close

Вход

Забыли?

вход по аккаунту

?

Патент РФ 2336902

код для вставки
РОССИЙСКАЯ ФЕДЕРАЦИЯ
RU
(19)
(11)
2 336 902
(13)
C2
(51) МПК
A61K 45/00
A61P 27/06
(2006.01)
(2006.01)
ФЕДЕРАЛЬНАЯ СЛУЖБА
ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ,
ПАТЕНТАМ И ТОВАРНЫМ ЗНАКАМ
(12)
ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ
(21), (22) За вка: 2004116308/15, 31.10.2002
(72) Автор(ы):
КЛАРК Эббот Ф. (US),
УОРДИНГЕР Роберт Дж. (US)
(24) Дата начала отсчета срока действи патента:
31.10.2002
(43) Дата публикации за вки: 27.03.2005
R U
(73) Патентообладатель(и):
АЛЬКОН, ИНК. (CH),
ЮНИВЕРСИТИ ОФ НОРТ ТЕКСЭС ХЕЛТ
САЙЕНС СЕНТЕР (US)
(30) Конвенционный приоритет:
31.10.2001 US 60/334,852
(45) Опубликовано: 27.10.2008 Бюл. № 30
2 3 3 6 9 0 2
(56) Список документов, цитированных в отчете о
поиске: RU 2139538 С1, 10.10.1999. RU 2155346
С1, 27.08.2000. WO 0107067 A3, 01.02.2001. WO
0061774 A3, 19.10.2000.
(85) Дата перевода за вки PCT на национальную фазу:
31.05.2004
2 3 3 6 9 0 2
R U
(87) Публикаци PCT:
WO 03/055443 (10.07.2003)
C 2
C 2
(86) За вка PCT:
US 02/35251 (31.10.2002)
Адрес дл переписки:
129010, Москва, ул. Б.Спасска , 25, стр.3,
ООО "Юридическа фирма Городисский и
Партнеры", пат.пов. Е.Е.Назиной, рег. № 517
(54) МОРФОГЕННЫЕ БЕЛКИ КОСТИ (ВМР), РЕЦЕПТОРЫ ВМР И СВЯЗЫВАЮЩИЕ ВМР БЕЛКИ И
ИХ ПРИМЕНЕНИЕ ДЛЯ ДИАГНОСТИКИ И ЛЕЧЕНИЯ ГЛАУКОМЫ
(57) Реферат:
Изобретение относитс к медицине, а именно к
офтальмологии. Предлагаетс использовать дл лечени глаукомы композиции, содержащие по
меньшей мере один агонист ВМР-4. При этом
композицию ввод т непосредственной доставкой в
глаз пациента, например посредством местных
глазных
капель;
глазной
мази;
устройства
замедленного высвобождени , имплантированного
в слепой мешок глаза или около склеры глаза или
внутри глаза; посредством инъекции. Концентраци ВМР-4 в композиции предпочтительно составл ет
от 0,01 до 2%. Способ основан на свойстве ВМР-4
снижать внутриглазное давление. 7 з.п. ф-лы, 15
ил., 2 табл.
Страница: 1
RU
RUSSIAN FEDERATION
RU
(19)
(11)
2 336 902
(13)
C2
(51) Int. Cl.
A61K 45/00
A61P 27/06
(2006.01)
(2006.01)
FEDERAL SERVICE
FOR INTELLECTUAL PROPERTY,
PATENTS AND TRADEMARKS
(12)
ABSTRACT OF INVENTION
(21), (22) Application: 2004116308/15, 31.10.2002
(72) Inventor(s):
KLARK Ehbbot F. (US),
UORDINGER Robert Dzh. (US)
(24) Effective date for property rights: 31.10.2002
(30) Priority:
31.10.2001 US 60/334,852
(43) Application published: 27.03.2005
(45) Date of publication: 27.10.2008 Bull. 30
2 3 3 6 9 0 2
(85) Commencement of national phase: 31.05.2004
(86) PCT application:
US 02/35251 (31.10.2002)
(87) PCT publication:
WO 03/055443 (10.07.2003)
(54) MORPHOGENE BONE PROTEINS (BMP), BMP RECEPTORS AND BINDING BMP PROTEINS
(57) Abstract:
FIELD: medicine.
SUBSTANCE: invention concerns medicine,
namely to ophthalmology. It is offered to use a
composition containing, at least one agonist BMP4 for treatment of glaucoma. Thus administer the
composition with immediate delivery into an eye
of the patient, for example using local eye drops;
an oculentum; devices of the slowed down release
implanted into a cul-de-sac of an eye either
about a sclera of an eye or in an eye; by means
of an injection. Concentration of BMP-4 in the
composition preferably makes from 0.01 to 2%. The
method is based on property of BMP-4 to reduce an
ophthalmotonus.
EFFECT: creation of a composition for glaucoma
treatment.
8 cl, 15 dwg, 2 tbl, 1 ex
R U
2 3 3 6 9 0 2
AND THEIR APPLICATION FOR DIAGNOSTICS AND GLAUCOMA TREATMENT
Страница: 2
C 2
C 2
Mail address:
129010, Moskva, ul. B.Spasskaja, 25, str.3,
OOO "Juridicheskaja firma Gorodisskij i
Partnery", pat.pov. E.E.Nazinoj, reg. № 517
EN
R U
(73) Proprietor(s):
AL'KON, INK. (CH),
JuNIVERSITI OF NORT TEKSEhS KhELT SAJENS
SENTER (US)
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
1. Область изобретени Насто щее изобретение раскрывает способы и реагенты дл диагностики и лечени глаукомы и близких нарушений.
2. Описание области техники
"Глаукомы" представл ют группу нарушающих зрение глазных заболеваний, которые
вл ютс основной причиной возникновени необратимой слепоты в США и других
развитых странах. Первична открытоугольна глаукома ("POAG") - наиболее
распространенна форма глаукомы - характеризуетс дегенерацией трабекул рной сети,
привод щей к блокаде нормальной способности глазной жидкости к оттоку из глаза без
перекрыти пространства (например, "угла") между радужкой и роговицей (Vaughan D. et
al. (1992)). Характерным признаком подобной блокады при данном заболевании вл етс повышенное внутриглазное давление ("IOP"), что в конечном итоге при отсутствии
соответствующего и своевременного лечени приводит к прогрессирующей потере зрени и слепоте. Установлено, что заболевание поражает 0,4-3,3% взрослых людей в возрасте
старше 40 лет (Leske M.C. et al. (1986); Bengtsson B. (1989); Strong N.P. (1992)).
Кроме того, распространение заболевани возрастает до 6% у людей в возрасте 75 лет
или старше (Strong N.P. (1992)).
Поскольку повышенное IOP вл етс хорошо определ емым признаком глаукомы, то
диагностика заболевани в основном проводитс по измерению внутриглазного давлени (тонометри ) (Strong N.P. (1992); Greve M. et al. (1993)). К сожалению, поскольку
пределы давлени при глаукоме и нормального давлени перекрываютс , подобные
методы обладают ограниченной ценностью, если только не провод тс многократные
определени (Hitchings R.A. (1993); Tuck M.W. et al. (1993); Vaughan D. et al. (1992);
Vernon S.A. (1993)). По этой причине часто примен ют дополнительные способы, такие
как пр мое обследование диска зрительного нерва и определение степени потери пол зрени у пациента дл повышени точности постановки диагноза (Greve M. et al. (1993)).
При глаукоме поражаютс три отдельных ткани в глазе. Повышенное IOP, св занное с
POAG, возникает за счет морфологических и биохимических изменений в трабекул рной
сети (ТМ), ткани, расположенной в углу между роговицей и радужкой. Больша часть
питающей глазной жидкости проходит через передний сегмент глаза по ТМ.
Прогрессирующа потер клеток ТМ и скопление внеклеточного дебриса в ТМ глаза при
глаукоме приводит к повышенному сопротивлению оттоку глазной жидкости (Lutjen-Drecoll
and Rohen, 1996; Rohen, 1983; Rohen et al., 1993; Grierson and Calthorpe, 1988), в
результате чего повышаетс IOP. Повышенное IOP, а также другие факторы, такие как
ишеми , привод т к дегенеративным изменени м в головке глазного нерва (ONH), вызыва прогрессирующее "углубление" ONH (Varma and Minckler, 1996; Hernandez and Gong, 1996;
Hernandez et al., 1990; Hernandez and Pena, 1997; Morrison et al., 1990) и потерю
ганглиозных клеток сетчатки (Quigley et al., 2000; Quigley, 1999; Quigley et al.,
1995; Kerrigan et al., 1997) и аксонов. Детальный молекул рный механизм,
ответственный за повреждение ТМ, ONH и ганглиозных клеток сетчатки при глаукоме,
остаетс неизвестным.
Лечение глаукомы в насто щее врем направлено на снижение IOP, основного фактора
риска дл развити и прогрессировани глаукомы. В результате подобного лечени снижаетс IOP, но оно не направлено непосредственно на механизм патогенеза, и
заболевание продолжает прогрессировать. По меньшей мере, у половины пациентов с
глаукомой диагноз не поставлен, и со временем, когда у пациентов все-таки глаукома
диагностируетс , потер ганглиозных клеток сетчатки уже составл ет примерно 40%.
Следовательно, имеетс потребность в способах более раннего установлени и
диагностики глаукомы.
В свете значени глаукомы и, по меньшей мере, частичной неадекватности способов
диагностики предшествующего уровн техники было бы желательным иметь
усовершенствованный, более точный способ диагностики глаукомы на ранних стади х
заболевани . Кроме того, было бы желательным иметь новые терапевтические средства,
Страница: 3
DE
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
направленные на механизм патогенеза глаукомы.
Краткое описание изобретени В насто щем изобретении преодолеваютс данные и другие недостатки
предшествующего уровн техники обеспечением способов и наборов дл ранней
диагностики глаукомы, дл лечени глаукомы и дл идентификации соединений, пригодных
дл лечени глаукомы.
В некоторых конкретных воплощени х изобретение обеспечивает способ диагностики
глаукомы в пробе, полученной из клетки или жидкости организма, детектированием
измененной экспрессии гена, члена семейства морфогенных белков кости. В целом способ
включает стадии:
а) получени пробы ткани или жидкости от пациента с подозрением на глаукому;
b) экстрагировани ДНК из указанной пробы;
с) получени множества ПЦР-праймеров, при этом каждый из указанных праймеров
включает последовательность, состо щую из 18-1547 смежных нуклеотидов
последовательностей SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:
37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 или SEQ ID
NO:53;
d) амплификации областей экстрагированной ДНК с использованием указанных
праймеров с получением продукта ПЦР;
е) выделени продукта ПЦР; и
f) идентификации различий между последовательностью продукта ПЦР и нормальной
последовательностью гена;
при этом различие между амплифицированной последовательностью и нормальной
последовательностью гена вл етс диагностическим признаком глаукомы.
В основном способы по изобретению могут включать получение пробы от индивидуума и
экстрагирование ДНК из указанной пробы. Выбранные ПЦР-праймеры дл конкретных
членов семейства генов ВМР затем используютс дл амплификации соответствующих
областей экстрагированного гена с получением продукта ПЦР. Продукт ПЦР выдел ют
методом, с помощью которого можно эффективно установить различи в
последовательност х ДНК между нормальной и мутантной формой конкретного гена
семейства ВМР, которые подвергаютс оценке (экстрагированной ДНК). Установленные
различи между последовательност ми указывают на наличие глаукомы.
Пробой ткани или жидкости дл использовани в способах по изобретению может быть
кровь или клетки щеки.
Как правило, последовательности праймеров будут иметь длину в пределах примерно от
10, 15 или 18 нуклеотидов до примерно 20 или примерно 30 нуклеотидов. Более длинные
последовательности, например, из 40, 50, 80, 90, 95, 100 нуклеотидов, даже до
полноразмерных последовательностей, вл ютс даже более предпочтительными дл некоторых воплощений. Специалисты в данной области считают допустимыми
олигонуклеотиды длиной, по меньшей мере, из 18-20 нуклеотидов, как достаточные дл проведени в достаточной мере специфической гибридизации, в качестве молекул рного
зонда, описанные Lathe (1985), данный источник специально дл этой цели включен здесь
дл сведени . Предпочтительно нуклеотидна последовательность будет состо ть из 20100 смежных нуклеотидов последовательностей SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5,
SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45,
SEQ ID NO:47 или SEQ ID NO:53. Также предусматриваетс , что последовательности
праймеров могут состо ть из последовательностей, по меньшей мере, из 10, 15 или 18
смежных нуклеотидов последовательностей генов ВМР-рецепторов и св занных с ВМР
белков, последовательности которых хорошо известны.
Молекулы нуклеиновой кислоты, имеющие участки из 10, 18, 20, 30, 50, 60, 65 или
даже до и включа 100 нуклеотидов, и так далее, комплементарные любой из
последовательностей SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:
37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 или SEQ ID
Страница: 4
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
NO:53, пригодны в качестве зондов дл гибридизации. Специалисты в данной области
признают, что праймеры или зонды, имеющие нуклеотидную длину из примерно 18
нуклеотидов, обеспечивают высокую специфичность гибридизации с последовательностьюмишенью. Полный размер фрагмента, а также размер комплементарных участков, в
конечном итоге будет зависеть от предназначаемого применени конкретного сегмента
нуклеиновой кислоты. В воплощени х гибридизации, как правило, найдут применение
меньшие фрагменты, у которых длина комплементарной области может варьировать так,
например, в пределах примерно от 10, 18, 20 или 30 и до примерно 50, 60, 70, 80, 90
или 100 нуклеотидов или даже полного размера, соответственно комплементарным
последовательност м, которые подвергаютс детектированию.
В особо предпочтительных воплощени х праймеры будут состо ть из смежных
последовательностей из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID
NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 или SEQ
ID NO:53. В других предпочтительных воплощени х праймеры будут состо ть из смежных
последовательностей из генов ВМР-рецепторов (раскрыты у Dijke et al., 1993; Astrom et
al., 1999; Nohno et al., 1995, все включены здесь дл сведени ) или из св занных с
ВМР генов, таких как хордин (NCBI NM_029130), гремлин (Murphy et al., 1999; McMahon
et al., 2000), фоллистатин (NCBI NM_003892) или бамби (NCBI NM_005791). Наиболее
предпочтительно праймеры будут состо ть из смежной последовательности из SEQ ID NO:
3. В некоторых аспектах, по меньшей мере, некоторые из праймеров могут дополнительно
включать детектируемую метку.
В некоторых воплощени х изобретение обеспечивает способ лечени глаукомы
введением пациенту, нуждающиес в этом, композиции, содержащей последовательность,
состо щую, по меньшей мере, из одного соединени , выбранного из группы, состо щей из
агониста ВМР-2, агониста ВМР-4, агониста ВМР-5, агониста ВМР-7, агониста Smad 1/5,
антагониста хордина, антагониста гремлина и антагониста фоллистатина.
В дополнительных аспектах насто щее изобретение обеспечивает способ
идентификации терапевтического средства дл лечени глаукомы. Терапевтические
средства можно идентифицировать, например:
а) получением первой композиции, содержащей попул цию рекомбинантных клеток,
экспрессирующих ВМР-2А, ВМР-4, ВМР-5 или ВМР-7;
b) получением соединени -кандидата;
с) инкубацией указанной композиции и указанного соединени -кандидата;
тестированием указанной композиции на ее способность воздействовать на
индуцированные ВМР пути передачи сигнала с участием Smad и/или регулируемую ВМР
экспрессию гена; и идентификацией соединени -кандидата, которое ингибирует или
стимулирует данные эффекты в пр мом направлении ВМР.
Другим аспектом изобретени вл ютс диагностические наборы, содержащие
последовательности по насто щему изобретению и подход щие реагенты, такие как
детектируема метка, св занна с белком, пептидом или самим антителом. Альтернативно
детектируема метка может быть св зана со второй последовательностью, котора избирательно гибридизуетс с последовательностью по изобретению.
Близкие воплощени включают терапевтические наборы, которые содержат
фармацевтически приемлемые композиции либо последовательностей нуклеиновых
кислот, либо последовательностей пептидов или белков, раскрытых здесь. Подобные
наборы пригодны дл детектировани измененной экспрессии генов ВМР и белков в
клинических пробах дл диагностики глаукомы.
Краткое описание фигур
Фигуры составл ют часть насто щего описани и включены дл дополнительной
демонстрации некоторых аспектов насто щего изобретени . Изобретение можно лучше
пон ть при обращении к одной или более фигур в сочетании с подробным описанием
конкретных воплощений, представленных здесь.
Фиг.1. Нуклеотидна и аминокислотна последовательность ВМР-2А.
Страница: 5
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Фиг.2. Нуклеотидна и аминокислотна последовательность ВМР-4.
Фиг.3. Нуклеотидна и аминокислотна последовательность ВМР-5.
Фиг.4. Нуклеотидна и аминокислотна последовательность ВМР-7.
Фиг.5. Путь передачи сигнала с участием морфогенных белков кости. Димеры
морфогенных белков кости (ВМР) св зываютс с мембранным комплексом, состо щим из
ВМР-рецепторов 1 и 2, которые представл ют серин/треонинкиназы. Регул торные Smad
(Smad 1/Smad 5) фосфорилируютс и св зываютс с со-Smad (Smad 4). Данный
образующийс Smad-комплекс проникает в дро, где он св зываетс с факторами
транскрипции (TF) и регулирует экспрессию гена. Св занные с ВМР белки действуют в
качестве антагонистов ВМР, св зыва сь с ВМР и предупрежда взаимодействие ВМР с
ВМР-рецепторами.
Фиг.6. Экспресси ВМР в человеческих клетках и ткан х ТМ. Окрашенный бромистым
этидием агарозный гель продуктов ПЦР дл ВМР из проб кДНК, полученных при анализе
ОТ-ПЦР экспрессии ВМР в человеческих клетках (полосы 1-5) и ткан х (полосы 6-7) ТМ. L
= маркеры пар оснований. С = отрицательна контрольна полоса при ПЦР. ?-актин
использовали в качестве положительного внутреннего контрол при проведении ОТ-ПЦР.
Фиг.7. Экспресси ВМР-рецептора в человеческих клетках и ткан х ТМ. Окрашенный
бромистым этидием агарозный гель продуктов ПЦР из проб кДНК, полученных при анализе
ОТ-ПЦР экспрессии ВМР-рецепторов в человеческих клетках (полосы 1-5) и ткан х (полосы
6-7) ТМ. L = маркеры пар оснований. С = отрицательна контрольна полоса при
ПЦР. ?-актин использовали в качестве положительного внутреннего контрол при
проведении ОТ-ПЦР.
Фиг.8. Экспресси ВМР в человеческих астроцитах ONH, ткан х ONH и астроцитах мозга
человека. Окрашенный бромистым этидием агарозный гель продуктов ПЦР из проб кДНК,
полученных при анализе ОТ-ПЦР экспрессии ВМР в человеческих астроцитах ONH (полосы
1-5), ткан х ONH (полоса 6) и астроцитах мозга человека (полоса 7). L = маркеры пар
оснований. С = отрицательна контрольна полоса при ПЦР. ?-актин использовали в
качестве положительного внутреннего контрол при проведении ОТ-ПЦР.
Фиг.9. Экспресси ВМР в лини х человеческих клеток решетчатой полости склеры.
Окрашенный бромистым этидием агарозный гель продуктов ПЦР из проб кДНК, полученных
при анализе ОТ-ПЦР человеческих клеток решетчатой полости склеры (полосы 1-9). L =
маркеры пар оснований. С = отрицательна контрольна полоса при ПЦР. ? -актин
использовали в качестве положительного внутреннего контрол при проведении ОТ-ПЦР.
Фиг.10. Экспресси ВМР-рецептора в человеческих астроцитах ONH, ткан х ONH и
астроцитах мозга человека. Окрашенный бромистым этидием агарозный гель продуктов
ПЦР из проб кДНК, полученных при анализе ОТ-ПЦР экспрессии ВМР-рецепторов в
астроцитах головки зрительного нерва человека (ONA) (полосы 1-5), ткани ONH (полоса
6) и астроцитах мозга человека (полоса 7). L = маркеры пар оснований. С =
отрицательна контрольна полоса при ПЦР. ? -актин использовали в качестве
положительного внутреннего контрол при проведении ОТ-ПЦР.
Фиг.11. Экспресси ВМР-рецепторов в лини х человеческих клеток решетчатой полости
склеры. Окрашенный бромистым этидием агарозный гель продуктов ПЦР из проб кДНК,
полученных при анализе ОТ-ПЦР человеческих клеток решетчатой полости склеры (полосы
1-9). L = маркеры пар оснований. С = отрицательна контрольна полоса при ПЦР. ? -актин
использовали в качестве положительного внутреннего контрол при проведении ОТ-ПЦР.
Фиг.12. Вестерн-иммуноблоттинг экспрессии ВМР и ВМР-рецепторов в
культивированных человеческих клетках ТМ, астроцитах головки зрительного нерва (ONA)
и клетках решетчатой полости склеры. Хемилюминесцентное детектирование ВМР-белков
и ВМР-рецепторов в человеческих клетках трабекул рной сети (полосы 1-2), астроцитах
ONH (полосы 3-4) и клетках решетчатой полости склеры (полосы 5-6). Масса белков
указана в kDa.
Фиг.13. Экспресси мРНК св занных с ВМР белков в человеческих клетках ТМ.
Окрашенный бромистым этидием агарозный гель продуктов ПЦР из проб кДНК, полученных
Страница: 6
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
при анализе ОТ-ПЦР человеческих клеток ТМ (полосы 1-5). L = маркеры пар оснований.
С = отрицательна контрольна полоса при ПЦР. ?-актин использовали в качестве
положительного внутреннего контрол при проведении ОТ-ПЦР.
Фиг.14. Экспресси мРНК св занных с ВМР белков в человеческих клетках решетчатой
полости склеры и астроцитах ONH. Окрашенный бромистым этидием агарозный гель
продуктов ПЦР из проб кДНК, полученных при анализе ОТ-ПЦР клеток решетчатой полости
склеры (LC) (полосы 1-7) и астроцитов ONH (полосы 8-11). L = маркеры пар оснований. С
= отрицательна контрольна полоса при ПЦР. ? -актин использовали в качестве
положительного внутреннего контрол при проведении ОТ-ПЦР.
Фиг.15. Иллюстраци повышенной экспрессии антагониста ВМР гремлина (CКTSF1B1) в
клетках ТМ при глаукоме. Экспрессию гена оценивали с использованием совокупности
генов Affymetrix (генный чип U133А Affymetrix).
Подробное описание предпочтительных воплощений
Было высказано предположение, что трабекул рна сеть играет важную роль в
движении глазной жидкости в норме, и полагаетс , что она представл ет основное место
сопротивлени оттоку в глазе при глаукоме. Клетки трабекул рной сети человека (НТМ)
вл ютс специализированными клетками, которые образуют каналы дл оттока, по
которым глазна жидкость выходит из глаза. Измененна синтетическа функци клеток
может участвовать в патогенезе POAG, стероидной глаукомы и других типов глаукомы.
Несмотр на годы интенсивных исследований, точный молекул рный механизм,
ответственный за повреждени глаза, возникающие в результате глаукомы, остаетс неизвестным. В результате недавно проведенных исследований было высказано
предположение, что факторы роста могут быть важными в поддержании нормального
гомеостаза в ткан х глаза, св занных с развитием глаукомы, и изменени факторов
роста/рецепторов факторов роста могут играть роль в патогенезе глаукомы. Факторы
роста представл ют очень большое семейство полипептидов, которые регулируют рост и
дифференциацию клеток. Данные молекулы обладают различными специфичными дл клеток эффектами в отношении экспрессии генов, состава и отложени внеклеточного
матрикса, организации цитоскелета и регул ции функции клеток. ТМ экспрессирует
широкий р д факторов роста, рецепторов факторов роста (Tripathi et al., 1993a;
Tripathi et al., 1993b; Tripathi et al., 1994a; Tripathi et al., 1994b; Wordinger et
al., 1998; Wordinger et al., 1999), а также нейротрофинов/нейротрофических факторов и
их рецепторов (Liu et al., 2001; Wordinger et al., 2000). Астроциты ONH и клетки
решетчатой полости склеры, два типа клеток головки зрительного нерва, экспрессируют
факторы роста, нейротрофины и их рецепторы (Lambert et al., 2001; Pena et al., 1999).
Глазна жидкость также содержит различные факторы роста, включа FGF2, EGF, TGF?,
HGH (Tripathi et al., 1996; Tripathi et al., 1991; Tripathi et al., 1992; Hu and
Ritch, 2001), а также нейротрофины (Chundru et al., 2000). Сообщалось о повышенном
уровне TGF? -2 и HGF в глазной жидкости пациентов с POAG (Tripathi et al., 1994c;
Inatani et al., 2001; Picht et al., 2001). Факторы роста могут участвовать в развитии
глаукомы, измен нормальное развитие и/или функцию ТМ и ONH.
Насто щее изобретение частично происходит из представлений о том, что морфогенные
белки кости (ВМР) индуцируют образование не только кости и хр ща, но вл ютс многофункциональными цитокинами, оказывающими широкий р д воздействий на
многочисленные типы клеток (Hogan, 1996; Reddi, 1997), и экспрессируютс как клетками
трабекул рной сети (НТМ), так и головки зрительного нерва (ONH) человека (Wordinger
et al., 2002). ВМР вл ютс членами суперсемейства TGF? , и у человека имеетс примерно 15-20 генов ВМР, 3 ВМР-рецептора и р д св занных с ВМР белков, которые
функционируют в качестве антагонистов ВМР (Yamashita et al., 1996). ВМР передают
сигнал через рецепторный комплекс, состо щий из BMPR-I и BMPR-II. Сообщалось, что
члены суперсемейства TGF? и TGF? R (Agarwal et al., 1997; Lambert et al., 1997) и
GDNF и GDNFR (Wordinger et al., 1999; Liu et al., 1999) экспрессируютс как клетками
НТМ, так и ONH.
Страница: 7
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
ВМР и ВМР-рецепторы экспрессируютс в ткан х глаза (Obata et al., 1999; You et al.,
1999), но предшествующие сообщени в основном касались развити глаза. Функци ВМР
вл етс важной дл развити глаза, поскольку направленный разрыв генов, кодирующих
ВМР у мышей, приводит к т желым дефектам развити в сетчатке и хрусталике (Jena et
al., 1997; Luo et al., 1995; Dudley et al., 1995). ВМР-2, ВМР-4 и ВМР-7 принимают
участие в развитии хрусталика и сетчатки (Jena et al., 1997; Furuta and Hogan, 1998;
Reddi, 2000; Trousse et al., 2001). Оказалось, что ВМР-6 и ВМР-7 играют роль в защите
нейронов от повреждени в результате гипогликемии или ишемии (Nonner et al., 2001;
Liu et al., 2001), и было показано, что ВМР-2 повышает экспрессию нейротрофина в
ганглиозных клетках (Zhang et al., 1998). Гетерозиготные "нокаутные" мыши с
гаплонедостаточностью по Bmp4 имеют зрительные фенотипы, включающие дисгенез
переднего сегмента, повышенное IOP и аномалии зрительного нерва (Chang et al., 2001).
Имеетс очень ограниченна опубликованна информаци , касающа с роли ВМР дл глаза человека в постнатальном периоде.
Mohan и коллеги (1998) сообщали, что ВМР-2-, ВМР-4- и ВМР-рецепторы
экспрессировались в клетках роговицы взрослого человека, и предположили, что в
функции ВМР может входить воздействие на пролиферацию и апоптоз кератоцитов
роговицы. You и коллеги (1999) подтвердили результаты данного исследовани и также
сообщили об экспрессии ВМР-3, ВМР-5 и ВМР-7 в услови х ex vivo и культивированных
клетках эпители роговицы и стромы. Они сообщили, что уровень транскрипции ВМР был
выше в строме, в то врем как уровень рецепторов был выше в культивированных
эпителиальных клетках роговицы.
С использованием ОТ-ПЦР авторы насто щего изобретени вы вили мРНК ВМР, ВМРрецепторов BMPR-IА, BMPR-IВ и BMPR-II, а также св занных с ВМР белков гремлина,
хордина, фоллистатина и бамби в НТМ, решетчатой полости склеры (LC) и клеточных
лини х астроцитов и ткан х ONH (Wordinger et al., 2002). Кроме того, авторы
насто щего изобретени обнаружили, что клетки НТМ и ONH экспрессируют белки ВМР-2,
ВМР-4, ВМР-5 и ВМР-7.
Глаукому можно будет диагностировать по обнаружению генетических изменений в
генах членов сигнального семейства ВМР. В том смысле, в котором они здесь
используютс , выражени "ген, член семейства морфогенных белков кости" и "сигнальное
семейство ВМР" относитс к ВМР, ВМР-рецепторам и св занным белкам. Термин
"генетические изменени " хорошо известен специалистам в данной области. Существуют
многочисленные примеры заболеваний, св занных с генетическими изменени ми в
определенных генах (см. примеры у Cummings, 1997; Strachan et al., 1996; Jorde et
al., 1999). Генетические изменени в конкретном гене (например, ВМР) можно определить
с использованием различных методов, хорошо известных специалистам в данной области,
таких как SSCP, DGGE, ASO, RFLP, гетеродуплексный анализ, CCM, PTT и расщепление
РНКазой (см. Birren et al., 1998).
Глаукома может быть вызвана измененной экспрессией одного или более генов
семейства ВМР в глазе, что приводит к повышенному IOP и/или нейропатии зрительного
нерва при глаукоме. "Измененна экспресси гена ВМР" означает экспрессию продукта
данного гена, котора отличаетс от таковой в норме. Термин может также относитс к
изменени м в последовательности гена или белка. Ген ВМР в норме был хорошо
охарактеризован (см. выше), и сообщалось об экспрессии ВМР в различных ткан х,
включа ТМ и ONH. Генетические изменени в кодирующей области генов семейства ВМР
могут измен ть функцию данных белков. Генетические изменени вне кодирующей области
также могут привести к глаукоме.
Специалистам в данной области хорошо известно, что "изменени вне" кодирующей
области конкретного гена вл ютс важными дл регул ции экспрессии гена. Например,
известно, что область выше (5') кодирующей области большинства генов служит в
качестве промоторной области, котора "способствует" и регулирует экспрессию данного
гена. Промоторна область содержит многочисленные нуклеотидные последовательности,
Страница: 8
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
распознаваемые различными факторами транскрипции и ДНК-св зывающими белками,
которые ответственны за активацию или подавление экспрессии гена. Нижние области (3')
гена могут также определ ть полиаденилирование продукта гена, тем самым регулиру процессинг РНК и трансл цию продукта гена.
Измененную экспрессию генов ВМР или мутации в последовательности генов, котора указывает на наличие глаукомы, можно детектировать с использованием методов, хорошо
известных специалистам в данной области. Например, предусматриваетс , что можно
использовать фрагмент нуклеиновой кислоты практически любой длины, при полной длине
предпочтительно ограничивать простотой получени и применени в предназначенном
протоколе. Последовательности нуклеиновой кислоты, раскрытые здесь, могут также
примен тьс в качестве зондов или праймеров в воплощени х гибридизации нуклеиновых
кислот. Если это так, то предполагаетс , что сегменты нуклеиновой кислоты, которые
включают область последовательности, состо щей из последовательности, по меньшей
мере, из 14 смежных нуклеотидов, котора имеет ту же последовательность, или
комплементарную последовательность из 14 смежных нуклеотидов ВМР-2А (SEQ ID NO:1),
ВМР-4 (SEQ ID NO:3), ВМР-5 (SEQ ID NO:5), ВМР-7 (SEQ ID NO:7), ВМР-RIA (SEQ ID NO:
37), ВМР-RIB (SEQ ID NO:39), ВМР-RII (SEQ ID NO:41), хордина (SEQ ID NO:43), гремлина
(SEQ ID NO:45), фоллистатина (SEQ ID NO:47) или бамби (SEQ ID NO:53), будет иметь
особую применимость. Также в некоторых воплощени х можно использовать смежные
идентичные или комплементарные последовательности большей длины, например,
примерно из 20, 30, 40, 50, 100, 200, 500, 1000 нуклеотидов (включа все
последовательности с промежуточными длинами) и вплоть до полноразмерных
последовательностей примерно из 1547 нуклеотидов (дл ВМР-2А), 1946 нуклеотидов (дл ВМР-4), 2153 нуклеотидов (дл ВМР-5) и 1878 нуклеотидов (дл ВМР-7), 2932 нуклеотидов
(дл ВМР-RIA), 2032 нуклеотидов (дл ВМР-RIB), 3611 нуклеотидов (дл ВМР-RII), 3561
(дл хордина), 4049 нуклеотидов (дл гремлина), 1386 нуклеотидов (дл фоллистатина) и
1523 нуклеотидов (дл бамби).
Легко пон ть, что "последовательности с промежуточными длинами" в данном контексте
означают любую длину между указанными пределами, такую как 14, 15, 16, 17, 18, 19, 20
и т.д.; 21, 22, 23 и т.д., 30, 31, 32 и т.д., 50, 51, 52, 53 и т.д., 100, 101, 102,
103 и т.д., 150, 151, 152, 153 и т.д., включа все целые числа в пределах 200-500,
500-1000, 1000-2000, до и включа последовательности из 2001, 2002, 2050, 2051
нуклеотидов и тому подобное.
Способность таких нуклеотидных зондов и праймеров специфически гибридизоватьс с
кодирующими последовательност ми ВМР и праймерами дл специфической
амплификации последовательностей ВМР позволит использовать их дл детектировани наличи комплементарных последовательностей в данной пробе. Однако
предусматриваютс другие применени , включа применение информации по
секвенированию дл получени праймеров мутантных видов или праймеров дл получени других генетических конструкций.
Молекулы нуклеиновой кислоты, имеющие области последовательности, состо щие из
участков смежных нуклеотидов длиной 10, 20, 30, 50 и даже 100-200 нуклеотидов или так
далее, идентичные или комплементарные последовательност м ВМР-2А (SEQ ID NO:1),
ВМР-4 (SEQ ID NO:3), ВМР-5 (SEQ ID NO:5), ВМР-7 (SEQ ID NO:7), ВМР-RIA (SEQ ID NO:
37), ВМР-RIB (SEQ ID NO:39), ВМР-RII (SEQ ID NO:41), хордина (SEQ ID NO:43), гремлина
(SEQ ID NO:45), фоллистатина (SEQ ID NO:47) или бамби (SEQ ID NO:53), особенно
пригодны дл использовани в качестве зондов дл гибридизации, например, при оценке
SNP и в тестах гибридизации на твердой фазе, в дополнение к саузерн- и нозернблоттингу. Это позволит проводить анализ структурных и регул торных генов ВМР в
ткан х и клетках. Полный размер фрагмента, а также размер комплементарного
участка(ов), в конечном итоге будет зависеть от предназначаемого применени конкретного сегмента нуклеиновой кислоты. Меньшие фрагменты, как правило, будут
примен тьс при гибридизации, когда длина смежной комплементарной области может
Страница: 9
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
варьировать, например, в пределах примерно от 10 до примерно 100 нуклеотидов, но
можно использовать более крупные смежные комплементарные участки вплоть до
примерно 1547 нуклеотидов (дл ВМР-2А), 1946 нуклеотидов (дл ВМР-4), 2153
нуклеотидов (дл ВМР-5) и 1878 нуклеотидов (дл ВМР-7), 2932 нуклеотидов (дл ВМРRIA), 2032 нуклеотидов (дл ВМР-RIB), 3611 нуклеотидов (дл ВМР-RII), 3561 (дл хордина), 4049 нуклеотидов (дл гремлина), 1386 нуклеотидов (дл фоллистатина) и 1523
нуклеотидов (дл бамби) нуклеотидов, соответственно длине комплементарных
последовательностей, которые желательно детектировать.
При применении зонда дл гибридизации длиной примерно 10-14 нуклеотидов
образуетс дуплексна молекула, котора одновременно вл етс стабильной и
избирательной. Молекулы, имеющие смежные комплементарные последовательности к
участкам длиной более 10 оснований, в основном вл ютс предпочтительными, хот дл повышени стабильности и избирательности гибрида, и тем самым дл улучшени качества и степени получаемых конкретных гибридных молекул, как правило,
предпочтительно конструировать молекулы нуклеиновых кислот, имеющих
комплементарные участки дл генов, состо щих из 15-20 смежных нуклеотидов или, при
необходимости, длиннее.
Зонды дл гибридизации можно выбрать из любого участка любой последовательности,
раскрытой здесь. Все, что требуетс , это проанализировать представленные
последовательности SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37,
SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 или SEQ ID NO:
53 и выбрать любой смежный участок последовательности длиной примерно от 10
нуклеотидов и вплоть до полноразмерной последовательности, который желательно
использовать в качестве зонда или праймера. При выборе последовательностей зонда и
праймера можно руководствоватьс различными факторами, только в качестве примера,
например, желательно ли использовать праймеры к концам целой последовательности или
от концов функциональных кодирующих домен последовательностей, дл последующей
амплификации ДНК.
Способ отбора и получени сегмента нуклеиновой кислоты, который включает смежную
последовательность из последовательностей ВМР-2А (SEQ ID NO:1), ВМР-4 (SEQ ID NO:3),
ВМР-5 (SEQ ID NO:5), ВМР-7 (SEQ ID NO:7), ВМР-RIA (SEQ ID NO:37), ВМР-RIB (SEQ ID
NO:39), ВМР-RII (SEQ ID NO:41), хордина (SEQ ID NO:43), гремлина (SEQ ID NO:45),
фоллистатина (SEQ ID NO:47) или бамби (SEQ ID NO:53), альтернативно может быть
определен как получение фрагмента нуклеиновой кислоты. Конечно, фрагменты также
можно получить другими методами, такими как, например, механическое
гидродинамическое фрагментирование ДНК или расщепление рестриктазой. Небольшие
сегменты или фрагменты нуклеиновой кислоты можно легко получить, например, пр мым
синтезом фрагмента химическими методами, как это широко распространено на практике с
использованием автоматического синтезатора олигонуклеотидов. Кроме того, фрагменты
можно получить применением методов репродукции нуклеиновой кислоты, такой как
технологи ПЦР ? согласно патенту США № 4683202 и патенту США № 4682195 (каждый
включен здесь дл сведени ), введением отобранных последовательностей в
рекомбинантные векторы дл рекомбинантной продукции, и другими методами
рекомбинантной ДНК, хорошо известными специалистам в области молекул рной
биологии.
Следовательно, нуклеотидные последовательности по изобретению можно
использовать по их способности к селективному образованию дуплексных молекул с
комплементарными участками генов или кДНК ВМР. В зависимости от предполагаемого
подхода будет желательно использовать различные степени избирательности
гибридизации дл достижени различной степени избирательности зонда относительно
последовательности-мишени. Дл применений, где требуетс высока избирательность,
как правило, желательно использовать относительно жесткие услови дл образовани гибридов, например, следует выбрать услови с относительно низкой концентрацией соли
Страница: 10
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
и/или высокой температурой, такие как обеспечиваютс при использовании 0,02-0,15 М
NaCl при температуре 50-70°С. В подобных услови х имеетс небольша , если вообще
такова существует, веро тность ошибочного спаривани зонда и матрицы или цепимишени, и они особенно подход т дл исследовани генов ВМР.
Конечно, дл некоторых применений, например, когда желательно получить или
идентифицировать мутанты с использованием цепи мутантного праймера,
гибридизованного с лежащей в основе матрицей, или когда необходимо выделить
кодирующие последовательности ВМР из близких видов, функциональных эквивалентных
вариантов и тому подобное, как правило, требуютс менее жесткие услови гибридизации
дл образовани гетеродуплекса. В данных обсто тельствах может быть желательным
использовать такие услови , как концентраци соли 0,15-1,0 М при температуре в
пределах примерно от 20 до 55°С. Тем самым можно легко идентифицировать
перекрестно-гибридизующиес виды в качестве положительно гибридизующихс сигналов
по отношению к контрольной гибридизации. В любом случае в целом предусматриваетс ,
что услови можно сделать более жесткими при снижении концентрации NaCl или
добавлении возрастающих количеств формамида, который служит дл дестабилизации
гибридного дуплекса так же, как повышенна температура. Таким образом, можно легко
манипулировать услови ми гибридизации, и, таким образом, имеетс метод выбора в
зависимости от желаемых результатов.
В некоторых воплощени х будет преимущественным использовать последовательности
нуклеиновых кислот по насто щему изобретению в сочетании с подход щими средствами,
такими как метка, дл определени результатов гибридизации. В данной области известны
самые различные соответствующие индикаторные средства, включа флуоресцентные,
радиоизотопные, ферментативные или другие лиганды, такие как авидин/биотин, которые
способны воспроизводить детектируемый сигнал. В предпочтительных воплощени х
желательно использовать флуоресцентную метку или ферментативную метку, такую как
уреаза, щелочна фосфатаза или пероксидаза, вместо радиоактивного или других
нежелательных дл окружающей среды реагентов. В случае ферментативных меток
известны индикаторные субстраты дл колориметрии, которые можно использовать дл обеспечени средств, видимых человеческому глазу или обнаруживаемых при
спектрофотометрии, дл идентификации специфической гибридизации с пробами,
содержащими комплементарные нуклеиновые кислоты.
В общем предусматриваетс , что зонды дл гибридизации, описанные здесь, будут
пригодными в качестве реагентов как дл гибридизации в растворе, так и в воплощени х
с использованием твердой фазы. В воплощени х с твердой фазой анализируема ДНК (или
РНК) адсорбируетс или фиксируетс иначе на выбранном матриксе или поверхности.
Затем данную фиксированную одноцепочечную нуклеиновую кислоту подвергают
специфической гибридизации с отобранными зондами в желаемых услови х. Выбранные
услови будут зависеть от конкретных обсто тельств, основанных на конкретных
требуемых критери х (в зависимости, например, от содержани G+C, типа нуклеиновой
кислоты-мишени, источника нуклеиновой кислоты, размера зонда дл гибридизации и
т.д.). После промывани гибридизованной поверхности дл удалени неспецифически
св занных молекул зонда, провод т детектирование специфической гибридизации или
даже количественное определение, с помощью метки.
Также следует понимать, что данное изобретение не ограничиваетс конкретными
нуклеотидными и аминокислотными последовательност ми ВМР-2А (SEQ ID NO:1), ВМР-4
(SEQ ID NO:3), ВМР-5 (SEQ ID NO:5), ВМР-7 (SEQ ID NO:7), ВМР-RIA (SEQ ID NO:37), ВМРRIB (SEQ ID NO:39), ВМР-RII (SEQ ID NO:41), хордина (SEQ ID NO:43), гремлина (SEQ ID
NO:45), фоллистатина (SEQ ID NO:47) или бамби (SEQ ID NO:53). Так, рекомбинантные
векторы и выделенные сегменты ДНК могут включать кодирующие области ВМР сами по
себе, "верхние" или "нижние" гены, кодирующие области, несущие выбранные изменени или модификации основной кодирующей области, или они могут кодировать более крупные
полипептиды, которые, тем не менее, включают кодирующие области ВМР, или могут
Страница: 11
RU 2 336 902 C2
5
10
15
20
25
кодировать биологически эквивалентные функциональные белки или полипептиды,
имеющие вариантные аминокислотные последовательности.
Сегменты ДНК по насто щему изобретению включают биологически эквивалентные
функциональные белки и полипептиды ВМР. Данные последовательности можно получить
в результате избыточности кодона и функциональной эквивалентности, которые, как
известно, имеют место в естественных услови х в последовательност х нуклеиновой
кислоты и белках, их кодируемых. Альтернативно, функционально эквивалентные белки
или полипептиды можно получить с помощью применени технологии рекомбинантной
ДНК, с помощью которой можно воспроизвести изменени в структуре белка, основанные с
учетом свойств аминокислот, которые подвергаютс замене. Сконструированные
человеком изменени можно ввести с помощью методов сайт-направленного мутагенеза,
например, дл повышени антигенных свойств белка или тестировани мутантов ВМР дл исследовани св зывающей активности на молекул рном уровне.
Терапевтическое средство дл лечени глаукомы может быть пептидом или белком,
пептидомиметиком, олигонуклеотидом или дериватизированным олигонуклеотидом, или
небольшой подобной лекарственному препарату молекулой, которые воздействуют на одну
или более сторон зрительных путей с участием ВМР. Предпочтительными
терапевтическими средствами вл ютс : (1) агонисты ВМР-2, ВМР-4, ВМР-5 или ВМР-7; (2)
антагонисты хордина, гремлина, фоллистатина или бамби; и/или (3) агонисты Smad1,
Smad5 и/или Smad4.
Средство можно непосредственно вводить в глаз (например, в виде глазных капель или
мазей дл местного применени ; с помощью устройств с замедленным высвобождением в
слепой мешок или имплантированных около склеры или внутри глаза; посредством
периокул рной, конъюнктивальной, в теноновую фасцию, в камеру или в стекловидное тело
инъекций) или парентерально (например, перорально, с помощью внутривенной,
подкожной или внутримышечной инъекций; через кожу и т.д.) с использованием методов,
хорошо известных в данной области. Последующее представл ет примеры возможных
композиций, воплощенных данным изобретением.
(а) Глазна композици дл местного применени вес.%
30
35
Средство, повышающее экспрессию ВМР-4 в глазе 0,01-2
НРМС
0,5
Хлорид натри 0,8
ВАС
0,01
ЭДТА
0,01
NaOH/HCl
до рН 7,4
Очищенна вода
до 100 мл
(b) Глазна композици дл местного применени вес.%
40
45
50
Антагонист гремлина
0,01-2
НРМС
0,5
Хлорид натри 0,8
ВАС
0,01
ЭДТА
0,01
NaOH/HCl
до рН 7,4
Очищенна вода
до 100 мл
(с) Глазна композици дл местного применени вес.%
Агонист Smad 1/5
0,01-2
НРМС
0,5
Хлорид натри 0,8
ВАС
0,01
ЭДТА
0,01
NaOH/HCl
до рН 7,2
Очищенна вода
до 100 мл
Дополнительно предусматриваетс , что соединени по изобретению можно приготовить
в виде устройств дл внутриглазной доставки.
А. Анализ терапевтических средств
Данное изобретение также пригодно дл обнаружени новых терапевтических средств
Страница: 12
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
против глаукомы, которые принимают участие в пут х передачи сигналов с ВМР (см.
фиг.5). Избирательные лиганды ВМР св зываютс с ВМР-рецепторами
серин/треонинкиназами типа I и типа II (ВМР-RI и ВМР-RII) и передают сигнал через
Smad-белки. Сигнал ВМР распростран етс Smad через белок-белковые и белок-ДНК
взаимодействи (Attisano and Tuen Lee-Hoeflich, 2001). Регул торные белки Smad1 и
Smad5 активируютс (посредством фосфорилировани ) св занными с лигандом ВМРрецепторами (Bubnoff and Cho, 2001). Затем данные регул торные белки Smad
взаимодействуют с Smad4 с образованием гетеромерного комплекса, который
перемещаетс в дро. Данный комплекс способен активировать или подавл ть
транскрипцию избирательных генов, которые распознают данный транскрипционный
комплекс в зависимости от того, какие дерные кофакторы присутствуют.
Путь передачи сигналов с участием ВМР/Smad отрицательно регулируетс несколькими
механизмами. Некоторые ВМР-св зывающие белки (такие как гремлин, BABMI или
фоллистатин) св зывают ВМР и подавл ют их взаимодействие с ВМР-рецепторами. Кроме
того, имеютс ингибирующие Smad-белки (например, Smad6 и Smad7), которые
св зываютс и инактивируют ВМР-рецепторы (Kowabata et al., 1998; Itoh et al., 2000;
Miyazono, 2000). Авторы насто щего изобретени установили, что человеческие клетки
ТМ, астроциты ONH и клетки решетчатой полости склеры экспрессируют мРНК и белок дл рецепторного комплекса ВМР. Таким образом, данные клетки могут давать ответную
реакцию на эндогенные лиганды ВМР.
Дл обнаружени новых терапевтических средств против глаукомы можно использовать
различные методы, и данные методы хорошо известны специалистам в данной области.
Например, средства на основе пептидов или пептидомиметиков, которые действуют в
качестве агонистов или ингибиторов ВМР, можно установить с помощью молекул рного
моделировани ВМР/ВМР-рцепторных структур (Nickel et al., 2001). Передача сигнала с
участием ВМР включает избирательные группы Smad-белков (Kawabata et al., 1998; Itoh
et al., 2000; Attiseno et al., 2000). Избирательные агонисты ВМР и агонисты Smad
можно обнаружить с использованием клеточных тестов. Тестируема клетка должна
экспрессировать соответствующие ВМР-рецептор(ы) и располагать соответствующим
путем передачи сигнала с участием ВМР. Поскольку основными эффектами передачи
сигнала ВМР вл етс изменение экспрессии гена, агонисты ВМР и агонисты Smad можно
обнаружить при скрининге ВМР-индуцированных генов. Индукцию регулируемых ВМР генов
также можно измерить путем количественного определени уровней мРНК с
использованием количественной ОТ-ПЦР (Wang et al., 2001), микросовокупностей ДНК или
конструкций репортерного гена. Имеютс природные ингибиторы передачи сигнала с
участием ВМР, ВМР-св зывающие белки (известные как св занные с ВМР белки) такие, как
хордин, гремлин и фоллистатин. Антагонисты ингибиторов белков можно обнаружить с
использованием тестов св зывани лиганда. Например, анализируемые агенты можно
добавить к рекомбинантному очищенному гремлину, и идентифицировать те агенты,
которые будут св зыватьс с гремлином, с использованием различных методов, известных
специалистам в данной области. Дл определени того, вл ютс ли данные агенты
антагонистами гремлина, используют клеточный тест, аналогичный описанному выше.
Предполагаетс , что в сочетании с насто щим изобретением можно использовать
любую известную модель скрининга in vitro и in vivo дл идентификации новых
лекарственных средств против глаукомы, обладающих воздействием на семейство генов
ВМР. Подобные модели хорошо известны специалистам в данной области и их постановка
на практике вл етс общеприн той. Небольшие пептиды или пептидомиметиков можно
сконструировать, основыва сь на представлени х о структуре/функции ВМР, BMPR и/или
продуктов гена, св зывающихс с ВМР белков. Можно использовать тесты св зывани лиганда дл детектировани небольших молекул, которые св зываютс с ВМР, BMPR или
белками, св зывающимис с ВМР. При постановке клеточных тестов можно обнаружить
действие различных агентов на пути передачи сигнала с участием ВМР. Можно получить
клеточные линии "нокин", включающие промоторы генов семейства ВМР, св занные с
Страница: 13
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
репортерным геном, дл обнаружени средств, которые измен ют экспрессию члена
семейства генов ВМР. Данные тесты можно использовать дл идентификации как молекул
агонистов, так и антагонистов. Тесты ex vivo такие, как культивирование передних
сегментов человеческого глаза при перфузии (Clark et al., 1995a; Pang et al., 2000),
можно использовать дл исследовани эффектов средств на IOP и передачу сигнала с
участием ВМР в ткани ТМ. Можно создать модели глаукомы на грызунах с использованием
хорошо известных методов дл создани стабильных трансгенных с членом семейства
ВМР, без "нокаутных" или "нокиновых" штаммов мышей и крыс. Данные модели на
грызунах можно использовать дл скрининга средств, которые измен ют
глаукомоподобный фенотип(ы) (например, с помощью тонометрии определ ют
воздействие на IOP, с помощью гистологии оценивают воздействие на нейрологию зрени при глаукоме).
В. Наборы
Насто щее изобретение обеспечивает способы, композиции и наборы дл раннего
обнаружени глаукомы. Наборы могут включать сегмент нуклеиновой кислоты, кодирующей
полипептид или белок ВМР. Набор может дополнительно включать реагенты дл детектировани взаимодействи между пробой и нуклеиновой кислотой или пептидом по
насто щему изобретению. Обеспеченный реагент может включать радиоизотопную,
флуоресцентную или ферментативную метку. Набор может содержать известный меченый
радиоизотопом агент, способный св зыватьс или взаимодействовать с нуклеиновой
кислотой или пептидом, или белком по насто щему изобретению.
Реагент набора может быть обеспечен в виде жидкого раствора, св занным с твердой
подложкой или в виде сухого порошка. Предпочтительно, когда реагент обеспечиваетс в
виде жидкого раствора, в этом случае жидкий раствор представл ет собой водный
раствор. Предпочтительно, когда обеспеченный реагент св зан с твердой подложкой, в
этом случае тверда подложка может быть средой дл хроматографии, аналитическим
планшетом, имеющим множество лунок, или микроскопическим стеклом. Когда
обеспеченный реагент представл ет собой сухой порошок, то порошок можно восстановить
добавлением подход щего растворител , который также может находитьс в наборе.
В еще дополнительных воплощени х насто щее изобретение касаетс способов
диагностики и св занных наборов дл диагностики глаукомы. Предполагаетс , что
св занные с ВМР пептиды и нуклеиновые кислоты по изобретению можно использовать
дл детектировани полиморфизма или мутаций в нуклеиновых кислотах ВМР из проб
пациентов. В основном данные способы будут включать в начале получение пробы с
подозрением на присутствие полиморфизма или мутации, контактирование пробы с
пептидом или нуклеиновой кислотой по насто щему изобретению в услови х, эффективных
дл образовани комплекса и затем детектирование присутстви комплекса.
В основном детектирование образовани комплекса довольно хорошо известно в данной
области и его можно проводить при использовании различных подходов. Например,
насто щее изобретение предусматривает применение ELISA, RIA, методов непр мой
флуоресценции и тому подобное. Обычно образование комплекса будет детектироватьс при использовании метки, такой как радиоактивна метка или ферментативна метка
(така как щелочна фосфатаза, пероксидаза хрена и тому подобное). Конечно, можно
найти дополнительные преимущества при использовании вторично св зывающегос лиганда.
Последующие примеры представл ют методы, использованные авторами изобретени дл осуществлени аспектов насто щего изобретени . Несмотр на то, что данные методы
представл ют примеры предпочтительных воплощений на практике изобретени ,
специалисты в данной области в свете насто щего описани должны понимать, что можно
сделать многочисленные модификации, не отступа от сущности и предполагаемого
объема изобретени .
Пример 1
Культура клеток: человеческие клетки ТМ и клетки ONH получали из глаза доноров, как
Страница: 14
RU 2 336 902 C2
5
10
15
20
25
30
35
40
описано (Steely et al., 1992; Steely et al., 2000; Wilson et al., 1993; Clark et al.,
1994; Clark et al., 1995b; Clark et al., 1995c; Clark et al., 1996; Clark et al.,
2001a; Clark et al., 2001b; Dickerson et al., 1998; Wordinger et al., 1998; Wordinger
et al., 1999; Wordinger et al., 2000; Wordinger et al., 2002; Lambert et al., 2001;
Agarwal et al., 1999; Liu et al., 2001). Клетки ТМ культивировали из эксплантатов ТМ
от доноров в возрасте от 6 дней до 90 лет. Астроциты головки зрительного нерва и
клетки решетчатой полости склеры (LC) человека получали из аккуратно
отпрепарированных головок оптического нерва (доноры в возрасте от 2 дней до 90 лет) и
охарактеризовали, как описано ранее (Lambert et al., 2001; Clark et al., 1995a).
Клетки культивировали до сли ни в следующей среде: среда Хэма F10 (JRH Biosciences,
Lenexa, KS), содержаща 10% фетальной бычьей сыворотки (FBS) (HyClone, Logan, UT) и
антибиотики (Gibco BRL-Life Technologies, Grand Island, NY) дл клеток ТМ;
модифицированна по Дульбекко среда Игла (DMEM, HyClone), содержаща 10% FBS дл клеток LC; и среда дл культивировани астроцитов (AGM, Clonetics, San Diego, CA),
содержаща 5% FBS дл астроцитов ONH.
ОТ-ПЦР: ткани ТМ и ONH также иссекали из глаза доноров (Wordinger et al., 1998;
Wang et al., 2001). Общую фракцию РНК выдел ли из клеток и тканей ТМ и ONH с
использованием экстракции TRIzol (Gibco BRL-Life Technologies) и кДНК получали
обратной транскрипцией с использованием обычных методов (Wordinger et al., 1998;
Wordinger et al., 1999; Wordinger et al., 2000; Wordinger et al., 2002). Праймеры дл ПЦР конструировали с использованием программного обеспечени Oligos 4,0 (см. пары
праймеров в таблице 1). Все пары праймеров конструировали таким образом, что в
результате амплификации потенциально загр зненных последовательностей геномной
ДНК получали продукты ПЦР, мРНК, которые были значительно больше, чем
предполагалось, поскольку интронные последовательности, которые вырезали во врем процессинга РНК, включались в геномную ДНК. Праймеры ПЦР ?-актина
AGGCCAACCGCGAGAAGATGACC (верхние) и GAAGTCCAGGGCGACGTAGCAC (нижние)
при температуре отжига 55°С давали продукт ПЦР размером 350 п.н.
Реакцию ПЦР проводили как описано (Wordinger et al., 1998; Wordinger et al., 1999;
Wordinger et al., 2000; Lambert et al., 2001; Wordinger et al., 2002) с
использованием Taq Start Antibody Hot Start при следующих услови х циклов: 2 минуты
при 94°С, 2 минуты при 92°С и 40 циклов в течение 30 секунд при оптимальной
температуре отжига, удлинени в течение 90 секунд при 72°С и денатураци в течение 45
секунд при 92°С. Амплифицированные продукты ПЦР анализировали горизонтальным
электрофорезом в 1,5% агарозном геле. Дл обеспечени специфичности продуктов ОТПЦР проводили саузерн-блоттинг с зондами, сконструированными с использованием Oligo
4.0, которые гибридизовали с областью в амплифицированном продукте ПЦР. Продукты
ПЦР секвенировали дл подтверждени специфичности реакции ПЦР. В таблице 2
представлены члены семейства ВМР, которые экспрессируютс в ТМ и ONH человека.
45
50
Страница: 15
RU 2 336 902 C2
5
10
15
20
25
30
35
40
Таблица 2
Члены семейства ВМР, экспрессированные в ТМ и ONH человека
Член семейства ВМР Трабекул рна сеть Головка зрительного нерва
45
50
BMP-2
+
+
BMP-4
+
+
BMP-5
+
+
BMP-7
+
+
BMPR-IA
+
+
BMPR-IB
+
+
BMPR-II
+
+
Хордин
+
+
Гремлин
+
+
Фоллистатин
+
+
Бамби
+
+
Ноггин
-
-
Страница: 16
RU 2 336 902 C2
CER-1
5
10
15
20
25
30
35
40
45
50
-
-
Вестерн-иммуноблоттинг: белок выдел ли из культивированных клеток с
использованием лизирующего буфера, и белки раздел ли электрофорезом в
полиакриламидном геле в денатурирующих услови х перед электрофоретическим
переносом на нитроцеллюлозные мембраны (Lambert et al., 2001). Мембраны блокировали
5% молоком (дл ВМР) или 3% желатином (дл BMPR) и инкубировали со следующими
первичными антителами против: ВМР-2, ВМР-4, ВМР-5, ВМР-7 (все производства Santa
Cruz, Santa Cruz, CA) или ВМР-RIA, ВМР-RIB, ВМР-RII (производства Jackson Immuno
Research, West Grove, PA). Мембраны промывали, инкубировали со вторичными
антителами (козьи анти-мышиный IgG-пероксидаза хрена-антитела дл ВМР, Santa Cruz;
ослиные анти-козий IgG-пероксидаза хрена-антитела дл ВМР-рцепторов, Jackson Immuno
Research), и про вл ли с использованием хемилюминесцентной системы дл иммунодетектировани WesternBreeze (Invitrogen, Carlsbad, CA).
Экспресси мРНК ВМР, BMPR в человеческих клетках и ткан х ТМ: продукты
амплификации предлагаемого размера дл пар праймеров ВМР-2, ВМР-4, ВМР-5 и ВМР-7 в
человеческих клетках и ткан х ТМ представлены на фиг.6. При постановке саузернблоттинга с использованием специфических зондов было подтверждено, что это были
предполагаемые продукты ПЦР. Все человеческие линии клеток и ткани ТМ
экспрессировали мРНК дл ВМР-2, ВМР-4 и ВМР-7. Однако уровень мРНК дл ВМР-5 был
низким вплоть до неопредел емого в пробах ткани ТМ человека (фиг.6, полосы 6 и 7).
Контрольные реакции без кДНК не давали продуктов амплификации, что указывает на то,
что реагенты и праймеры не были загр знены ДНК или РНК (фиг.6, полоса С).
На фиг.7 показаны продукты амплификации предполагаемого размера дл пар
праймеров ВМР-RIA, ВМР-RIB и ВМР-RII в клетках и ткан х ТМ человека. Все человеческие
клетки и ткани ТМ экспрессировали мРНК дл рецепторных комплексов ВМР. При
постановке саузерн-блоттинга с использованием специфических праймеров было
подтверждено, что это были предполагаемые продукты ПЦР. В реакции ПЦР с ВМР-RII
детектировали альтернативный продукт амплификации (350 п.н.). Альтернативный продукт
амплификации присутствовал во всех клетках и ткан х ТМ человека. Данную
альтернативную полосу идентифицировали дл определени того, соответствует ли она
альтернативной сплайсированной форме рецептора. Контрольные реакции без кДНК не
давали продуктов амплификации (фиг.7, полоса С), что указывает на отсутствие
загр знени реагентов и праймеров ДНК или РНК.
Экспресси мРНК ВМР и ВМР-рецепторов в человеческих клетках и ткан х ONH:
продукты амплификации предлагаемого размера дл пар праймеров ВМР-2, ВМР-4, ВМР-5
и ВМР-7 в человеческих астроцитах ONH и ткан х ONH представлены на фиг.8. Все
астроциты ONH и ткань ONH экспрессировали мРНК дл соответствующего ВМР.
Астроциты мозга человека использовали в качестве положительной контрольной клеточной
линии. При постановке саузерн-блоттинга с использованием специфических зондов было
подтверждено, что это были предполагаемые продукты ПЦР. За исключением ВМР-2 все
другие ВМР экспрессировались астроцитами мозга человека (фиг.8, полоса 7).
Контрольные реакции без кДНК не давали продуктов амплификации (фиг.8, полоса С), что
указывает на то, что реагенты и праймеры не были загр знены ДНК или РНК.
На фиг.9 показаны продукты амплификации предполагаемых размеров дл пар
праймеров ВМР-2, ВМР-4, ВМР-5 и ВМР-7 в культивированных человеческих клетках LC.
Все клеточные линии LC экспрессировали мРНК дл каждого ВМР. При постановке
саузерн-блоттинга было подтверждено, что это были предполагаемые продукты ПЦР.
Контрольные реакции без кДНК не давали продуктов амплификации (фиг.9, полоса С), что
указывает на то, что реагенты и праймеры не были загр знены ДНК или РНК.
Продукты амплификации предполагаемого размера дл пар праймеров ВМР-RIA, ВМРRIB и ВМР-RII в человеческих астроцитах ONH и ткан х ONH представлены на фиг.10. Все
клеточные линии астроцитов и ткани ONH экспрессировали мРНК дл ВМР-RIA и ВМР-RIB.
При постановке саузерн-блоттинга с использованием специфических зондов было
Страница: 17
RU 2 336 902 C2
5
10
15
подтверждено, что это были предполагаемые продукты ПЦР. За исключением ткани ONH
(фиг.10, полоса 6), ВМР-RII экспрессировалс всеми клеточными лини ми астроцитов ONH.
мРНК дл всех ВМР-рецепторов (фиг.10, полоса 7) экспрессировалась клеточной линией
астроцитов мозга человека, котора служила в качестве положительного контрол .
Оказалось, что имеютс различи в экспрессии ВМР-RII в ткани ONH и клеточных лини х
ONH. Низка экспресси в ткани ONH может отражать низкий уровень экспрессии.
Контрольные реакции без кДНК не давали продуктов амплификации (фиг.5, полоса С), что
указывает на то, что реагенты и праймеры не были загр знены ДНК или РНК.
На фиг.11 показаны продукты амплификации предполагаемых размеров дл пар
праймер ВМР-RIA, ВМР-RIB и ВМР-RII в культивированных человеческих клетках LC. Все
клеточные линии LC экспрессировали мРНК дл каждого ВМР-рецептора. При постановке
саузерн-блоттинга с использованием специфических зондов было подтверждено, что это
были предполагаемые продукты ПЦР. Контрольные реакции без кДНК не давали продуктов
амплификации (фиг.11, полоса С), что указывает на то, что реагенты и праймеры не были
загр знены ДНК или РНК.
Экспресси ВМР-белков и ВМР-рецепторных белков в человеческих клетках и ткан х ТМ
и ONH: на фиг.12 представлены результаты детектировани белков ВМР-2, ВМР-4, ВМР-5,
20
25
30
35
40
45
50
ВМР-7, ВМР-RIA, ВМР-RIB и ВМР-RII в человеческих клетках и ткан х ТМ и ONH с
помощью хемилюминесцентного иммуноблоттинга. Все исследованные клеточные линии
экспрессировали соответствующие белки ВМР. Белки ВМР детектировали в клеточных
лини х со следующими значени ми молекул рной массы: 54-56 kDa дл ВМР-2, 25-27 kDa
дл ВМР-4, 55-57 kDa дл ВМР-5 и 77 kDa дл ВМР-7. Дл ВМР-2 и ВМР-4 детектировали
множество полос, которые наиболее веро тно соответствуют гликозилированным и
частично гликозилированным формам данных ВМР, как показано в других исследовани х.
Однако авторы не проводили исследований по гликозилированию, поскольку они
находились вне объема данного исследовани . ВМР-рецепторные белки детектировали в
клеточных лини х со значени ми молекул рной массы: 38 kDa дл ВМР-RIA, 64 kDa дл ВМР-RIB и 57 kDa дл ВМР-RII. Дл ВМР-RIB и ВМР-RII детектировали множество полос в
клетках ТМ, которые наиболее веро тно соответствуют гликозилированным и частично
гликозилированным формам, как это следует из результатов других исследований.
Оказалось, что уровни экспрессии белков ВМР-рецепторов ниже в клетках ТМ по
сравнению с клетками ONH. Например, ВМР-RII не детектировали в клетках ТМ, и ВМР-RIB
было значительно снижено.
Экспресси мРНК св занных с ВМР белков в культивированных человеческих клетках
ТМ и человеческих клетках ONH: продукты амплификации предполагаемого размера дл пар праймеров белков, св занных с ВМР, в человеческих клеточных лини х ТМ,
представлены на фиг.13. Человеческие линии ТМ экспрессировали мРНК дл DRM
(гремлина), хордина, фоллистатина и NMA (BAMBI). При постановке саузерн-блоттинга с
использованием специфических зондов было подтверждено, что это были предполагаемые
продукты ПЦР. Явное различие в экспрессии мРНК между клеточными лини ми
отсутствовало. Все исследованные человеческие клетки ТМ не экспрессировали мРНК дл св занных с ВМР белков ноггина и Cer-1. Контрольные реакции без кДНК не давали
продуктов амплификации, что указывает на то, что реагенты и праймеры не были
загр знены ДНК или РНК.
Продукты амплификации предполагаемого размера дл пар праймеров св занных с
ВМР белков в астроцитах ONH и клеточных лини х LC представлены на фиг.14. Все
астроциты ONH и клеточные линии LC экспрессировали мРНК дл DRM (гремлина),
фоллистатина и NMA (BAMBI). При постановке саузерн-блоттинга с использованием
специфических зондов было подтверждено, что это были предполагаемые продукты ПЦР.
Больша часть клеток LC и астроцитов ONH экспрессировала мРНК дл хордина. Все
исследованные человеческие астроциты ONH и клетки LC не экспрессировали мРНК
св занных с ВМР белков ноггина и Cer-1. Контрольные реакции без кДНК не давали
продуктов амплификации, что указывает на то, что реагенты и праймеры не были
Страница: 18
RU 2 336 902 C2
5
10
15
20
загр знены ДНК или РНК.
На фиг.15 показана повышенна экспресси антагониста ВМР гремлина (CRTSF1B1) в
клетках ТМ при глаукоме. Экспрессию гена оценивали с использованием совокупности
генов Affymetrix (генные чипы U133A Affymetrix).
Все композиции и/или способы, раскрытые и за вленные в этом документе, можно
осуществить и выполнить без излишнего экспериментировани в свете насто щего
описани . Несмотр на то, что композиции и способы по данному изобретению описаны
здесь в виде предпочтительных воплощений, специалистам в данной области, очевидно,
пон тно, что можно внести вариации в композиции и/или способы, и стадии или
последовательность стадий способа, описанного здесь, не отступа от концепции,
сущности и объема изобретени . Конкретнее, очевидно, пон тно, что некоторые средства,
близкие в химическом и структурном отношении, можно использовать здесь вместо
средств, описанных здесь с достижением аналогичных результатов. Предполагаетс , что
все замены и модификации, известные специалистам в данной области, наход тс в
соответствии с сущностью, объемом и концепцией изобретени , которые определены в
прилагаемой формуле изобретени .
Источники литературы
Последующие источники литературы в той степени, в которой они обеспечивают
примеры методических и других деталей в дополнение к представленным в этом
документе, специально включены здесь дл сведени .
Книги
25
30
35
40
45
50
Страница: 19
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Другие публикации
Страница: 20
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Страница: 21
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Страница: 22
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Страница: 23
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Страница: 24
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Страница: 25
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Страница: 26
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Страница: 27
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
Страница: 28
RU 2 336 902 C2
5
10
15
20
25
30
35
Формула изобретени 1. Способ лечени глаукомы, предусматривающий введение пациенту, нуждающемус в
этом, композиции, содержащей по меньшей мере один агонист ВМР-4, где композицию
ввод т непосредственной доставкой в глаз пациента.
2. Способ по п.1, где агонист ВМР-4 ввод т посредством местных глазных капель.
3. Способ по п.1, где агонист ВМР-4 ввод т посредством местной глазной мази.
4. Способ по п.1, где агонист ВМР-4 ввод т посредством устройства замедленного
высвобождени , имплантированного в слепой мешок глаза.
5. Способ по п.1, где агонист ВМР-4 ввод т посредством устройства замедленного
высвобождени , имплантированного около склеры глаза.
6. Способ по п.1, где агонист ВМР-4 ввод т посредством устройства замедленного
высвобождени , имплантированного внутри глаза.
7. Способ по п.1, где агонист ВМР-4 ввод т инъекцией.
8. Способ по п.1, где концентраци агониста ВМР-4 в композиции составл ет от 0,01
до 2%.
40
45
50
Страница: 29
CL
RU 2 336 902 C2
Страница: 30
DR
RU 2 336 902 C2
Страница: 31
RU 2 336 902 C2
Страница: 32
RU 2 336 902 C2
Страница: 33
RU 2 336 902 C2
Страница: 34
RU 2 336 902 C2
Страница: 35
RU 2 336 902 C2
Страница: 36
RU 2 336 902 C2
Страница: 37
RU 2 336 902 C2
Страница: 38
RU 2 336 902 C2
Страница: 39
RU 2 336 902 C2
Страница: 40
RU 2 336 902 C2
Страница: 41
RU 2 336 902 C2
Страница: 42
RU 2 336 902 C2
Страница: 43
RU 2 336 902 C2
Страница: 44
RU 2 336 902 C2
Страница: 45
RU 2 336 902 C2
Страница: 46
RU 2 336 902 C2
Страница: 47
RU 2 336 902 C2
Страница: 48
RU 2 336 902 C2
Страница: 49
RU 2 336 902 C2
Страница: 50
RU 2 336 902 C2
Страница: 51
RU 2 336 902 C2
Страница: 52
RU 2 336 902 C2
Страница: 53
RU 2 336 902 C2
Страница: 54
RU 2 336 902 C2
Страница: 55
RU 2 336 902 C2
Страница: 56
RU 2 336 902 C2
Страница: 57
RU 2 336 902 C2
Страница: 58
RU 2 336 902 C2
Страница: 59
RU 2 336 902 C2
Страница: 60
RU 2 336 902 C2
Страница: 61
RU 2 336 902 C2
Страница: 62
RU 2 336 902 C2
Страница: 63
RU 2 336 902 C2
Страница: 64
RU 2 336 902 C2
Страница: 65
RU 2 336 902 C2
Страница: 66
RU 2 336 902 C2
Страница: 67
RU 2 336 902 C2
Страница: 68
RU 2 336 902 C2
Страница: 69
RU 2 336 902 C2
Страница: 70
RU 2 336 902 C2
Страница: 71
RU 2 336 902 C2
Страница: 72
RU 2 336 902 C2
Страница: 73
RU 2 336 902 C2
Страница: 74
RU 2 336 902 C2
Страница: 75
RU 2 336 902 C2
Страница: 76
RU 2 336 902 C2
Страница: 77
RU 2 336 902 C2
Страница: 78
RU 2 336 902 C2
Страница: 79
RU 2 336 902 C2
Страница: 80
RU 2 336 902 C2
Страница: 81
RU 2 336 902 C2
Страница: 82
RU 2 336 902 C2
Страница: 83
RU 2 336 902 C2
Страница: 84
RU 2 336 902 C2
Страница: 85
RU 2 336 902 C2
Страница: 86
RU 2 336 902 C2
Страница: 87
RU 2 336 902 C2
Страница: 88
RU 2 336 902 C2
Страница: 89
RU 2 336 902 C2
Страница: 90
RU 2 336 902 C2
Страница: 91
RU 2 336 902 C2
Страница: 92
3561
(дл хордина), 4049 нуклеотидов (дл гремлина), 1386 нуклеотидов (дл фоллистатина) и
1523 нуклеотидов (дл бамби).
Легко пон ть, что "последовательности с промежуточными длинами" в данном контексте
означают любую длину между указанными пределами, такую как 14, 15, 16, 17, 18, 19, 20
и т.д.; 21, 22, 23 и т.д., 30, 31, 32 и т.д., 50, 51, 52, 53 и т.д., 100, 101, 102,
103 и т.д., 150, 151, 152, 153 и т.д., включа все целые числа в пределах 200-500,
500-1000, 1000-2000, до и включа последовательности из 2001, 2002, 2050, 2051
нуклеотидов и тому подобное.
Способность таких нуклеотидных зондов и праймеров специфически гибридизоватьс с
кодирующими последовательност ми ВМР и праймерами дл специфической
амплификации последовательностей ВМР позволит использовать их дл детектировани наличи комплементарных последовательностей в данной пробе. Однако
предусматриваютс другие применени , включа применение информации по
секвенированию дл получени праймеров мутантных видов или праймеров дл получени других генетических конструкций.
Молекулы нуклеиновой кислоты, имеющие области последовательности, состо щие из
участков смежных нуклеотидов длиной 10, 20, 30, 50 и даже 100-200 нуклеотидов или так
далее, идентичные или комплементарные последовательност м ВМР-2А (SEQ ID NO:1),
ВМР-4 (SEQ ID NO:3), ВМР-5 (SEQ ID NO:5), ВМР-7 (SEQ ID NO:7), ВМР-RIA (SEQ ID NO:
37), ВМР-RIB (SEQ ID NO:39), ВМР-RII (SEQ ID NO:41), хордина (SEQ ID NO:43), гремлина
(SEQ ID NO:45), фоллистатина (SEQ ID NO:47) или бамби (SEQ ID NO:53), особенно
пригодны дл использовани в качестве зондов дл гибридизации, например, при оценке
SNP и в тестах гибридизации на твердой фазе, в дополнение к саузерн- и нозернблоттингу. Это позволит проводить анализ структурных и регул торных генов ВМР в
ткан х и клетках. Полный размер фрагмента, а также размер комплементарного
участка(ов), в конечном итоге будет зависеть от предназначаемого применени конкретного сегмента нуклеиновой кислоты. Меньшие фрагменты, как правило, будут
примен тьс при гибридизации, когда длина смежной комплементарной области может
Страница: 9
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
варьировать, например, в пределах примерно от 10 до примерно 100 нуклеотидов, но
можно использовать более крупные смежные комплементарные участки вплоть до
примерно 1547 нуклеотидов (дл ВМР-2А), 1946 нуклеотидов (дл ВМР-4), 2153
нуклеотидов (дл ВМР-5) и 1878 нуклеотидов (дл ВМР-7), 2932 нуклеотидов (дл ВМРRIA), 2032 нуклеотидов (дл ВМР-RIB), 3611 нуклеотидов (дл ВМР-RII), 3561 (дл хордина), 4049 нуклеотидов (дл гремлина), 1386 нуклеотидов (дл фоллистатина) и 1523
нуклеотидов (дл бамби) нуклеотидов, соответственно длине комплементарных
последовательностей, которые желательно детектировать.
При применении зонда дл гибридизации длиной примерно 10-14 нуклеотидов
образуетс дуплексна молекула, котора одновременно вл етс стабильной и
избирательной. Молекулы, имеющие смежные комплементарные последовательности к
участкам длиной более 10 оснований, в основном вл ютс предпочтительными, хот дл повышени стабильности и избирательности гибрида, и тем самым дл улучшени качества и степени получаемых конкретных гибридных молекул, как правило,
предпочтительно конструировать молекулы нуклеиновых кислот, имеющих
комплементарные участки дл генов, состо щих из 15-20 смежных нуклеотидов или, при
необходимости, длиннее.
Зонды дл гибридизации можно выбрать из любого участка любой последовательности,
раскрытой здесь. Все, что требуетс , это проанализировать представленные
последовательности SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37,
SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 или SEQ ID NO:
53 и выбрать любой смежный участок последовательности длиной примерно от 10
нуклеотидов и вплоть до полноразмерной последовательности, который желательно
использовать в качестве зонда или праймера. При выборе последовательностей зонда и
праймера можно руководствоватьс различными факторами, только в качестве примера,
например, желательно ли использовать праймеры к концам целой последовательности или
от концов функциональных кодирующих домен последовательностей, дл последующей
амплификации ДНК.
Способ отбора и получени сегмента нуклеиновой кислоты, который включает смежную
последовательность из последовательностей ВМР-2А (SEQ ID NO:1), ВМР-4 (SEQ ID NO:3),
ВМР-5 (SEQ ID NO:5), ВМР-7 (SEQ ID NO:7), ВМР-RIA (SEQ ID NO:37), ВМР-RIB (SEQ ID
NO:39), ВМР-RII (SEQ ID NO:41), хордина (SEQ ID NO:43), гремлина (SEQ ID NO:45),
фоллистатина (SEQ ID NO:47) или бамби (SEQ ID NO:53), альтернативно может быть
определен как получение фрагмента нуклеиновой кислоты. Конечно, фрагменты также
можно получить другими методами, такими как, например, механическое
гидродинамическое фрагментирование ДНК или расщепление рестриктазой. Небольшие
сегменты или фрагменты нуклеиновой кислоты можно легко получить, например, пр мым
синтезом фрагмента химическими методами, как это широко распространено на практике с
использованием автоматического синтезатора олигонуклеотидов. Кроме того, фрагменты
можно получить применением методов репродукции нуклеиновой кислоты, такой как
технологи ПЦР ? согласно патенту США № 4683202 и патенту США № 4682195 (каждый
включен здесь дл сведени ), введением отобранных последовательностей в
рекомбинантные векторы дл рекомбинантной продукции, и другими методами
рекомбинантной ДНК, хорошо известными специалистам в области молекул рной
биологии.
Следовательно, нуклеотидные последовательности по изобретению можно
использовать по их способности к селективному образованию дуплексных молекул с
комплементарными участками генов или кДНК ВМР. В зависимости от предполагаемого
подхода будет желательно использовать различные степени избирательности
гибридизации дл достижени различной степени избирательности зонда относительно
последовательности-мишени. Дл применений, где требуетс высока избирательность,
как правило, желательно использовать относительно жесткие услови дл образовани гибридов, например, следует выбрать услови с относительно низкой концентрацией соли
Страница: 10
RU 2 336 902 C2
5
10
15
20
25
30
35
40
45
50
и/или высокой температурой, такие как обеспечиваютс при использовании 0,02-0,15 М
NaCl при температуре 50-70°С. В подобных услови х имеетс небольша , если вообще
такова существует, веро тность ошибочного спаривани зонда и матрицы или цепимишени, и они особенно подход т дл исследовани генов ВМР.
Конечно, дл некоторых применений, например, когда желательно получить или
идентифицировать мутанты с использованием цепи мутантного праймера,
гибридизованного с лежащей в основе матрицей, или когда необходимо выделить
кодирующие последовательности ВМР из близких видов, функциональных эквивалентных
вариантов и тому подобное, как правило, требуютс менее жесткие услови гибридизации
дл образовани гетеродуплекса. В данных обсто тельствах может быть желательным
использовать такие услови , как концентраци соли 0,15-1,0 М при температуре в
пределах примерно от 20 до 55°С. Тем самым можно легко идентифицировать
перекрестно-гибридизующиес виды в качестве положительно гибридизующихс сигналов
по отношению к контрольной гибридизации. В любом случае в целом предусматриваетс ,
что услови можно сделать более жесткими при снижении концентрации NaCl или
добавлении возрастающих количеств формамида, который служит дл дестабилизации
гибридного дуплекса так же, как повышенна температура. Таким образом, можно легко
манипулировать услови ми гибридизации, и, таким образом, имеетс метод выбора в
зависимости от желаемых результатов.
В некоторых воплощени х будет преимущественным использовать последовательности
нуклеиновых кислот по насто щему изобретению в сочетании с подход щими средствами,
такими как метка, дл определени результатов гибридизации. В данной области известны
самые различные соответствующие индикаторные средства, включа флуоресцентные,
радиоизотопные, ферментативные или другие лиганды, такие как авидин/биотин, которые
способны воспроизводить детектируемый сигнал. В предпочтительных воплощени х
желательно использовать флуоресцентную метку или ферментативную метку, такую как
уреаза, щелочна фосфатаза или пероксидаза, вместо радиоактивного или других
нежелательных дл окружающей среды реагентов. В случае ферментативных меток
известны индикаторные субстраты дл колориметрии, которые можно использовать дл обеспечени средств, видимых человеческому глазу или обнаруживаемых при
спектрофотометрии, дл идентификации специфической гибридизации с пробами,
содержащими комплементарные нуклеиновые кислоты.
В общем предусматриваетс , что зонды дл гибридизации, описанные здесь, будут
пригодными в качестве реагентов как дл гибридизации в растворе, так и в воплощени х
с использованием твердой фазы. В воплощени х с твердой фазой анализируема ДНК (или
РНК) адсорбируетс или фиксируетс иначе на выбранном матриксе или поверхности.
Затем данную фиксированную одноцепочечную нуклеиновую кислоту подвергают
спец
Документ
Категория
Без категории
Просмотров
0
Размер файла
5 801 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа