


вход по аккаунту



код для вставкиСкачать
Accepted Manuscript
MicroRNA expression profiling of dibenzalacetone (DBA) treated intracellular
amastigotes of Leishmania donovani
Neeloo Singh, Indira Singh Chauhan
YEXPR 7593
To appear in:
Experimental Parasitology
Received Date: 13 November 2017
Revised Date:
19 July 2018
Accepted Date: 30 July 2018
Please cite this article as: Singh, N., Chauhan, I.S., MicroRNA expression profiling of dibenzalacetone
(DBA) treated intracellular amastigotes of Leishmania donovani, Experimental Parasitology (2018), doi:
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.
MicroRNA expression profiling of Dibenzalacetone (DBA) treated intracellular amastigotes
of Leishmania donovani
Neeloo Singha*and Indira Singh Chauhana
Road, Lucknow- 226031, India
Biochemistry Division, CSIR Central Drug Research Institute, Jankipuram Extension, Sitapur
* Corresponding author:
Dr. Neeloo Singh, Biochemistry Division, CSIR Central Drug Research Institute, Jankipuram
Extension, Sitapur Road, Lucknow, India, 226031,
Among different leishmanial infections, visceral leishmaniasis (VL) if not treated is the most
severe form with high mortality rates. In India, it is caused by the protozoan parasite Leishmania
donovani. The therapy of visceral leishmaniasis is limited due to high toxicity, resistance to
existing drugs and increasing cases of Leishmania co-infections. Hence, there is a need to
identify novel drug and targets to overcome these hindrances. MicroRNAs (miRNAs) are a class
of small non-coding RNAs (~22 to 24 nucleotide in length) that regulate gene expression in
various biological processes. They play as intracellular mediators that are essential for different
biological processes.
The aim of present study is to explore the leishmaniacidal role of trans-dibenzalacetone (DBA, a
synthetic monoketone analog of curcumin) on the expression profile of miRNA in intracellular
amastigotes of Leishmania donovani.
Small RNA libraries of samples (macrophages-infected with Leishmania amastigotes; and
infected macrophages treated with DBA) were prepared by using Illumina Trueseq Small RNA
Using miRDIP database, we identified target gene of differentially expressed miRNAs (target
miRNAs: hsa-mir-15b, hsa-mir-671, hsa-mir-151a and has-mir-30c) which was confirmed by
real time stem-loop PCR. Ten KEGG pathways were significantly enriched with these target
miRNA genes and they mainly relate to mitogen-activated protein kinases (MAPK) pathway. We
have previously established the antiproliferative and apoptotic effect of trans-dibenzalacetone
(DBA, a synthetic monoketone analog of curcumin) on the Leishmania donovani parasites. In the
present study, using GFP-ATG8 gene as a marker for tracking putative autophagosomes, we
confirmed that autophagic vacuolization may lead to autophagic cell death in the DBA-treated
parasites. Our results demonstrated that curcumin analog DBA has a role to play in regulating the
balance between autophagy and apoptosis.
We conclude that curcumin analog DBA triggers imbalance between two known phenotypes of
cell death viz apoptosis and autophagy.
Trans-dibenzalacetone (DBA), Leishmania donovani, MicroRNA (miRNA).
Among different leishmanial infections, visceral leishmaniasis (VL) if not treated is the most
severe form with high mortality rates. In India, the disease is known as Kala Azar and is endemic
on_document/en/). Leishmania donovani is a species of intracellular protozoan parasites that are
able to survive and multiply within the hostile phagolysosomal environment of infected
macrophages (Leirião, et al., 2004). MicroRNAs (miRNAs) are a class of small non-coding
RNAs (~22 to 24 nucleotide in length) that regulate gene expression in various biological
processes. They play as intracellular mediators that are essential for different biological
processes (Lai, et al., 2013, Ling, et al., 2013). Mature miRNAs are produced by sequential
processing of primary transcripts (pri-miRNAs) mediated by two RNase III enzymes, Drosha
and Dicer (Siomi and Siomi, 2010). miRNAs regulate gene expression at the post-transcriptional
level by either degradation or translational repression of a target mRNA (Felekkis, et al., 2010).
The small, non-coding RNAs bind to the 3′ untranslated region of target messenger RNA
(mRNA) and negatively regulate the expression of genes involved in development,
differentiation, proliferation, apoptosis, and other important cellular processes (Felekkis, et al.,
2010). A single miRNA can modulate the expression of hundreds of different targets and is thus
implicated in a broad range of physiological and pathological processes (O'Connell, et al., 2010).
Manipulation in miRNA expression can be used as important biomarkers for disease
development and altered miRNA expression represents important avenues for therapeutic
intervention (Hu, et al., 2012). Recent bioinformatics and experimental advances, point towards
rapid progress in understanding the targets and functions of miRNAs (Lai, et al., 2013).
Microarray studies revealed that upon infection by Leishmania promastigotes, the mRNA profile
of the macrophage gets altered and some of the changes in mRNA may be moderated by miRNA
(Wendlandt, 2013). Alteration in miRNA levels likely plays an important role in regulating
macrophage functions following L. major infection (Lemaire, et al., 2013). It has been
established by Erik that miRNAs are important modifiers of mRNA changes during Leishmania
infection (Wendlandt, 2013). It has been reported by Alok et al. that a novel role of MIR30A-3p
in regulating autophagic-mediated L. donovani elimination by targeting BECN1 (Singh, et al.,
2016). A study was recently carried out by Geraci et al. on miRNA profiles upon Leishmania
infection in human phagocytes (Geraci, et al., 2015). There is increasing evidence that
chemotherapy with various anticancer drugs such as curcumin (a naturally occurring flavinoid)
affects miRNA expression in a number of cancers (Srivastava, et al., 2015, Sun, et al., 2008,
Yang, et al., 2013, Zhang, et al., 2010).
In our laboratory, we have established that DBA (trans-dibenzalacetone, a synthetic monoketone
analog of curcumin) has potent antiprolific activity against Leishmania donovani (Chauhan, et
al., 2018). It alters the general ultrastructure and the mitochondrial physiology of the parasite.
Autophagy pathway is coordinated by autophagy-related proteins ATG (genes encoding
proteins) with similarity to the core ATG proteins in yeast and mammals (He and Klionsky,
2009). They have been described in Leishmania species, suggesting that these parasites possess a
functional autophagy pathway (Williams, et al., 2009). Using the specific gene marker (ATG8),
we confirmed that autophagic vacuolization may lead to cell death in the DBA-treated parasites.
The comparison of miRNA expression between the treatment of intracellular Leishmania and the
untreated parasite will reveal an explicit impact of chemotherapy with this drug on the miRNA
expression profile of the parasite.
Materials and Methods
Leishmania strain and culture conditions
The standard strain of L. donovani (MHOM/IN/80/DD8) were routinely cultured as described
previously (Kaur, et al., 2010). The J774A.1 mouse (BALB/c) macrophage cell line was
procured from National Centre for Cell Science (Pune, India). The cells were maintained in
RPMI 1640 medium (Gibco-BRL) adjusted to contain 2 g of sodium bicarbonate/liter, 6 g of
HEPES/liter, 10% (v/v) heat-inactivated fetal bovine serum (HI-FBS; Gibco, Germany), and 100
U penicillin and 100 µg of streptomycin/ml at 37°C in a humidified atmosphere of 95% air and
5% CO2 (Kaur, et al., 2011). Antileishmanial activity of DBA in intracellular amastigotes was
previously determined by us (Chauhan, et al., 2018). Infected macrophages were treated with
IC50 value of DBA and incubated at 37°C in 5% CO2 for 24 h (Kaur, et al., 2010).
Total RNA was isolated using TRI reagent (Molecular Research Center, Cat. No. TR118), as per
manufacturer`s instruction, from three different samples: [A] mouse macrophage (J774A.1) cells
(AM); [B] macrophages infected with Leishmania amastigotes (BI); and [C] amastigote-infected
macrophages treated for 24 h with DBA (CI). The quality of total RNA was checked on 1%
denatured agarose gel (loaded 5 µl) for the presence of 28S and 18S bands. The gel was run at
100 V for 30 min. Further, total RNA was quantified using Qubit fluorometer.
miRNA microarray profiling
The small RNA libraries from these samples were prepared using Illumina Trueseq SmallRNA
kit from 1 µg of total RNA. Initially, 3' and 5' adaptors were ligated to each end of the RNA
molecule and reverse transcription reaction was used to create single stranded cDNA. The cDNA
was PCR amplified using a common primer and index primer to create cDNA construct. The
cDNA construct was purified using 6% Novex TBE PAGE gel. After gel purification, the cDNA
was extracted and concentrated by ethanol precipitation.
A total 13534082 reads for AM sample, 30909234 reads for BI sample and 18415476 reads for
CI sample were generated, have been provided in Table S1. High Quality data reads of AM, BI
and CI samples were imported by discarding the Illumina importer using CLC Genomics
Workbench. A total 7254885 reads for AM sample, 5561238 reads for BI sample and 12138167
reads for CI were trimmed, as shown in Table S2. Trimmed reads were mapped to Rfam
database to remove ribosomal contamination other than miRNAs. Mapping statistics using Rfam
shown in Table S3. The unmapped reads from Rfam were mapped to Leishmania donovani strain
a/data/Tri TrypDB-25_LdonovaniBHU1220_Genome.fasta) and the unmapped reads were
considered for the downstream analysis. Mapping statistics using Leishmania donovani strain
BHU1220 shown in Table S4. To identify the known and novel miRNAs, miRDeep2 software
package was used. The mature Homo sapiens and precursors miRNA was downloaded from
( and these miRNAs were mapped against BI and CI samples. The below steps
were carried out to identify the known and the novel miRNAs. The module of miRDeep2
software was used to process deep sequencing reads and/or map them to the Human genome.
Bioinformatics analysis
Target prediction for known miRNAs of BI and CI samples were pulled out from the microRNA
Data integration Portal (mirDIP ) based on reference paper
(Geraci, et al., 2015). mirDIP integrates multiple target prediction databases and provides a
standardized score for each miRNA transcript relationship. While target was predicted for novel
miRNAs of BI and CI samples using Miranda. Predicted target gene transcripts for the known BI
and CI samples were used to identify KEGG pathways by using WEB-based Gene set Analysis
Toolkit (Web Gestalt) with hyper geometric tests, Benjamini-Hocheberg adjustments and Human
genome as a reference set. In Figure 1 we represent the bioinformatics workflow for small RNA
Real-time quantification of target miRNAs by stem–loop RT–PCR
cDNA was synthesized from the individual RNA taking 500 ng total RNA from each sample
using RevetAid H Minus First Strand cDNA Synthesis Kit (Fermentas, Cat no. K1631) as per the
manufacturing instruction. cDNA was synthesized, taking approximately 500 ng RNA to which
1µl of 10 mM dNTPs, stem loop RT primer [10 pM, miR specific primers (hsa-mir-30c-1, hsa-
mir-15b, hsa-mir-671, hsa-mir-151a and U6) were designed and synthesis by Xcelris Labs] and
volume was maintained 13 µl. The details of the primers are given below.
4. hsa-mir-151a; hsa-mir-151a F: ACACTCCAGCTGGGTCGAGGAGCTCACAG
5. U6 House Keeping Gene: Forward qPCR primer: GCTTCGGCAGCACATATACTAAAAT
This reaction mix was incubated at 65°C for 5 min. After incubation, each of specific miR-RT
reactions were kept on ice for 2 min. Rest of cDNA synthesis cocktail was added as follow, 4µl
of 5X reaction buffer, 1 µl RiboLock RNase Inhibitor (20 U/µl), 1µl RevertAid H minus M-
MuLV Reverse Transcriptase (200 U/µl), 1µl DTT (100 mM). Final volume of cDNA reaction
mix was maintained to 20µl. After mixing gently, reactions were placed on thermocycler with
given stem loop PCR as follow, 30 min at 16°C, cycles at 30°C for 30 seconds, 42°C for 30
seconds and 50°C for 1 second.
Real time PCR was carried out in Light Cycler 480 II (Roche) using following conditions: PCR
mixture (10 µl) consisted of 1 µl of cDNA, 5 µl FastStart Essential DNA Green l Master (2X), 1
µl of each primer (5 pmole /µl) and 2 µl of nuclease free water. Amplification includes initial
denaturation at 94ºC for 2 min (1 cycle), followed by 40 cycles of denaturation at 94ºC for 15
second and annealing of primers at 60ºC for 1 min (Heid, et al., 1996, Schmittgen, et al., 2000).
Identification of autophagic vacuoles
Autophagy, characterized by increased formation of lysosomes and autophagolysosomes in
vacuoles (AVOs), was quantified by flow cytometry after staining the cells with acridine orange
base dye (AO, Cat. No. 235474, Sigma) (Bhakdi, et al., 2007). Logarithmic phase promastigotes
of L. donovani (1×106 cells, final volume 2 ml/well) were seeded in 6-well microtiter plates in
the presence of different concentrations (0 - 40 µg/ml) of DBA and incubated at 25°C for 24 h.
Then, the, cells were centrifuged (3500 x g for 5 min), washed once with PBS (pH 7.2), re-
suspended in 1 µg/ml final concentration of AO, and incubated for 15 min in the dark at room
temperature. After washing, samples were processed on a FACSCalibur flow cytometer and
analyzed using CellQuest Pro software. 10,000 events from each sample were acquired to ensure
adequate data. The histogram and images are representative of three independent experiments.
Monitoring of autophagy: Transfection of GFP-ATG8 gene in L. donovani
We are grateful to Jeremy C. Mottram for the kind gift of GFP-ATG8 plasmid which is a marker
for tracking putative autophagosomes (Cull, et al., 2014). Logarithmic phase promastigotes of L.
donovani (1×107 cell/ml) were harvested by centrifugation at 4500 rpm for 5 min at room
temperature and transfection of GFP-ATG8 gene in wild type parasites was done by using K2
transfection system (Biontex, Cat. No. T060-1.5) as per manufacturer`s guidelines. Transfection
was confirmed by using a FACS Calibur flow cytometer (BD Bioscience, San Jose, CA, USA).
Fluorescence was collected in the FL1 channel, equipped with 488 nm band pass filter. Analysis
for mean fluorescence intensity was done using CellQuest Pro software (BD Biosciences, CA).
Transfectant cells were treated with IC50 value of DBA for 24 h and analysed by using flow
cytometer. 10,000 events from each sample were acquired to ensure adequate data. The
histogram and images are representative of three independent experiments.
Fluorescence Microscopy
For live cell imaging, transfectant cells were pelleted by centrifugation and washed twice in PBS
to remove medium. Transfectant cells were viewed by fluorescence microscopy on Olympus
fluoviewTM FV1000 confocal microscope (America Inc., USA) with GFP filter. Imaging of
transfectant cells was performed at 60 x magnification. DIC images were obtained under
polarized light. The level of autophagy is expressed as the percentage of cells in a population
containing at least one GFP-ATG8-labelled autophagosomes with minimum 200 cells counted
from at least 3 independent experiments.
Promastigotes (5 x 106) of L. donovani were treated with different concentrations of (0 - 40
µg/ml) DBA and after incubation at 25°C for 24 h, cells were centrifuged, washed with PBS (pH
7.4) and suspended in lysis buffer (20 mM HEPES pH 7.4, 150 mM NaCl, 1 mM dithiothreitol,
0.5% triton X-100 and 1x protease inhibitor mixture set) for 30 min on ice. The samples were
centrifuged and supernatant was collected as total protein lysate. Equal amount of protein (20-40
µg) was resolved on SDS-PAGE and transferred to polyvinyl difluoride (PVDF) membrane (Cat.
No. IPVH000010, Milipore, Bedford MA, USA) using Hoefer SemiPhor (Amersham Pharmacia
Biotech). After blocking with 5% (w/v) skimmed milk in PBS, membrane was incubated with
1:1000 dilution of antibody for 1 h at room temperature. The membrane was then incubated with
corresponding horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000 ) for 2 h at
room temperature and protein expression was detected by DAB (3,3'-diaminobenzidine, Sigma)
chromogenic reagent.
In vitro activity of DBA against Leishmania donovani and mammalian cytotoxicity
In our previous study, we have established the antileishmanial activity of DBA against
amastigotes of L. donovani. DBA showed apoptotic cell death at IC50 concentration of 7.43
µg/ml (Figure 2A) against amastigotes. DBA was also tested for cytotoxicity in BALB/c mouse
cell line J774A.1. It was found that the 50% cytotoxic dose (CC50) was higher than the IC50 dose
for intracellular amastigotes (Figure 2B) with a SI (selectivity index) value of 15.34 (Chauhan, et
al., 2018).
Small RNA library preparation:
Small RNA libraries were prepared using Illumina Trueseq Small RNA kit from 1 µg of total
RNA (Figure 3a). The mean sizes of the fragment distribution are 160 bp, 155 bp and 144 bp for
sample A-macrophage (AM), B-intracellular amastigotes (BI) and C-DBA treated intracellular
amastigotes (CI) respectively (Figure 3b and c). Final library was validated on Bio-analyzer 2100
using High-Sensitive DNA Chip for sample A-macrophage (AM), B-intracellular amastigotes
(BI) and C-DBA treated intracellular amastigotes (CI) respectively (Figure 4a-c). The libraries
were sequenced using 1 X 75 bp chemistry to generate 10 million reads/sample.
Predicted known miRNAs
A total of 212 known miRNAs were predicted for BI sample while a total of 211 known
miRNAs were predicted for CI sample. Table S5 represents known miRNA statistics. These
miRNAs were classified into the various families, representative example shown in the Table 1
and Table 2 for sample BI and CI respectively.
Predicted novel miRNA
A total of 6 novel miRNAs were predicted for BI sample while a total of 11 novel miRNAs were
predicted for CI sample. Table S6 represents novel miRNA statistics. These miRNAs were
classified into the various families, representative example shown in the Table 3 and Table 4 for
sample BI and CI respectively.
Predicted targets for known miRNAs
In sample BI, a total of 212 known miRNAs were searched for targets against the mirDIP
transcripts. A total of 675 unique targets were found from BI sample while in sample CI a total
of 211 known miRNAs were searched for targets against the mirDIP transcripts. A total of 675
unique targets were found from CI sample. The targets are shown in Table 5 and Table 6 for BI
and CI samples respectively.
Predicted targets for novel miRNAs
A total of 17 novel miRNAs were searched for targets against the 3’UTR, 5‘UTR and CDS
region of Human genome. In sample BI, a total of 71 from 3’UTR, 9 from 5’UTR and 77 from
CDS unique targets were found. While in sample CI a total of 367 from 3’UTR, 70 from 5’UTR
and 280 from CDS unique targets were found (Figure 5). Predicted targets were used for
functional annotation using blastx (
PAGE_TYPE=BlastSearch). The targets and functional annotation are shown in Table 7, 8 and 9
for targets of novel miRNA BI sample. While in Table 10, 11, and 12 targets of novel for CI
Differential expression analysis of known miRNAs using counts per million (CPM)
A total of 133 common known miRNAs from BI and CI samples were used to calculate counts
per million (CPM). 72 miRNAs were found to be differentially expressed in DBA treated
intracellular amastigotes (CI) as compared with untreated parasites (BI). Out of these 72
miRNAs, 12 miRNAs such as hsa-mir-671, hsa-mir-1470, hsa-mir-9-3, hsa-mir-128-1, hsa-mir-
9-1, hsa-mir-9-2, hsa-mir-128-2, hsa-mir-484, hsa-mir-30c-2, hsa-mir-30c-1, hsa-mir-15b and
hsa-mir-151a were found to be significantly down regulated while 1miRNAs (hsa-mir-8065)
was significantly up regulated in treated sample as shown in Table 13.
Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway
A total of 133 common known miRNAs from BI and CI samples were used to calculate counts
per million (CPM). 13 out of 133 known miRNAs has been searched against the mirDIP
database to pull out target gene symbols of each miRNA. A total of 5 miRNAs found to have
target gene symbols from miRDIP database. A total of 12000, 9915, 9294, 845 and 819 target
genes for miRNAs hsa-mir-15b, hsa-mir-671, hsa-mir-484, hsa-mir-30c-2 and hsa-mir-30c-1
respectively were tabulated as given in Table 14. All the pulled genes symbols of each target
miRNAs were used to identify KEGG pathways by using WEB-based Gene set Analysis Toolkit
(Web Gestalt). A total of 10 different enriched KEGG Pathways Table 15 (metabolic pathways,
pathways in cancer, MAPK signaling pathway, regulation of actin cytoskeleton, focal adhesion,
insulin signaling pathway, Wnt signaling pathway, calcium signaling pathway, endocytosis and
axon guidance) where identified in each of these 5 miRNAs.
Real-time quantification of target miRNAs by stem–loop RT–PCR
The amplified products of real time stem-loop PCR were analyzed on 3% agarose gel along with
no template control (NTC) (Figure 6A). Melting curve and peak analysis confirmed the amplicon
specificity of PCR product of each targeted gene (Figure 6B and C). Expression profiles of hsa-
mir-30c-1, hsa-mir-15b, hsa-mir-671 and hsa-mir-151a (target miR). CI (experimental) is
compared against BI (Control) using U6 as housekeeping gene. The targeted miR obtained from
our miRNA analysis in the infected macrophages treated with DBA contained 5.59, 2.12, 5.21
and 5.93-fold downregulated in hsa-mir-30c-1, hsa-mir-15b, hsa-mir-671 and hsa-mir-151a
respectively as compared to control (Figure 6D and Table 16) (Livak and Schmittgen, 2001).
Cells treated with DBA display autophagic vacuoles
Autophagy is characterized by increased formation of AVOs which can be quantified by flow
cytometry after staining the cells with AO (acridine orange) (Chen, et al., 2007). Cells with
AVOs showed enhanced red fluorescence that increased after treatment with DBA in a dose-
dependent manner (Figure 7A). It is also known that ATG8 N-terminally tagged with GFP
becomes associated with punctate structures (putative autophagosomes) in Leishmania
promastigotes, especially under the starvation conditions and during differentiation between its
life cycle forms (Besteiro, et al., 2006). In the present study, localization of GFP-ATG8 gene in
promastigotes of L. donovani and transfection of GFP-ATG8 gene in wild type parasites was
( Transfection was confirmed by
increased MFI of GFP. New positive cells were treated with IC50 value of DBA for 24 h and
samples were analyzed by using flow cytometer (Figure 7B). To confirm the localization of
GFP-ATG8 gene in parasites, transfectants treated with or without DBA were analyzed by
fluorescence microscope, and the presence and number of GFPATG8-labelled autophagosomes
within these cells were recorded. Fluorescence microscopic analysis showed that the untreated
promastigotes had no fluorescence and upon DBA treatment, the cells distributed into a punctate
structure in the cytosol (Figure 7C). The confirmation of overexpression of GFP-ATG8 gene in
the treated cells was carried out by western blot analysis using GFP antibody. One major protein
was detected at 40 kDa in the treated cells which was consistent with the predicted mass of the
fusion protein (GFP-ATG8) (Figure 7D).
The high failure rate of the drugs and their significant side effects against visceral leishmaniasis
calls for a mainstay therapy for the same. The traditional drug Miltefosine is teratogenic that
should not be administered to pregnant woman. Resistance against sodium stibogluconate has
been reported previously. Liposomal formulation of amphotericin B is quite expensive and
cannot be labeled as poor man’s drug. No report of vaccine against visceral leishmaniasis is
known till date. A rational approach to design and develop new anti-leishmanial agents has
identified several metabolic and biochemical differences between host and parasite that can be
exploited as drug target (Shukla, et al., 2010). One such approach that we adopted is miRNA
expression profiling of drug treated intracellular amastigotes. It has been well documented by
Zheng et al that miRNA pathways are a potential target for the therapeutic control of parasitic
diseases (Zheng, et al., 2013).
MicroRNAs (miRNAs, a class of small non-coding RNAs (~22 to 24 nucleotide)) regulate gene
expression at the post-transcriptional level by either degradation or translational repression of a
target mRNA (Filipowicz, et al., 2008). Nowadays, miRNAs can be used as biomarkers for
disease development and manipulation of miRNAs expression represents a potential avenue of
therapy (Hu, et al., 2012).
We have previously established the leishmanicidal activity of DBA, which leads to apoptotic cell
death in Leishmania donovani via the activation of the MAPK cascades (Chauhan, et al., 2018)
and in the present study, we for the first time report the miRNA expression profile in the DBA
treated intracellular amastigotes of Leishmania donovani. We identified differentially expressed
miRNAs (target miRNAs: hsa-mir-15b, hsa-mir-671, hsa-mir-151a, has-mir-30c-2 and has-mir-
30c-1) and its related target gene in DBA treated intracellular amastigotes as compared to
untreated parasites. Biological pathway analysis of target miRNAs through KEGG analysis
revealed mitogen-activated protein kinase (MAPK) signaling pathway as the most significant
pathway in our analysis. MAPK pathway is well known pathway in Leishmania infection
(Gregory and Olivier, 2005).
To validate the expression profile of these target miRNAs, real time stem-loop PCR was carried
out and PCR product of these target miRNAs were found to be expressed during DBA treated
intracellular amastigotes. Guo et al have reported that miR 15b induces the expression of gene
involved in apoptosis by targeting Bcl-2 and the caspase signaling (Guo, et al., 2009). In our
study the expression level of miR15b in DBA treated intracellular amastigotes was significantly
lower (~2 fold) than untreated cell. We identified ATG5 target gene by KEGG analysis of miR
15b. Williams et al have reported that the ATG5 is essential for ATG8 dependent autophagy and
phospholipid balance in the mitochondrion in Leishmania major (Williams, et al., 2012). So, we
can say that DBA promotes miR 15b expression and plays a role in regulating the balance
between autophagic and apoptotic cell death in intracellular amastigotes.
Zhou et al have reported that miR151a participates in the regulation of cellular respiration and
ATP production by targeting cytochrome b (Zhou, et al., 2015). We found 5-fold downregulation
of miR151a in DBA treated intracellular amastigotes. It means that DBA induces mitochondrial
dysfunction in parasites which can be correlated with our previous work. We had reported that
the main ultrastructural alteration was observed in the mitochondrion-kinetoplast complex,
which showed intense mitochondrial swelling with an increase in the number of cristae and that
was further confirmed with mitochondrial membrane potential dissipation (Chauhan, et al.,
The molecular mechanism involved in the autophagy response in host cell (macrophages)
infected with leishmanial parasites has been well established by Singh et al and they reported
that MIR30A-3p was overexpressed in host cells after infection with Leishmania parasites
(Singh, et al., 2016). In our study, we found 5-fold down regulation of miR30c with more than
800 unique target gene in the DBA treated intracellular amastigotes. So, we can conclude that the
downregulation of miR30c inhibits the proliferation and virulence of Leishmania parasites.
Autophagy pathway is coordinated by autophagy-related proteins ATG (genes encoding
proteins) with similarity to the core ATG proteins in yeast and mammals. They have been
described in Leishmania species, suggesting that these parasites possess a functional autophagy
pathway (Williams, et al., 2009). In miR30c we identified ATG4, ATG9 and ATG16 target gene.
William et al have established that ATG4 activity is required for parasite viability and from
differential expression profiling of DBA treated intracellular amastigotes, we found down
regulation of miR30c whose target gene is ATG4 (Williams, et al., 2013). So, we can conclude
that the down regulation of ATG4 inhibits the cell viability of parasites via regulation of miR 30c
expression. The essential proteins, ATG8 and ATG12/ATG5 required for autophagosome
formation and encoding have been established in L. major genome (Williams, et al., 2012).
ATG8 has been shown to form putative autophagosomes during differentiation and starvation
of L. major. To ascertain whether the several alterations in the ultrastructure that lead to growth
inhibition and eventually cell lysis in the DBA-treated parasites are indeed the result of
autophagy, we proceeded to verify this with the GFP-ATG8 gene. A major overexpressed
protein was detected ~ 40 kDa which is consistent with the predicted mass of the GFP-ATG8
protein. Fluorescence microscopy of the untreated, control parasite demonstrated healthy
promastigote with no GFP fluorescence while the DBA-treated parasite showed green
fluorescence of GFP tagged autophagosome marker, ATG8. The elongated cell body had
changed to a pronounced rounded form with morphological alterations which are visible
parameters of DBA effect on this parasite.
In our study, a total of 13534082 reads for sample AM (macrophages), 30909234 reads for
sample BI (intracellular amastigotes) and 18415476 reads for sample CI (DBA treated
intracellular amastigotes) were generated. A total of 212 known miRNAs from sample BI and
211 known miRNAs from sample CI were identified. A total of 675 targets were pulled out from
mirDIP (mircoRNA Data Integration Portal) for both BI and CI sample respectively. A total of
10 enriched KEGG pathways were identified from target miRNAs (hsa-mir-15b, hsa-mir-671,
hsa-mir-151a, has-mir-30c-2 and has-mir-30c-1). In the present study, we conclude that
curcumin analog DBA triggers imbalance between two known phenotypes of cell death viz
apoptosis and autophagy and thus represents a potential therapeutic value for treatment of
visceral leishmaniasis.
Supplementary data
Table S1. High quality reads data statistics, Table S2. Trimmed reads data statistics, Table S3.
Mapping statistics using Rfam, Table S4. Mapping statistics using BHU1220 strain of
Leishmania. Table S5 and S6 statistics of known and novel miRNAs respectively.
The data sets supporting the results of this article are submitted at https://submit. ncbi.nlm.nih.
gov/subs/biosample/ under BioSample accession numbers:
SAMN07274573 (
SAMN07274574 (
SAMN07274575 (
We are thankful to late Dr. Govind J. Kapadia and Dr. G. Subba Rao for the dibenzalacetone
(DBA), which was a kind gift from them and to Jeremy C. Mottram for the kind gift of GFP-
ATG8 plasmid. This is CDRI communication no.16/2017/NS.
This work was supported by the Council of Scientific & Industrial Research (CSIR), India (grant
number BSC-0114). Indira Singh Chauhan was supported by fellowships from Indian Council of
Medical Research (ICMR).
Transparency declarations
None to declare.
Besteiro, S., Williams, R. A., Morrison, L. S., Coombs, G. H., and Mottram, J. C., 2006.
Endosome sorting and autophagy are essential for differentiation and virulence of
Leishmania major. Journal of Biological Chemistry 281, 11384-11396.
Bhakdi, S. C., Sratongno, P., Chimma, P., Rungruang, T., Chuncharunee, A., Neumann,
H. P., Malasit, P., and Pattanapanyasat, K., 2007. Re‐evaluating acridine orange for rapid
flow cytometric enumeration of parasitemia in malaria‐infected rodents. Cytometry Part
A 71, 662-667.
Chauhan, I. S., SubbaRao, G., Shankar, J. Chauhan, L. K. S., Kapadia, G.J., and Singh, N.,
dibenzalacetone, a synthetic curcumin analog leads to apoptotic cell death in Leishmania
donovani. Parasitology international 67, 627-636.
Chen, Y., McMillan-Ward, E., Kong, J., Israels, S. J., and Gibson, S. B., 2007.
Mitochondrial electron-transport-chain inhibitors of complexes I and II induce
autophagic cell death mediated by reactive oxygen species. Journal of cell science 120,
Williams, R. A., Coombs, G. H., and Mottram, J. C., 2014. Glycosome turnover in
Leishmania major is mediated by autophagy. Autophagy 10, 2143-2157.
Cull, B., Prado Godinho, J. L., Fernandes Rodrigues, J. C., Frank, B., Schurigt, U.,
Felekkis, K., Touvana, E., Stefanou, C., and Deltas, C., 2010. microRNAs: a newly
described class of encoded molecules that play a role in health and disease. Hippokratia
14, 236-240.
Filipowicz, W., Bhattacharyya, S. N., and Sonenberg, N., 2008. Mechanisms of post-
transcriptional regulation by microRNAs: are the answers in sight? Nature Reviews
Genetics 9, 102-114.
Geraci, N. S., Tan, J. C., and McDowell, M. A., 2015. Characterization of microRNA
expression profiles in Leishmania‐infected human phagocytes. Parasite immunology 37,
parasite Leishmania. Parasitology 130, S27-S35.
Gregory, D. and Olivier, M., 2005. Subversion of host cell signalling by the protozoan
Guo, C.-J., Pan, Q., Li, D.-G., Sun, H., and Liu, B.-W., 2009. miR-15b and miR-16 are
implicated in activation of the rat hepatic stellate cell: An essential role for apoptosis.
Journal of hepatology 50, 766-778.
and therapeutic potential. Frontiers in genetics 3, 56.
pteridine reductase inhibitors targeting visceral leishmaniasis. Antimicrobial agents and
chemotherapy 55, 659-666.
Kaur, J., Kumar, P., Tyagi, S., Pathak, R., Batra, S., Singh, P., and Singh, N., 2011. In
silico screening, structure-activity relationship, and biologic evaluation of selective
Hu, G., Drescher, K. M., and Chen, X., 2012. Exosomal miRNAs: biological properties
Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M., 1996. Real time quantitative
PCR. Genome research 6, 986-994.
autophagy. Annual review of genetics 43, 67.
He, C. and Klionsky, D. J., 2009. Regulation mechanisms and signaling pathways of
Kaur, J., Sundar, S., and Singh, N., 2010. Molecular docking, structure–activity
relationship and biological evaluation of the anticancer drug monastrol as a pteridine
reductase inhibitor in a clinical isolate of Leishmania donovani. Journal of antimicrobial
chemotherapy 65, 1742-1748.
Lai, F., Orom, U. A., Cesaroni, M., Beringer, M., Taatjes, D. J., Blobel, G. A., and
Shiekhattar, R., 2013. Activating RNAs associate with Mediator to enhance chromatin
architecture and transcription. Nature 494, 497-501.
protozoan intracellular parasites in host cells. EMBO reports 5, 1142-1147.
Leirião, P., Rodrigues, C. D., Albuquerque, S. S., and Mota, M. M., 2004. Survival of
Lemaire, J., Mkannez, G., Guerfali, F. Z., Gustin, C., Attia, H., Sghaier, R. M., Dellagi,
K., Laouini, D., Renard, P., and Sysco-Consortium, 2013. MicroRNA expression profile
in human macrophages in response to Leishmania major infection. PLoS Negl Trop Dis
7, e2478.
targets for anticancer drug development. Nature reviews Drug discovery 12, 847-865.
Livak, K. J. and Schmittgen, T. D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2− ∆∆CT method. methods 25, 402-408.
O'Connell, R. M., Rao, D. S., Chaudhuri, A. A., and Baltimore, D., 2010. Physiological
Ling, H., Fabbri, M., and Calin, G. A., 2013. MicroRNAs and other non-coding RNAs as
and pathological roles for microRNAs in the immune system. Nature Reviews
Immunology 10, 111-122.
Schmittgen, T. D., Zakrajsek, B. A., Mills, A. G., Gorn, V., Singer, M. J., and Reed, M.
W., 2000. Quantitative reverse transcription–polymerase chain reaction to study mRNA
decay: comparison of endpoint and real-time methods. Analytical biochemistry 285, 194204.
Shukla, A. K., Singh, B. K., Patra, S., and Dubey, V. K., 2010. Rational approaches for
drug designing against leishmaniasis. Applied biochemistry and biotechnology 160,
Singh, A. K., Pandey, R. K., Shaha, C., and Madhubala, R., 2016. MicroRNA expression
profiling of Leishmania donovani-infected host cells uncovers the regulatory role of
MIR30A-3p in host autophagy. Autophagy 12, 1817-1831.
biogenesis in animals. Molecular cell 38, 323-332.
Siomi, H. and Siomi, M. C., 2010. Posttranscriptional regulation of microRNA
Srivastava, S. K., Arora, S., Averett, C., Singh, S., and Singh, A. P., 2015. Modulation of
microRNAs by phytochemicals in cancer: underlying mechanisms and translational
significance. BioMed research international 2015.
Sun, M., Estrov, Z., Ji, Y., Coombes, K. R., Harris, D. H., and Kurzrock, R., 2008.
Curcumin (diferuloylmethane) alters the expression profiles of microRNAs in human
pancreatic cancer cells. Molecular cancer therapeutics 7, 464-473.
Journal of Biological Chemistry 288, 3678-3690.
Williams, R. A., Mottram, J. C., and Coombs, G. H., 2013. Distinct roles in autophagy
and importance in infectivity of the two ATG4 cysteine peptidases of Leishmania major.
TLRs or upon infection with Leishmania infantum chagasi.
Wendlandt, E. B., 2013. Macrophage microRNA and mRNA responses to stimulation of
Williams, R. A., Smith, T. K., Cull, B., Mottram, J. C., and Coombs, G. H., 2012. ATG5
is essential for ATG8-dependent autophagy and mitochondrial homeostasis in
Leishmania major. PLoS Pathog 8, e1002695.
Williams, R. A., Woods, K. L., Juliano, L., Mottram, J. C., and Coombs, G. H., 2009.
Characterization of unusual families of ATG8-like proteins and ATG12 in the protozoan
parasite Leishmania major. Autophagy 5, 159-172.
Yang, C. H., Yue, J., Sims, M., and Pfeffer, L. M., 2013. The curcumin analog EF24
targets NF-κB and miRNA-21, and has potent anticancer activity in vitro and in vivo.
PloS one 8, e71130.
Zhang, J., Zhang, T., Ti, X., Shi, J., Wu, C., Ren, X., and Yin, H., 2010. Curcumin
promotes apoptosis in A549/DDP multidrug-resistant human lung adenocarcinoma cells
through an miRNA signaling pathway. Biochemical and biophysical research
communications 399, 1-6.
infection. RNA biology 10, 371-379.
Zheng, Y., Cai, X., and Bradley, J. E., 2013. microRNAs in parasites and parasite
Zhou, R., Wang, R., Qin, Y., Ji, J., Xu, M., Wu, W., Chen, M., Wu, D., Song, L., and
Shen, H., 2015. Mitochondria-related miR-151a-5p reduces cellular ATP production by
targeting CYTB in asthenozoospermia. Scientific reports 5, 17743.
Table 1: Representation of conserved known miRNAs in BI sample (partial table representation)
Table 2: Representation of conserved known miRNAs in CI sample (partial table representation)
Table 3: Representation of conserved novel miRNAs in BI sample
Table 5: Targets of known miRNAs in BI
Table 6: Targets of known miRNAs in CI
Table 7: 5' UTR Targets of novel miRNAs in BI
Table 8: 3' UTR Targets of novel miRNAs in BI
Table 9: CDS Targets of novel miRNAs in BI
Table 10: 5' UTR Targets of novel miRNAs in CI
Table 11: 3' UTR Targets of novel miRNAs in CI
Table 12: CDS Targets of novel miRNAs in CI
Table 13: Differential expression analysis as BI control and CI treated
Table 14: Total unique target genes from mirDIP darabase
Table 15: Identification KEGG pathways and gene counts
Table 16. Expression ratios of miR hsa-mir-30c-1,hsa-mir-15b, hsa-mir-671, hsa-mir-151a (target miR)
with respect to U6 (Housekeeping).
hsa-mir30c-1 16.43
hsa-mir30c-1 16.43
hsa-mir30c-1 15.88
Ct-hsamir30c-1 16.24666667 0.183333333 16.43
hsa-mir15b 26.21
hsa-mir15b 26.41
0.21825062 -8.18
Down2.583333333 5.596666667 0.020665002 -5.596667 Regulated
Down3.993333333 2.123333333 0.229516005 -2.123333 Regulated
Ct-hsamir-15b 26.29666667 0.059254629 23.00666667 0.056960025 1.87
hsa-mir671 23.62
hsa-mir15b 26.27
CI (CT) Triplicate
BI (CT) \
mir amount Regulation
relative to
B1 2((Log2 Regulation
hsa-mir671 23.66
hsa-mir671 23.6
Ct-hsamir-671 23.62666667 0.017638342 23.42333333 0.227034016 -0.8
hsa-mir151a 19.91
hsa-mir151a 20.64
hsa-mir151a 19.9
0.245017006 20.67333333 0.033333333 4.276666667 1.66
mir-U6 23.4
mir-U6 25.88
mir-U6 24
Ct-U6 24.42666667 0.747023724 19.01333333 0.392697226 0
Down5.936666667 0.016326206 -5.93667 Regulated
Ct-hsamir151a 20.15
Figure legends:
Figure 1. Bioinformatics workflow for smallRNA analysis.
Figure 2.[A] In vitro analysis of antileishmanial activity of DBA in intracellular amastigotes:
Macrophages (4000 cells/well, final volume 200 µl) were infected with promastigotes of L.
donovani in a ratio of 8:1 (parasites/macrophages) and infected macrophages were treated with
increasing concentrations (0, 5, 10, 15 and 20 µg/ml) of DBA for 24 h. After indicated
incubation time, treated or untreated cells were stained with Giemsa stain and the slides were
viewed on an inverted bright field microscope (IX73 Inverted Microscope, Olympus). The 50%
inhibitory concentration (IC50) was obtained by plotting the graph of percentage of cell viability
against log value of DBA concentrations (µg/ml). The results were taken as the mean of
duplicate experiments and p=0.05 has been considered as the level of significance. [B]
Cytotoxicity in macrophages: Macrophages (50,000 cells/well, final volume 200 µl) were treated
with increasing concentrations (0, 10, 20, 40, 80 and 160 µg/ml) of DBA for 24 h. After
indicated incubation time, the viability of the macrophages was estimated by alamarBlue® cell
viability reagent. Results are presented as mean ± SD; n=3 and p=0.05 has been considered as
the level of significance.
Figure 3. [a] Total RNA on 1% denaturing agarose gel. Lane 1: macrophages (AM), Lane 2:
intracellular amastigotes (BI) and Lane 3: DBA treated intracellular amastigotes (CI) [b] 6%
TBE PAGE gel image of cDNA construct of AM and BI samples. [c] 6% TBE PAGE gel image
of cDNA construct of CI sample.
Figure 4. [a] Small RNA library profile of sample macrophages (AM) on Agilent DNA HS
Chip. [b] Small RNA library profile of sample intracellular amastigotes (BI) on Agilent DNA HS
Chip. [c] Small RNA library profile of sample DBA treated intracellular amastigotes (CI) on
Agilent DNA HS Chip.
Figure 5.Venn diagram showing the predicted novel miRNAs targeting the (A) 3' UTR region,
(B) 5' UTR region and (C) CDS region between two groups (BI and CI).
Figure 6. (A) 3% Agarose gel showing Amplified PCR Products (~60bp). Lane 1: 100 bp
Ladder; Lane 2: miR30-C B1; Lane 3: miR30-C C1; Lane 4: miR15b B1; Lane 5: miR15b C1;
Lane 6: miR671 B1; Lane 7: miR671 C1; Lane 8: miR151a B1; Lane 9: miR151a C1; Lane 10:
NTC (No Template Control). (B)Melting Curves of hsa-mir-30c-1, hsa-mir-15b, hsa-mir-671
and hsa-mir-151a (target miR) in both (BI and CI) RNA. The Melting Curves of each of the miR
is shown by their name. (C)Melting Peak of hsa-mir-30c-1, hsa-mir-15b, hsa-mir-671 and hsa-
mir-151a (target miR) in both (BI and CI) RNA. The Melting Peaks of each of the miR is shown
by their name. (D) Expression profiles of hsa-mir-30c-1, hsa-mir-15b, hsa-mir-671 and hsa-mir-
151a (target miR). CI (experimental) are compared against BI (Control) using U6as
housekeeping gene.
Figure 7 [A]. Autophagosome formation was quantified by flow cytometry after staining the
cells with acridine orange (AO). (a) Cells were treated with different concentrations [a, b, c and d
represent 0, 10, 20 and 40 µg/ml respectively] of DBA for 24 h, stained with AO and its
fluorescence was measured using a flow cytometer. Untreated cells were used as control. [B]
Transfection of GFP-ATG8 gene in promastigotes of L. donovani was done by using K2
transfection system. After treatment of DBA, transfectants were processed on a FACS Calibur
flow cytometer. Fluorescence of the GFP was collected in the FL1 channel; analysis for mean
fluorescence intensity was done using CellQuest Pro software. Where (a), (b) and (c) show wild
type parasites (WT), untreated transfectants (UT) and DBA treated transfectant (DT)
respectively. (b) Graph shows quantitative analysis of transfection which is based on GFP mean
fluorescence intensity. [C] Visualization of autophagosome formation in wild type (WT),
untreated (UT) and treated transfectants (DT) were obtained by fluorescence microscopy and
number of GFP-ATG8-labelled autophagosomes within these cells was recorded. [D] To confirm
overexpression of GFP-ATG8 gene in DBA treated transfectant (DT) was carried out by western
blot analysis using GFP antibody. M: protein molecular weight marker, UT: untreated
transfectants, and DT: DBA treated transfectants.
Table 1: Representation of conserved known miRNAs in BI sample (partial table representation)
Length (nt)
Sequence (5’-3’)
Reference miRNA
miRNA family
Table 2: Representation of conserved known miRNAs in CI sample (partial table representation)
Reference miRNA
Sequence (5’-3’)
Length (nt)
miRNA family
Table 3: Representation of conserved novel miRNAs in BI sample
Consensus star
Consensus precursor sequence
Table 4: Representation of conserved novel miRNAs in CI sample
Consensus star
Consensus precursor sequence
Gene Symbol
C11or f24
C11 or f9
Table 5: Targets of known miRNAs in BI
Gene Symbol
C11or f24
C11 or f9
Table 6: Targets of known miRNAs in CI
Table 7: 5' UTR Targets of novel miRNAs in BI
Novel miRNA
Target ID
Hit Acc.
5HSAA092076_BA092076 gi|194382934|dbj|BAG59023.1|
no hit
5HSAA081767_BA081767 gi|694921514|ref|XP_00944136| Predicted: putative
postmeiotic segregation
increased 2-like protein
12 isoform X4 [Pan
5HSAA111419_BA111419 no hit
no hit
5HSAA111419_BA111421 no hit
no hit
5HSAA111420_BA111420 no hit
no hit
5HSAA111441_BA111441 no hit
no hit
5HSAA094709_BA094709 no hit
no hit
no hit
5HSAA092077_BA092077 gi|194382934|dbj|BAG59023.1|
Protein name
Unnamed protein product
[Homo sapiens]
Unnamed protein product
[Homo sapiens]
Table 8: 3' UTR Targets of novel miRNAs in BI
Target ID
Hit Acc.
3HSAA174308_CA174308 gi|344247605|gb|EGW03709.1|
3HSAA050307_CA050307 no hit
Novel miRNA
Protein name
Glyceraldehyde-3phosphate dehydrogenase,
testis-specific [Cricetulus
no hit
Table 9: CDS Targets of novel miRNAs in BI
Protein name
Protein disulfide-isomerase A6
isoform d precursor [Homo
Ceramide synthase 3 isoform 1
[Homo sapiens]
Ceramide synthase 3 isoform 1
[Homo sapiens]
Ceramide synthase 3 isoform 1
[Homo sapiens]
Cathepsin S isoform 1
preproprotein [Homo sapiens]
Cathepsin S isoform 2
preproprotein [Homo sapiens]
1.1|unnamed protein product
[Homo sapiens]
Chain A, Pyrazole-Based
Cathepsin S Inhibitors With
Arylalkynes As P1 Binding
Cathepsin S, partial [Homo
Hit Acc.
Target ID
Novel miRNA
Table 10: 5' UTR Targets of novel miRNAs in CI
Novel miRNA
Target ID
Hit Acc.
5HSAA060154_BA060154 gi|521029117|gb|EPQ10905.1|
no hit
no hit
no hit
gi|432105116 |gb|ELK31485.1|
5HSAA060154_BA060155 gi|521029117| gb|EPQ10905.1|
5HSAA098157_BA098157 gi|562875850| ref|XP_006165720.1
Protein name
Hypothetical protein
d623_10027736 [Myotis
Hypothetical protein
d623_10027736 [Myotis
no hit
no hit
no hit
Putative tumor
suppressor protein MN1
[Myotis brandtii]
protein Shroom4-like
[Tupaia chinensis]
PREDICTED: protein
argonaute 12-like[Pan
5HSAA044294_BA044294 gi|675780980| ref|XP_008976930.1
Target ID
Hit Acc.
Novel miRNA
Table 11: 3' UTR Targets of novel miRNAs in CI
no hit
Protein name
Tropomodulin-1 [Pan
PREDICTED: thiosulfate
sulfurtransferase/rhodaneselike domain-containing protein
2 isoform X2 [Homo sapiens]
Tropomodulin-1 [Pan
Tropomodulin-1 [Pan
Tropomodulin-1 [Pan
Tropomodulin-1 [Pan
Tropomodulin-1 [Pan
no hit
Table 12: CDS Targets of novel miRNAs in CI
ADAMTS-like protein 3 isoform
a precursor [Homo sapiens]
Ceramide synthase 3 isoform 1
[Homo sapiens]
Ceramide synthase 3 isoform 1
[Homo sapiens]
Ceramide synthase 3 isoform 1
[Homo sapiens]
Cathepsin S isoform 1
preproprotein [Homo sapiens]
Cathepsin S isoform 2
preproprotein [Homo sapiens]
1.1|unnamed protein product
[Homo sapiens]
Chain A, Pyrazole-Based
Cathepsin S Inhibitors With
Arylalkynes As P1 Binding
Cathepsin S, partial [Homo
Protein name
Protein disulfide-isomerase A6
isoform d precursor [Homo
ADAMTS-like protein 3 isoform
a precursor [Homo sapiens]
Hit Acc.
Target ID
Novel miRNA
Table 13: Differential expression analysis as BI control and CI treated
P Value
Down Regulated
Down Regulated
Up Regulated
Down Regulated
Down Regulated
Down Regulated
Down Regulated
Down Regulated
Down Regulated
Down Regulated
Down Regulated
Down Regulated
Down Regulated
count count
Table 14: Total unique target genes from mirDIP darabase
Total unique pulled target genes from mirDIP database
Table 15: Identification KEGG pathways and gene counts
C=326;O=225;E=69.66;R=3.23;rawP=1.98e-76;adjP=2.24 e-74
Pathway Name
Metabolic pathways
Pathway in cancer
MAPK signaling pathway
Regulation of actin cytoskeleton
Focal adhesion
Insulin signaling pathway
Wnt signaling pathway
Calcium signaling pathway
Axon guidance
To explore the leishmaniacidal role of trans-dibenzalacetone (DBA) on the expression
profile of miRNA in intracellular amastigotes of Leishmania donovani.
mir-151a) and autophagy (has-mir-30c).
DBA triggers imbalance between two known phenotypes of cell death viz apoptosis (hsa-
Без категории
Размер файла
17 256 Кб
018, 2018, exppara
Пожаловаться на содержимое документа