительных полос в сравнении с
контрольной ƒ» (норма) и панели образцов ƒЌ с мутаци†ми A1555G, del961T(ins)n,
C1494T и “1095— гена MTRNR1.
Ќа фигурах 1 и 2 представлен SSCP-анализ продуктов амплификации гена MTRNR1.
‘игура 1. SSCP-анализ участка 1 гена MTRNR1. ƒорожка 1 - молекул†рный
маркер ?pUC19/Pstl; дорожка 2 - образец, содержащий мутацию “1095—, дорожки 3, 4 образцы, содержащие мутацию del961TinsCn, дорожка 5 - образец с нормальной
последовательностью ƒЌ . ‘игура 2. SSCP-анализ участка 2 гена MTRNR1. ƒорожка 1 молекул†рный маркер ?pUC19/Pstl; дорожка 2 - образец, содержащий мутацию A1555G в
состо†нии гомоплазмии, дорожка 3 - образец, содержащий мутацию A1555G в состо†нии
гетероплазмии, дорожка 4 - образец, содержащий мутацию C1494T.
¬ качестве конкретных примеров в целом были обследованы 70 неродственных
пациентов с острой нейросенсорной тугоухостью, возникшей на фоне применени†
антибиотиков из группы аминогликозидов, а также 231 пробанд с диагнозом двухсторон톆
нейросенсорна† тугоухость предположительно наследственной этиологии, состо†щих на
учете в –еспубликанском сурдологическом центре –еспубликанской детской клинической
больницы г.”фы, членов их семей, а также здоровых доноров, проживающих в ¬олго”ральском регионе. ƒиагноз глухоты или тугоухости устанавливалс† на основе данных
тональной пороговой аудиометрии (аудиометр ЂGSI-61ї, Grason Stadler Instruments,
USA), акустической импедансометрии (импедансометр ЂZodiac 901ї, ƒани†) и регистрации
отоакустической эмиссии (система ЂILO 92ї, Otodynamics Ltd., ¬еликобритани†).
—траница: 5
RU 2 335 541 C1
5
10
15
20
25
30
35
40
45
50
Ќаследственный характер глухоты в семь†х устанавливали на основании генеалогических
данных и ретроспективного анализа анамнеза больных с целью исключени† возможного
вли†ни† факторов внешней среды во врем† пренатального и постнатального развити†:
учитывали отсутствие инфекций, травм слухового аппарата.
ћолекул†рно-генетический анализ частот мутаций A1555G, del961T(ins)n, C1494T и
“1095— гена MTRNR1 проводилс† у больных, страдающих сенсоневральной тугоухостью
третьей и четвертой степени и глухотой, предположительно наследственной этиологии,
возникшей после терапии аминогликозидами.
ћутации A1555G, C1494T и “1095— гена MTRNR1 не обнаружены ни у одного из
обследуемых нами пациентов и в группе контрол†.
¬ гене MTRNR1 у четырех обследуемых была вы†влена мутаци† del961TinsCn. ” двух
пациентов данна† мутаци† находилась в состо†нии гомоплазмии и у двух - в состо†нии
гетероплазмии. ƒвум пациентам татарской и русской этнической принадлежности, несущим
мутацию del961TinsCn в состо†нии гетероплазмии, диагноз нейросенсорной
несиндромальной формы глухоты был поставлен в первые мес†цы жизни. “ерапию
аминогликозидами больные отрицают, однако указывают на т†желые инфекционные
заболевани† в возрасте до года. ƒвое других пациентов - носителей мутации del961TinsCn
в состо†нии гомоплазмии русской этнической принадлежности, указывали на т†желую
форму гриппа, перенесенную в раннем детстве. Ќа фоне лечени† осложнений после
гриппа у данных больных развилась остра† нейросенсорна† тугоухость. “акже были
обнаружены мутации 961“?G и 961“?ј у больных русской этнической принадлежности с
диагнозом острой нейросенсорной тугоухости не†сной этиологии. ћутаци† 961“?G, по
литературным данным, характерна дл† больных острой нейросенсорной тугоухостью из
европейских попул†ций [Mishmar et al., 2003; Achilla et al., 2004]. “огда как del961TinsCn
чаще встречаетс† у больных из японии [Tanaka et al., 2004], ореи и “айвани [Mishmar
et al., 2003], ѕакистана [Achilli et al., 2005]. »зменение нуклеотидной
последовательности митохондриальной ƒЌ 961“?ј гена MTRNR1 было вы†влено
впервые у больного острой нейросенсорной тугоухостью на фоне применени†
аминогликозидов. “аким образом, частота мутации del961TinsCn среди пациентов с острой
нейросенсорной тугоухостью составила 0,028 (2,8%), а среди пациентов с наследственной
несиндромальной глухотой - 0,008 (0,8%). ћутации 961T?G и 961“?ј были вы†влены с
частотой 0,014 (1,4%) в группе пациентов с острой нейросенсорной тугоухостью.
ѕолученные высокие значени† частоты мутации del961TinsCn среди больных острой
нейросенсорной тугоухостью в Ѕашкортостане подтверждают важность определени† этой
делеции в гене MTRNR1 при медико-генетическом консультировании пациентов с потерей
слуха на фоне лечени† антибиотиками из группы аминогликозидов. ѕоскольку применение
антибиотиков аминогликозидового р†да, таких как стрептомицин, канамицин, гентамицин,
клиндомицин и др., широко распространено в нашей стране, изучение частоты мутации
del961TinsCn гена MTRNR1 †вл†етс† актуальным дл† оценки риска возникновени†
сенсоневральной глухоты в семь†х, где данна† мутаци† находитс† в состо†нии
гетероплазмии, а также разработки схемы дородовой диагностики повреждений гена
MTRNR1 у плода.
ѕример 1. Ѕольной ‘.»., 1990 год рождени†, город “уймазы, –еспублика Ѕашкортостан.
ƒиагноз острой нейросенсорной двухсторонней глухоты установлен в 1992 году после
курса гентамицина по поводу острой двухсторонней пневмонии. ќстра† нейросенсорна†
тугоухость наступила после двух первых инъекций препарата, однако лечение продолжали
на основании т†желого соматического состо†ни† больного. ¬ насто†щее врем† пациент
использует слуховой аппарат. —о стороны родителей и ближайших родственников наследственность не от†гощена. Ќарушений слуха у родных пациента не вы†влено. ѕри
молекул†рно-генетическом тестировании у больного и его родителей было вз†то по 8 мл
венозной крови с последующим выделением ƒЌ и амплификацией двух участков
кодирующего региона гена MTRNR1 в реакционной смеси, содержащей 0,8 мкг геномной
ƒЌ , соответствующее кол-во каждого олигонуклеотида (“аблица), 125 мкћ каждого
—траница: 6
RU 2 335 541 C1
5
10
15
20
25
30
дезоксинуклеозидтрифосфата в 12,5 мкл однократного буфера дл† ѕ÷–. «атем провели
SSCP-анализ амплифицированных ѕ÷–-продуктов при посто†нном напр†жении 100 ¬.
ѕосле окончани† электрофореза гель окрасили раствором 0,1% водного раствора AgNO3,
содержащего 0,15% формалина и 0,02% тиосульфата натри†. »сследование ƒЌ больного
и его родителей вы†вило наличие мутации del961TinsCn у матери в состо†нии
гетероплазмии. ” пациента была вы†влена мутаци† del961TinsCn в состо†нии
гомоплазмии, котора† †вилась причиной глухоты в ответ на терапию антибиотиками
аминогликозидового р†да. ¬рем† исследовани† составило 2 дн†.
ѕример 2. ѕациентка ј.ј., 1978 год рождени†, город ”фа, –еспублика Ѕашкортостан.
—лух нормальный, беременность 8 недель. —о стороны мужа наследственность по
врожденной глухоте не от†гощена. ¬ы†влены нарушени† слуха у сына сестры пациентки.
Ѕольной был проведен амниоцентез и вз†та ворсина хориона. “акже у супругов вз†ли по 8
мл венозной крови с последующим выделением ƒЌ и амплификацией двух участков гена
MTRNR1 в реакционной смеси, содержащей 0,8 мкг геномной ƒЌ , соответствующее кол-во
каждого олигонуклеотида (“аблица), 125 мкћ каждого дезоксинуклеозидтрифосфата в 12,5
мкл однократного буфера дл† ѕ÷–. «атем провели SSCP-анализ амплифицированных
ѕ÷–-продуктов при посто†нном напр†жении 100 ¬. ѕосле окончани† электрофореза гель
окрасили раствором 0,1% водного раствора AgNO3, содержащего 0,15% формалина и
0,02% тиосульфата натри†. ѕри исследовании ƒЌ ворсины хориона была обнаружена
мутаци† del961TinsCn гена MTRNR1 в состо†нии гетероплазмии у пациентки и в состо†нии
гомоплазмии у плода, что †вилось свидетельством о возможном возникновении острой
нейросенсорной тугоухости у будущего ребенка в случае применени† антибиотиков
аминогликозидового р†да. ¬рем† исследовани† составило 2 дн†.
“аким образом, нами проведено молекул†рно-генетическое изучение
распространенности часто встречающейс† в нашем регионе мутации del961TinsCn гена
MTRNR1 у 70 больных острой нейросенсорной тугоухостью и глухотой и у 231
неродственного индивида с наследственной несиндромальной глухотой, проживающих на
территории республики Ѕашкортостан. ѕолученные данные позвол†ют оценивать
веро†тность возникновени† острой нейросенсорной тугоухости и глухоты при
антибиотикотерапии аминогликозидами у детей практически с первых дней жизни.
”становление с помощью молекул†рно-генетических методов веро†тности повреждени†
слуха при проведении антибиотикотерапии с самого рождени† позвол†ет предотвратить
повреждение процесса звуковоспри†ти†, а также снизить экономические затраты на
проведение дорогосто†щих диагностических процедур.
–еакционна† смесь дл† ѕ÷–
35
ћутаци†
961delTinsC
ѕ÷– буфер (х10), —месь dNTP, ѕраймер F, ѕраймер ќбъем Taq-полимеразы, мкл ќбъем Ќ2ќ, ол-во ƒЌ ,
мкл
мкл
мкл
R,
(≈ƒ)
мкл
мкг
мкл
1,25
0,5
0,19
0,18
0,25 (5≈ƒ)
10,38
0,8
1,25
0,5
0,25
0,25
0,25 (5≈ƒ)
9,35
0,8
n
40
A1555G
ƒанные привод†тс† из расчета на 1 образец ƒЌ . –еакци† проводитс† в 12,5 мкл
реакционной смеси
45
50
‘ормула изобретени†
—пособ определени† мутаций гена MTRNR1 при острой нейросенсорной тугоухости на
фоне применени† антибиотиков из группы аминогликозидов, включающий выделение ƒЌ из лимфоцитов периферической венозной крови, идентификацию мутаций A1555G,
del961T(ins)n, C1494T и “1095—, отличающийс† тем, что амплификацию провод†т с
помощью полимеразной цепной реакции синтеза дЌ и специфических олигонуклеотидов:
A1555G (F) gctcagcctatataccgccatcttcagcaa,
A1555G (R) tttccagtacacttaccatgttacgactgg,
de1961T(F) ccaccgcggtcacacgattaa,
de1961T(R) ttctggcgagcagttttgttga,
—траница: 7
CL
RU 2 335 541 C1
после чего провод†т SSCP анализ, а идентификацию генотипов осуществл†ют по
критерию присутстви† или отсутстви† дополнительных полос в сравнении с контрольной
ƒЌ и панелью образцов ƒЌ с мутаци†ми A1555G, de1961T(ins)n, C1494T и “ 1095— гена
MTRNR1.
5
10
15
20
25
30
35
40
45
50
—траница: 8
RU 2 335 541 C1
—траница: 9
DR
Документ
Категория
Без категории
Просмотров
0
Размер файла
115 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа