close

Вход

Забыли?

вход по аккаунту

?

j.lfs.2018.08.041

код для вставкиСкачать
Accepted Manuscript
LncRNA HOX transcript antisense RNA accelerated kidney
injury induced by urine-derived sepsis through the miR-22/high
mobility group box 1 pathway
Jun Shen, Junhao Zhang, Xinan Jiang, Huan Wang, Guanghui Pan
PII:
DOI:
Reference:
S0024-3205(18)30486-7
doi:10.1016/j.lfs.2018.08.041
LFS 15888
To appear in:
Life Sciences
Received date:
Revised date:
Accepted date:
18 May 2018
13 August 2018
15 August 2018
Please cite this article as: Jun Shen, Junhao Zhang, Xinan Jiang, Huan Wang, Guanghui
Pan , LncRNA HOX transcript antisense RNA accelerated kidney injury induced by
urine-derived sepsis through the miR-22/high mobility group box 1 pathway. Lfs (2018),
doi:10.1016/j.lfs.2018.08.041
This is a PDF file of an unedited manuscript that has been accepted for publication. As
a service to our customers we are providing this early version of the manuscript. The
manuscript will undergo copyediting, typesetting, and review of the resulting proof before
it is published in its final form. Please note that during the production process errors may
be discovered which could affect the content, and all legal disclaimers that apply to the
journal pertain.
ACCEPTED MANUSCRIPT
LncRNA HOX transcript antisense RNA accelerated kidney injury induced by
urine-derived sepsis through the miR-22/ high mobility group box 1 pathway
Running title: HOTAIR accelerated sepsis-induced kidney injury
PT
Jun Shen1#*, Junhao Zhang2#, Xinan Jiang2, Huan Wang3, Guanghui Pan1
RI
1 Department of Organ Transplantation, The Affiliated Hospital, Guizhou Medical
University, Guiyang; 550004, China
SC
2 Department of Urology, The Affiliated Hospital, Guizhou Medical University,
Guiyang; 550004, China
NU
3 Department of Human Anatomy&Histoembryology, School of Basic Medical,
MA
Guizhou Medical University, Guiyang; 550025, China
D
#These authors contributed equally.
PT
E
*Corresponding author: Jun Shen, MD. Mailing address: Department of Organ
Transplantation, The Affiliated Hospital, Guizhou Medical University, Address: 28
Guiyi Rd., Guiyang 550004, People’s Republic of China.
CE
TEL: +86-0851-86773096
AC
E-mail: dewu98888444000@163.com
ACCEPTED MANUSCRIPT
LncRNA HOX transcript antisense RNA accelerated kidney injury induced by
urine-derived sepsis through the miR-22/ high mobility group box 1 pathway
AC
CE
PT
E
D
MA
NU
SC
RI
PT
Running title: HOTAIR accelerated sepsis-induced kidney injury
ACCEPTED MANUSCRIPT
Abstract
Objective: This study investigated the role of long noncoding RNA (lncRNA) HOX
transcript antisense RNA (HOTAIR) in kidney injury induced by urine-derived sepsis
(US).
Materials and methods: An Escherichia coli suspension was injected into the distal
PT
ureter of adult male Sprague Dawley rats to establish a US model.
Lipopolysaccharides (LPSs) were used to induce an in vitro septic model. The
RI
interaction between HOTAIR and microRNA 22 (miR-22) was detected by RNA
precipitation and RNA pull-down assays. The expression of HOTAIR, miR-22, and
SC
high mobility group box 1 (HMGB1) were detected by quantitative real time
polymerase chain reaction (qRT-PCR) and Western blot analyses.
NU
Results: Compared with a sham group, HOTAIR was upregulated in kidney tissues of
the US group. HOTAIR was also upregulated in LPS-induced human renal tubular
MA
epithelial cells (HK-2). Furthermore, HOTAIR negatively regulated miR-22 and
promoted apoptosis of HK-2 cells. HOTAIR also promoted HMGB1 expression and
D
HK-2 cell apoptosis by inhibiting miR-22. In addition, the miR-22/HMGB1 pathway
PT
E
was involved in LPS-induced HK-2 cell apoptosis. In vivo experiments showed that
HOTAIR negatively modulated miR-22 and positively modulated HMGB1 and that
HOTAIR knockdown decreased renal function indicators (blood urea nitrogen [BUN]
CE
and serum creatinine).
Conclusion: HOTAIR was upregulated in sepsis-induced kidney injury, which
AC
promoted HK-2 cell apoptosis in kidney injury through the miR-22/HMGB1 pathway.
Keywords: LncRNA HOTAIR; miR-22; HMGB1; sepsis; kidney injury
Introduction
Sepsis is a systemic inflammatory response syndrome caused by bacterial, viral
or fungal infection, which leads to cellular or organ injury when the body responds to
the infection [1]. Acute kidney injury is a common sequela of sepsis and results in
increased mortality, prolonged stays in the intensive-care unit, and decreased abilities
to filter blood in the kidney [2]. According to previous research, the incidence of acute
ACCEPTED MANUSCRIPT
kidney injury caused by severe sepsis can be as high as 60% [3]. Therefore, timely
interventions are needed in cases of acute kidney injury induced by sepsis to prevent
and treat kidney injury. However, the latter is hampered by a lack of understanding of
the mechanisms underlying sepsis-induced acute kidney injury.
High mobility group box 1 (HMGB1) is a nonhistone chromatin-related nuclear
PT
protein that is widely distributed in mammalian cells [4,5]. HMGB1 functions as a
key mediator in the progression of sepsis, and it is highly expressed in serum and
RI
kidney tissues of septic mice [6]. HMGB1 accelerates proinflammatory responses by
interacting with toll-like receptor 2 (TLR2), TLR4, and the receptor for advanced
SC
glycation end products to stimulate the production of proinflammatory cytokines [7].
This interaction results in an increase in the permeability of blood vessels, the
NU
activation of coagulation, and the formation of microvascular thrombosis [7]. In
previous research, a high level of HMGB1 in sepsis indicated high mortality and
MA
predicted a poor prognosis, and a reduction in the expression level of HMGB1 was
associated with improved survival in human and murine sepsis [8,9]. However, the
D
upstream signaling pathway of HMGB1 is not fully understood.
PT
E
Long noncoding RNAs (lncRNAs) are transcripts more than 200 nt in length,
and they regulate target genes by functioning as decoys, scaffolds, guides, or
enhancers [10]. LncRNA HOX transcript antisense RNA (HOTAIR), which was first
CE
found in breast tumors [11], plays an important role in a variety of cancers [12,13] and
diseases, including multiple sclerosis [14], nontraumatic osteonecrosis of the femoral
AC
head [15], and ischemic infarcts [16]. Wu et al. discovered that lncRNA HOTAIR was
highly expressed in cardiomyocytes in a murine model of sepsis and that it facilitated
tumor necrosis factor-α production [17]. In the same study, they showed that small
interference RNA targeting HOTAIR (si-HOTAIR) improved the cardiac function of
septic mice. Hong et al. detected lncRNA HOTAIR in kidney tissue [18]. However,
the role of lncRNA HOTAIR in urine-derived sepsis (US) is not clear. Ge et al. found
that microRNA 22 (miR-22) was markedly decreased in patients with kidney injury
induced by sepsis [19]. Other studies demonstrated that miR-22 could directly target
HMGB1 in different physiological processes [20,21]. Bioinformatics software
ACCEPTED MANUSCRIPT
(DIANA)
(http://carolina.imis.athena-innovation.gr/diana_tools/web/index.php?r=site%2Findex)
is available to predict the binding sites between lncRNA HOTAIR and miR-22. This
study investigated the role of lncRNA HOTAIR in kidney injury induced by US. We
hypothesized that lncRNA HOTAIR would accelerate kidney injury induced by US
PT
through the miR-22/HMGB1 pathway.
RI
Materials and methods
Establishment of the US model
SC
Adult male Sprague Dawley rats weighing 220–250 g were purchased from the
laboratory animal center of Guizhou Medical University and kept in a 12-h light/12-h
NU
dark environment, with free access to food and water. The rats were randomly divided
into a sham group (n = 6) and US group (n = 6). All the rats were intraperitoneally
MA
injected with 10% chloral hydrate (Sinopharm Chemical Reagent, Shanghai, China)
for anesthesia. An incision was then made along the left rectus muscle. In the US
D
group, the left ureter was separated and ligated at the middle section to form an acute
PT
E
upper urinary tract obstruction. An Escherichia coli suspension (ATCC 25922, 1 ×
108/ml, 0.5 ml/kg) was then injected into the distal ureter. In the sham group, after
separation of the left ureter, the incision was sutured without any treatment of the
CE
ureter. Left kidney tissues were collected 24 h after the surgery. Part of the left kidney
tissue was fixed with formalin solution and embedded with paraffin, and the rest was
AC
washed with phosphate buffered saline (PBS) and stored at -80° C. The animal
experiment was approved by the ethics committee of the Affiliated Hospital of
Guizhou Medical University (No. 1701999).
Cell culture and transfection
The human renal tubular epithelial cell line HK-2 was purchased from the Cell
Bank of the Chinese Academy of Sciences and cultured in keratinocyte serum-free
medium with L-glutamine (Gibco, CA, USA) containing 100 U/ml of penicillin and
100 mg/ml of streptomycin (Sinopharm Chemical Reagent, Shanghai, China) under
an atmosphere of 5% CO2 at 37° C. To stimulate an in vitro lipopolysaccharide
ACCEPTED MANUSCRIPT
(LPS)-induced septic model, the HK-2 cells were treated with 1 μg/mL of LPS (Sigma,
NJ, USA) for 24 h.
pcDNA-HOTAIR was constructed by inserting HOTAIR cDNA into pcDNA3.1
(Invitrogen, CA, USA). For HOTAIR knockdown, si-HOTAIR was synthesized by
GENECHEM (Shanghai, China). The LPS-treated HK-2 cells were seeded at 5 × 105
PT
cells/well in a six-well plate and cultured until 50% confluence, then transfected with
empty vectors, si-HOTAIR, pcDNA-HOTAIR, or an miR-22 inhibitor (ThermoFisher
RI
Scientific, CA, USA) using Lipofectamine™ 2000 Transfection Reagent (Invitrogen,
CA, USA). For in vivo experiments, 100 μl of si-control or si-HOTAIR were injected
SC
into US rats through the tail vein at a lentivirus titer of 5 × 107TU/ml.
Quantitative real-time polymerase chain reaction
NU
Total RNA was isolated from kidney tissues or HK-2 cells using TRIzol™
reagent (Invitrogen, CA, USA). The SuperScript™ IV One-Step RT-PCR System
MA
(Invitrogen, CA, USA) was used for cDNA synthesis. The QuantStudio 3 Real-Time
PCR System (Applied Biosystems, CA, USA) was used to analyze HOTAIR, miR-22,
D
and HMGB1 expression. The relative expression of lncRNA HOTAIR, miR-22, and
PT
E
HMGB1 were expressed as a function of the threshold cycle (Ct) and analyzed by the
2-Ct method. The primers are shown in Table 1.
Western blotting
CE
The kidney tissues and HK-2 cells were lysed in Radio Immunoprecipitation
Assay (RIPA) buffer (Beyotime Biotechnology, Shanghai, China), and a BCA protein
AC
assay kit (Beyotime Biotechnology, Shanghai, China) was used to detect the protein
concentration.
Proteins
were
separated
by
12%
sodium
dodecyl
sulfate
polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride
membrane. Blots were incubated with primary antibodies against HMGB1 (Catalog #
PA1-16926; Invitrogen, CA, USA), cleaved-caspase-3 (#9661; Cell Signaling
Technology, MA, USA), β-actin (A1978; Sigma, NJ, USA), and horseradish
peroxidase-conjugated secondary antibody (ab205718; Abcam, TX, USA). The blots
were visualized using ImageQuantTM LAS 4000mini (GE Healthcare, NJ, USA).
Flow cytometry analysis
ACCEPTED MANUSCRIPT
Cell apoptosis was determined using an Annexin V-FITC apoptosis detection kit
(Beyotime Biotechnology, Shanghai, China). After trypsin digestion, HK-2 cells from
the different groups were collected, washed with PBS three times, and resuspended at
5 × 105 cells/ml. Cell apoptosis was detected by BD FACSCanto II flow cytometry
(BD, CA, USA) and analyzed using CellQuest software.
RNA immunoprecipitation (RIP)
PT
A Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, MA,
RI
USA) and AGO2 antibody were used for the RIP assay. HK-2 cell lysate (100 μl) was
prepared (1.5 × 107 cells) using 0.5 μl of protease inhibitor, 0.25 μl of RNase inhibitor,
prepared,
and
RNA-binding
protein
SC
and 100 μl of RIP lysis buffer. Magnetic beads for immunoprecipitation were
complex
was
obtained.
NU
immunoprecipitation-Western blot protocol used for AGO2 detection, and lncRNA
HOTAIR and miR-22 in the precipitates were measured by qRT-PCR.
MA
RNA pull-down
Biotin-labelled lncRNA HOTAIR was transcribed with Biotin RNA Labeling Mix
D
(Roche, Switzerland) and T7 RNA polymerase (Roche, Basel, Switzerland). The
PT
E
HK-2 cell lysate was prepared (1.5 × 107 cells) in RIP buffer and then mixed with the
biotin-labeled lncRNA HOTAIR at 4° C for 1 h. Beads were added to each binding
reaction and incubated at room temperature for 1 h. Western blotting used for AGO2
CE
detection, and qRT-PCR was performed to detect miR-22 expression in the three
groups of precipitates.
AC
Enzyme-linked immunosorbent assay
Venous blood was collected from the sham and US rats after the injection of a
lentivirus and then stored at -80° C after centrifugation. Blood urea nitrogen (BUN)
and serum creatinine were determined using a Urea Nitrogen Colorimetric Detection
Kit and Creatinine Urinary Detection Kit (Invitrogen, CA, USA).
Statistical analysis
SPSS software (Version 17.0, USA) was used for statistical analyses. All data were
presented as mean ± standard deviation. Between-group differences were assessed by
a t-test or one-way analysis of variance, with a significance level of p < 0.05.
ACCEPTED MANUSCRIPT
Results
lncRNA-HOTAIR was upregulated in the US rat model
As lncRNA-HOTAIR promotes tumor necrosis factor-α production in
cardiomyocytes of septic mice, and HOTAIR silencing improved cardiac function of
sepsis mice, we explored the function of lncRNA-HOTAIR in a US model established
PT
by an injection of an E.coli (ATCC 25922) suspension. Left kidney tissues were
collected 24 h later, and HOTAIR, miR-22, and HMGB1 levels were determined by
RI
qRT-PCR and Western blots. The results revealed that lncRNA-HOTAIR was
upregulated in left kidney tissues of the US group as compared with that in the sham
SC
group (Fig. 1A). In contrast, miR-22 was downregulated in left kidney tissues of the
US group as compared with that in the sham group (Fig. 1B). The mRNA and protein
NU
levels of HMGB1 were upregulated in left kidney tissues of the US group as
compared with those in the sham group (Figure 1C). HE staining showed that the
MA
injury of the left kidney in the US group was more severe than in the sham group.
LPS increased the lncRNA-HOTAIR level in HK-2 cells
D
The HK-2 cells were prepared and treated with LPS to stimulate an in vitro
PT
E
LPS-induced septic model. As shown in Figure 2A, lncRNA-HOTAIR was
upregulated in the LPS group as compared with that in a control group (cells treated
with vehicle). As compared with the control group, miR-22 was downregulated in the
CE
LPS group Fig. 2B). In contrast, HMGB1 was upregulated in the LPS group as
compared with that in the control group (Fig. 2C). These findings suggested that an in
AC
vitro LPS-induced septic model was successfully established.
HOTAIR negatively regulated the expression of miR-22
According to bioinformatics software predictions, there were binding sites
between HOTAIR and miR-22 (Fig. 3A). The RNA immunoprecipitation assay
revealed that miR-22 was accumulated AGO2 antibody complex (Fig. 3B). In contrast
to IgG, miR-22 and HOTAIR were enriched in AGO2 antibody complex (Figure 3B).
The RNA pull-down assay detected AGO2 in HOTAIR pull-down complexes (Fig.
3C). In addition, miR-22 was enriched in HOTAIR pull-down complexes (Fig. 3D).
HOTAIR promoted HMGB1 expression and regulated HK-2 cell apoptosis via
ACCEPTED MANUSCRIPT
miR-22
Previous studies demonstrated that miR-22 targeted to the 3' untranslated region
(UTR) of HMGB1 participated in cell proliferation of occlusive arterial disease and
osteosarcomas [19, 20]. Based on the interaction between HOTAIR and miR-22, we
speculated that HOTAIR might regulate HMGB1 via miR-22 and that it might be
PT
involved in the apoptosis of HK-2 cells. As shown in Figure 4A, LPS promoted
HMGB1 expression, si-HOTAIR inhibited HMGB1 expression, and an miR-22
RI
inhibitor reversed si-HOTAIR-induced inhibition of HMGB1 expression. Furthermore,
LPS promoted HK-2 cell apoptosis (7.63 ± 0.29% vs. 28.48 ± 0.99%, p < 0.05),
SC
si-HOTAIR inhibited HK-2 cell apoptosis (27.72 ± 0.58% vs. 12.22 ± 0.58%, p <
0.05), and the miR-22 inhibitor reversed si-HOTAIR-induced inhibition of cell
NU
apoptosis (12.78 ± 0.30% vs. 19.33 ± 0.68%, p < 0.05), as shown in Figure 4B. The
LPS treatment also elevated apoptosis protein cleaved-caspase-3 expression, whereas
MA
si-HOTAIR suppressed cleaved-caspase-3 expression, and the miR-22 inhibitor
reversed si-HOTAIR-induced suppression of cleaved-caspase-3 expression (Fig. 4C).
D
These data indicated that HOTAIR played a role in the promotion of HMGB1
PT
E
expression and HK-2 cell apoptosis by inhibiting miR-22.
LPS promoted HK-2 cell apoptosis via the miR-22/HMGB1 pathway
Following the successful induction of the in vitro septic model induced by LPS,
CE
the mechanism of LPS in inducing HK-2 cell apoptosis in sepsis was explored. The
results revealed that LPS promoted HK-2 cell apoptosis (6.25 ± 0.60% vs. 27.45 ±
AC
1.00%, p < 0.05). In addition, a miR-22 mimic reduced HK-2 cell apoptosis (26.54 ±
0.62% vs. 13.24 ± 0.50%, p < 0.05), and pcDNA-HMGB1 reversed the inhibitory
effect of miR-22 on HK-2 cell apoptosis (13.69 ± 0.32% vs. 20.02 ± 0.23%, p < 0.05),
as presented in Figure 5A. At the same time, LPS upregulated cleaved-caspase-3
expression, the miR-22 mimic decreased cleaved-caspase-3 expression, and
pcDNA-HMGB1 reversed the inhibitory effect of miR-22 on cleaved-caspase-3
expression (Fig. 5B). These data indicated that the miR-22/HMGB1 pathway was
involved in LPS-induced HK-2 cell apoptosis.
si-HOTAIR relieved kidney injury induced by US
ACCEPTED MANUSCRIPT
As HOTAIR was upregulated in left kidney tissue of the US rats and promoted
apoptosis of HK-2 cells, si-HOTAIR was injected into the US rats to observe the
effect of HOTAIR on kidney injury. HE staining showed that left kidney injury in the
si-control group was more severe than that in the si-HOTAIR group (Fig. 6A).
Compared with the si-control group, renal function indicators (BUN and serum
PT
creatinine) were downregulated in the si-HOTAIR group, which indicated that
si-HOTAIR relieved kidney injury (Fig. 6A). Compared with the si-control group,
RI
lncRNA-HOTAIR and HMGB1 were downregulated in the si-HOTAIR group, and
miR-22 was upregulated in the si-HOTAIR group (Fig. 6B). These findings showed
SC
that HOTAIR negatively modulated miR-22 and positively modulated HMGB1 in
NU
vivo.
Discussion
MA
Sepsis can cause cell injury and organ dysfunction far from the primary site of
injury, which leads to multiple organ failure. Thus, sepsis is a major public health
D
concern, with an increasing incidence. Even when sepsis is not fatal, the patient may
PT
E
suffer long-term cognitive, psychological, and physical disabilities [1]. The incidence
of kidney injury increases with the severity of sepsis [22]. The role of apoptosis in the
progression of kidney injury, which can be triggered by ischemia, exogen toxins, or
CE
endogen mediators, has attracted research attention [23]. Proximal tubule epithelial
cells are highly susceptible to apoptosis, and injury at this site of proximal tubule
AC
epithelial injury contributes to kidney failure [24]. As is well known, LPS, which is a
component of the cell wall of gram-negative bacteria, is associated with renal tubular
epithelial cell apoptosis and acute kidney injury [25,26]. LPS is commonly used in the
induction of apoptosis in in vivo and in vitro models of acute kidney injury [27,28].
Previous studies demonstrated that HMGB1, as a late mediator of sepsis,
mediated the inflammatory response and controlled apoptosis and autophagy during
inflammation [29]. They also showed that HMGB1 was essential in the response to
organ injuries, such as brain [30], liver [31], and kidney [32] injuries, during sepsis.
The expression of HMGB1 increased in chronic kidney disease, and this increase
ACCEPTED MANUSCRIPT
induced splenic apoptosis [32]. Although pervious research showed that HMGB1 was
upregulated in kidney tissues of septic mice [6], the underlying mechanism was
unclear. Furthermore, the upstream molecules that regulate HMGB1 in sepsis-induced
kidney injury were not known. In this study, the findings shed light on the underlying
mechanism of HMGB1 in sepsis-induced kidney injury, which is meaningful.
PT
Based on miR-22 targeted to the HMGB1 3′UTR in arterial smooth muscle cell
and osteosarcoma cells, we speculate that miR-22 might serve as an upstream
RI
regulator of HMGB1 in kidney injury induced by US. As demonstrated by the results,
miR-22 was downregulated in kidney tissue in our US rat model and LPS-induced
SC
HK-2 cells. Furthermore, overexpression of miR-22 inhibited HK-2 cell apoptosis
through regulating HMGB1. In terms of novel aspects of the present study, to the best
NU
of our knowledge, no other studies have demonstrated the role of miR-22/HMGB1 in
the regulation of HK-2 cell apoptosis in an in vitro septic model. The findings enrich
MA
the literature and provide directions for the treatment of US.
Only a few lncRNAs have been comprehensively investigated in sepsis-induced
D
kidney injury. In 2015, unbiased whole transcriptome profiling of human proximal
PT
E
tubular epithelial cells was performed to characterize lncRNAs in hypoxic and
inflammatory renal
epithelial
injury, which provided insights
into novel
transcriptomic variations in renal epithelial injury [33]. An lncRNA microarray of
CE
lncRNA expression profiles from three patients with sepsis-induced kidney injury and
matched control serum samples found 5,361 upregulated lncRNAs and 5,928
AC
downregulated lncRNAs in a sepsis-induced kidney injury group [34]. The lncRNA
PVT1 was the first lncRNA to be studied in detail in septic acute kidney injury, and its
possible downstream signaling pathway in regulating inflammatory response was
revealed [35]. More studies on lncRNAs in sepsis-induced kidney injury are needed to
shed light on the pathological process of US.
LncRNA HOTAIR, an oncogene that has been widely studied in various cancers,
(e.g., pancreatic, esophageal, and thyroid), promotes cancer progression and predicts a
poor prognosis [36,37]. Studies on HOTAIR in sepsis are rare, with only one study
describing the role of HOTAIR in cardiomyocytes of LPS-induced sepsis [17].
ACCEPTED MANUSCRIPT
Studies are needed to discover the underlying mechanism of HOTAIR in other
sepsis-induced organ injuries. In this study, HOTAIR was upregulated in kidney tissue
in the US rat model and LPS-induced HK-2 cells. The present study also
demonstrated an interaction between HOTAIR and miR-22. After HOTAIR
knockdown, HMGB1 was decreased in HK-2 cells, and HK-2 cell apoptosis was
PT
inhibited. In contrast, the miR-22 inhibitor further increased HMGB1 expression and
promoted HK-2 cell apoptosis. To the best of our knowledge, no other studies have
RI
demonstrated the expression of lncRNA HOTAIR in in vivo and in vitro septic model,
and the role of lncRNA HOTAIR regulates HMGB1 expression by targeting miR-22,
SC
which reveal the potential underlying mechanism of lncRNA HOTAIR in the
modulation of kidney injury induced by US and enrich the literature.
NU
In conclusion, HOTAIR was upregulated in sepsis-induced kidney injury, and it
promoted HK-2 cell apoptosis in kidney injury through the miR-22/HMGB1 pathway.
MA
This study detected an interaction between HOTAIR and miR-22 and the role of the
HOTAIR/miR-22/HMGB1 signaling pathway in sepsis-induced kidney injury. The
D
findings point to potential targets for the prevention and treatment of sepsis-induced
Financial support
PT
E
kidney injury.
CE
This study was supported by the Joint Foundation of Guiyang Science and
AC
Technology Bureau and Guizhou Medical University (No. GY2017-16).
Conflict of interest
None.
Figure legends
Figure 1. lncRNA-HOTAIR was upregulated in left kidney tissues in a US rat model.
qRT-PCR was used to detect relative HOTAIR, miR-22, and HMGB1 levels in left
kidney tissues of sham and US groups. Western blots were used to detect HMGB1
expression in left kidney tissues of the sham and US groups. A. As compared with the
ACCEPTED MANUSCRIPT
sham group, BUN and serum creatinine were upregulated in US group. HE staining
revealed kidney damage in the US rats. B. As compared with the sham group,
lncRNA-HOTAIR was upregulated in the US group. C. As compared with the sham
group, miR-22 was downregulated in the US group. D. As compared with the sham
PT
group, HMGB1 was upregulated in the US group. *p < 0.05 versus sham.
Figure 2. LPS increased the lncRNA-HOTAIR level in HK-2 cells. A. As compared
RI
with the control group (cells treated with vehicle), lncRNA-HOTAIR was upregulated
in the LPS group (HK-2 cells treated with LPS). B. As compared with the control
SC
group, miR-22 was downregulated in the LPS group. C. As compared with the control
group, mRNA and protein levels of HMGB1 were upregulated in the LPS group. *p <
NU
0.05 versus control.
MA
Figure 3. HOTAIR regulated the expression of miR-22. A. Binding sites between
HOTAIR and miR-22. B. Accumulation of HOTAIR and miR-22 in AGO2 antibody
D
complex as shown by an RIP assay. The immunoprecipitation-Western blot protocol
PT
E
was used for AGO2 detection, and qRT-PCR was used to measure HOTAIR and
miR-22 expression. C. Western blotting was used to detect AGO2 in HOTAIR
pull-down complexes. D. miR-22 was enriched in HOTAIR pull-down complexes. *p
CE
<0.05 versus Immunoglobulin G (IgG), #p <0.05 versus NC.
AC
Figure 4. HOTAIR regulated HMGB1 expression and HK-2 cell apoptosis via
miR-22. The HK-2 cells were divided into control, LPS, LPS + si-control, LPS +
si-HOTAIR, LPS + si-HOTAIR+NC, and LPS + si-HOTAIR + miR-22 inhibitor
groups. A. LPS promoted HMGB1 expression, si-HOTAIR inhibited HMGB1
expression, and the miR-22 inhibitor reversed the inhibitory effect of si-HOTAIR on
HMGB1 expression. B. LPS promoted HK-2 cell apoptosis, si-HOTAIR inhibited
HK-2 cell apoptosis, and the miR-22 inhibitor reversed the inhibitory effect of
si-HOTAIR on cell apoptosis. C. LPS elevated cleaved caspase-3 expression,
si-HOTAIR suppressed cleaved caspase-3 expression, and the miR-22 inhibitor
ACCEPTED MANUSCRIPT
reversed si-HOTAIR-induced suppression of cleaved caspase-3 expression. *p < 0.05
vs control, #p <0.05 vs. si-control, p <0.05 versus. negative control (NC).
Figure 5. LPS promoted HK-2 cell apoptosis via the miR-22/HMGB1 pathway. The
HK-2 cells were divided into control, LPS, LPS + pre-NC, LPS + miR-22 mimic, LPS
PT
+ miR-22 mimic + pcDNA, and LPS + miR-22 mimic + pcDNA-HMGB1 groups. A.
LPS promoted HK-2 cell apoptosis, the miR-22 mimic reduced HK-2 cell apoptosis,
RI
and pcDNA-HMGB1 reversed the inhibitory effect of miR-22 on HK-2 cell apoptosis.
B. LPS u-regulated cleavedcaspase-3 expression, the miR-22 mimic decreased
SC
cleaved caspase-3 expression, and pcDNA-HMGB1 reversed the inhibitory effect of
miR-22 on cleaved caspase-3 expression. *p <0.05 versus control, #p < 0.05 versus
NU
pre-NC, p <0.05 versus pcDNA.
MA
Figure 6. si-HOTAIR relieved kidney injury induced by US. A. HE staining of the left
kidney showed that the kidney injury was relieved in the si-HOTAIR group as
D
compared with that in the si-control group. As compared with the si-control group,
PT
E
BUN and serum creatinine were downregulated in the si-HOTAIR group. B. As
compared with the si-control group, lncRNA-HOTAIR and HMGB1 were
downregulated in the si-HOTAIR group, and miR-22 was upregulated in the
CE
si-HOTAIR group. *p <0.05 versus si-control.
AC
Table caption
Table 1. Primers used in qRT-PCR.
References
[1] C.W. Seymour, V.X. Liu, T.J. Iwashyna, F.M. Brunkhorst, T.D. Rea, A. Scherag, G. Rubenfeld, J.M.
Kahn, M. Shankarhari, M. Singer, Assessment of Clinical Criteria for Sepsis: For the Third
International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3), Jama 315 (2016)
762-774.
[2] L. Zafrani, B. Ergin, A. Kapucu, C. Ince, Blood transfusion improves renal oxygenation and renal
function in sepsis-induced acute kidney injury in rats, Journal of Instrumental Analysis 20
(2016) 406.
ACCEPTED MANUSCRIPT
[3] J. Mårtensson, R. Bellomo, Sepsis-Induced Acute Kidney Injury, Critical Care Clinics 31 (2015)
649-660.
[4] T. Gao, Z. Chen, H. Chen, H. Yuan, Y. Wang, X. Peng, C. Wei, J. Yang, C. Xu, Inhibition of HMGB1
mediates neuroprotection of traumatic brain injury by modulating the microglia/macrophage
polarization, Biochem. Biophys. Res. Commun. 497 (2018) 430-436.
[5] A. Kummarapurugu, S. Zheng, J. Ledford, S. Karandashova, J. Voynow, High-Mobility Group Box 1
Upregulates MUC5AC and MUC5B Expression in Primary Airway Epithelial Cells, Am. J. Respir.
Cell Mol. Biol. 58 (2018) 126-128.
[6] J. Lee, E. Seo, C. Oh, J. Paik, D. Hwang, S. Lee, S. Kim, Impact Of Circulating T Helper 1 And 17 Cells
PT
in the Blood on Regional Lymph Node Invasion in Colorectal Cancer, J Cancer 8 (2017)
1249-1254.
RI
[7] J.S. Bae, A.R. Rezaie, Activated protein C inhibits high mobility group box 1 signaling in endothelial
cells, Blood 118 (2011) 3952-3959.
experimental sepsis, Shock 41 (2014) 324.
SC
[8] H. Wang, D. Liu, Baicalin inhibits high-mobility group box 1 release and improves survival in
[9] T. Li, Y. Gui, T. Yuan, G. Liao, C. Bian, Q. Jiang, S. Huang, B. Liu, D. Wu, Overexpression of high
International 110 (2013) E1125-E1130.
NU
mobility group box 1 with poor prognosis in patients after radical prostatectomy, Bju
[10] J. Rinn, H. Chang, Genome regulation by long noncoding RNAs, Annu. Rev. Biochem. 81 (2012)
MA
145-166.
[11] R. Gupta, N. Shah, K. Wang, J. Kim, H. Horlings, D. Wong, M. Tsai, T. Hung, P. Argani, J. Rinn, Y.
Wang, P. Brzoska, B. Kong, R. Li, R. West, M. van de Vijver, S. Sukumar, H. Chang, Long
non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis, Nature
D
464 (2010) 1071-1076.
[12] S.K. Tan, C. Pastori, C. Penas, R.J. Komotar, M.E. Ivan, C. Wahlestedt, N.G. Ayad, Serum long
PT
E
noncoding RNA HOTAIR as a novel diagnostic and prognostic biomarker in glioblastoma
multiforme, Molecular Cancer 17 (2018) 74.
[13] Y.X. Zhou, C. Wang, L.W. Mao, Y.L. Wang, L.Q. Xia, W. Zhao, J. Shen, J. Chen, Long non-coding RNA
HOTAIR mediates the estrogen-induced metastasis of endometrial cancer cells via
CE
miR-646/NPM1 axis, Am J Physiol Cell Physiol (2018).
[14] M. Pahlevan Kakhki, A. Nikravesh, Z. Shirvani Farsani, M. Sahraian, M. Behmanesh, HOTAIR but
not ANRIL long non-coding RNA contributes to the pathogenesis of multiple sclerosis,
AC
Immunology 153 (2018) 479-487.
[15] B. Wei, W. Wei, B. Zhao, X. Guo, S. Liu, Long non-coding RNA HOTAIR inhibits miR-17-5p to
regulate osteogenic differentiation and proliferation in non-traumatic osteonecrosis of
femoral head, PLoS ONE 12 (2017) e0169097.
[16] L. Yang, Z. Lu, Long non-coding RNA HOTAIR promotes ischemic infarct induced by hypoxia
through up-regulating the expression of NOX2, Biochem. Biophys. Res. Commun. 479 (2016)
186-191.
[17] H. Wu, J. Liu, W. Li, G. Liu, Z. Li, LncRNA-HOTAIR promotes TNF-α production in cardiomyocytes of
LPS-induced sepsis mice by activating NF-κB pathway, Biochemical & Biophysical Research
Communications 471 (2016) 240-246.
ACCEPTED MANUSCRIPT
[18] Q. Hong, O. Li, W. Zheng, W.Z. Xiao, L. Zhang, D. Wu, G.Y. Cai, J.C. He, X.M. Chen, LncRNA HOTAIR
regulates HIF-1α/AXL signaling through inhibition of miR-217 in renal cell carcinoma, Cell
Death & Disease 8 (2017) e2772.
[19] Q.M. Ge, C.M. Huang, X.Y. Zhu, F. Bian, S.M. Pan, Differentially expressed miRNAs in
sepsis-induced acute kidney injury target oxidative stress and mitochondrial dysfunction
pathways, Plos One 12 (2017) e0173292.
[20] S. Huang, M. Wang, W. Wu, R. Wang, J. Cui, W. Li, Z. Li, W. Li, S. Wang, Mir-22-3p Inhibits Arterial
Smooth Muscle Cell Proliferation and Migration and Neointimal Hyperplasia by Targeting
HMGB1 in Arteriosclerosis Obliterans, Cell. Physiol. Biochem. 42 (2017) 2492-2506.
PT
[21] S. Guo, R. Bai, W. Liu, A. Zhao, Z. Zhao, Y. Wang, Y. Wang, W. Zhao, W. Wang, miR-22 inhibits
osteosarcoma cell proliferation and migration by targeting HMGB1 and inhibiting
RI
HMGB1-mediated autophagy, Tumour Biol. 35 (2014) 7025-7034.
[22] Y. Chen, J. Qiu, B. Chen, Y. Lin, Y. Chen, G. Xie, J. Qiu, H. Tong, D. Jiang, Long non-coding RNA
SC
NEAT1 plays an important role in sepsis-induced acute kidney injury by targeting miR-204 and
modulating the NF-κB pathway, Int. Immunopharmacol. 59 (2018) 252-260.
[23] A. Koçkara, M. Kayataş, Renal cell apoptosis and new treatment options in sepsis-induced acute
NU
kidney injury, Ren Fail 35 (2013) 291-294.
[24] A. Havasi, S. Borkan, Apoptosis and acute kidney injury, Kidney Int. 80 (2011) 29-40.
[25] C. Li, W. Jiang, L. Yuan, G. Xing, Cytoprotective Effect of Heat Shock Protein 27 Against
MA
Lipopolysaccharide-Induced Apoptosis of Renal Epithelial HK-2 Cells, Cellular Physiology &
Biochemistry 41 (2017) 2211-2220.
[26] X.J. Ni, Z.Q. Xu, H. Jin, S.L. Zheng, Y. Cai, J.J. Wang, Ginsenoside Rg1 protects human renal tubular
epithelial cells from lipopolysaccharide-induced apoptosis and inflammation damage,
D
Brazilian Journal of Medical & Biological Research 51 (2018) e6611.
[27] T. Stoyanoff, J. Todaro, M. Aguirre, M. Zimmermann, N. Brandan, Amelioration of
PT
E
lipopolysaccharide-induced acute kidney injury by erythropoietin: involvement of
mitochondria-regulated apoptosis, Toxicology 318 (2014) 13-21.
[28] K. Kang, Y. Gao, S. Wang, H. Liu, W. Kong, X. Zhang, R. Huang, Z. Qi, J. Zheng, J. Qu, R. Liu, Y. Liu, H.
Wang,
K.
Yu,
Dexmedetomidine
protects
against
lipopolysaccharide-induced
CE
sepsis-associated acute kidney injury via an α7 nAChR-dependent pathway, Biomed.
Pharmacother. 106 (2018) 210-216.
[29] X. Zhu, J.S. Messer, Y. Wang, F. Lin, C.M. Cham, J. Chang, T.R. Billiar, M.T. Lotze, D.L. Boone, E.B.
AC
Chang, Cytosolic HMGB1 controls the cellular autophagy/apoptosis checkpoint during
inflammation, Journal of Clinical Investigation 125 (2015) 1098-1110.
[30] C. Ren, Y.L. Tong, J.C. Li, N. Dong, J.W. Hao, Q.H. Zhang, Y.M. Yao, Early antagonism of cerebral high
mobility group box-1 protein is benefit for sepsis induced brain injury, Oncotarget 8 (2017)
92578-92588.
[31] W. Xu, Y. Lu, J. Yao, Z. Li, Z. Chen, G. Wang, H. Jing, X. Zhang, M. Li, J. Peng, Novel role of
resveratrol: suppression of high-mobility group protein box 1 nucleocytoplasmic translocation
by the upregulation of sirtuin 1 in sepsis-induced liver injury, Shock 42 (2014) 440-447.
[32] A. Leelahavanichkul, Y. Huang, X. Hu, H. Zhou, T. Tsuji, R. Chen, J.B. Kopp, J. Schnermann, P.S.
Yuen, R.A. Star, Chronic kidney disease worsens sepsis and sepsis-induced acute kidney injury
by releasing High Mobility Group Box Protein-1, Kidney International 80 (2011) 1198-1211.
ACCEPTED MANUSCRIPT
[33] J. Lin, X. Zhang, C. Xue, H. Zhang, M. Shashaty, S. Gosai, N. Meyer, A. Grazioli, C. Hinkle, J.
Caughey, W. Li, K. Susztak, B. Gregory, M. Li, M. Reilly, The long noncoding RNA landscape in
hypoxic and inflammatory renal epithelial injury, Am. J. Physiol. Renal Physiol. 309 (2015)
F901-913.
[34] H. Chun-Mei, G. Qin-Min, P. Shu-Ming, Z. Xiang-Yang, Expression profiling and ontology analysis of
circulating long non-coding RNAs in septic acute kidney injury patients, Clin. Chem. Lab. Med.
54 (2016) e395-e399.
[35] W. Huang, X. Lan, X. Li, D. Wang, Y. Sun, Q. Wang, H. Gao, K. Yu, Long non-coding RNA PVT1
promote LPS-induced septic acute kidney injury by regulating TNFα and JNK/NF-κB pathways
PT
in HK-2 cells, Int. Immunopharmacol. 47 (2017) 134-140.
[36] H. Cai, J. Yao, Y. An, X. Chen, W. Chen, D. Wu, B. Luo, Y. Yang, Y. Jiang, D. Sun, LncRNA HOTAIR acts
pancreatic cancer, Oncotarget 8 (2017) 32905-32917.
RI
a competing endogenous RNA to control the expression of notch3 via sponging miR-613 in
SC
[37] F. Xu, J. Zhang, Long non-coding RNA HOTAIR functions as miRNA sponge to promote the
epithelial to mesenchymal transition in esophageal cancer, Biomedicine & Pharmacotherapy
AC
CE
PT
E
D
MA
NU
90 (2017) 888-896.
ACCEPTED MANUSCRIPT
Table 1 Primers used in qRT-PCR.
Primer (F, 5’-3’)
Primer (R, 5’-3’)
HOTAIR (murine)
CCTTATAAGCTCATCGGAGCA
CATTTCTGGGTGGTTCCTTT
HOTAIR (human)
CAGTGGGGAACTCTGACTCG
GTGCCTGGTGCTCTCTTACC
miR-22 (murine)
ACACTCCAGCTGGGTTCGACG
CTCAACTGGTGTCGTGGAGTCG
GTCAACTTC
GCAATTCAGTTGAGACAGTTCT
miR-22 (human)
GGTTAAGCTGCCAGTTGAA
CAGTGCGTGTCGTGGAGT
HMGB1 (murine)
GGCGAGCATCCTGGCTTATC
AGGCAGCAATATCCTTCTCATAC
HMGB1 (human)
GATCCCAATGCACCCAAGAG
TCGCAACATCACCAATGGAC
AC
CE
PT
E
D
MA
NU
SC
RI
PT
Name
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Документ
Категория
Без категории
Просмотров
0
Размер файла
6 886 Кб
Теги
lfs, 2018, 041
1/--страниц
Пожаловаться на содержимое документа