close

Вход

Забыли?

вход по аккаунту

?

j.fsi.2018.08.032

код для вставкиСкачать
Accepted Manuscript
Characterization and function of GSK3β from Litopenaeus vannamei in WSSV
infection
Lingwei Ruan, Huachun Liu, Hong Shi
PII:
S1050-4648(18)30508-4
DOI:
10.1016/j.fsi.2018.08.032
Reference:
YFSIM 5490
To appear in:
Fish and Shellfish Immunology
Received Date: 21 June 2018
Revised Date:
13 August 2018
Accepted Date: 16 August 2018
Please cite this article as: Ruan L, Liu H, Shi H, Characterization and function of GSK3β from
Litopenaeus vannamei in WSSV infection, Fish and Shellfish Immunology (2018), doi: 10.1016/
j.fsi.2018.08.032.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT
1
Characterization and Function of GSK3β from Litopenaeus
2
vannamei in WSSV infection
3
Lingwei Ruana, *, Huachun Liua, b, Hong Shia
5
a
6
of Marine Genetic Resources of State Oceanic Administration, Third Institute of
7
Oceanography, State Oceanic Administration, Fujian Key Laboratory of Marine
8
Genetic Resources, South China Sea Bio-Resource Exploitation and Utilization
9
Collaborative Innovation Center, Xiamen 361005, People's Republic of China.
RI
PT
4
10
b
11
China.
School of Life Science, Xiamen University, Xiamen 361005, People's Republic of
12
* Corresponding author:
14
Lingwei Ruan
15
Third Institute of Oceanography
16
No. 184 Daxue Road
17
Xiamen, Fujian
18
P. R. China (361005)
19
Tel: +86 592 2195856
20
Fax: +86 592 2195856
21
Email: ruanlingwei@tio.org.cn
23
AC
C
EP
TE
D
13
22
M
AN
U
SC
State Key Laboratory Breeding Base of Marine Genetic Resources, Key Laboratory
ACCEPTED MANUSCRIPT
24
Abstract:
GSK3β, a serine/threonine protein kinase, is a crucial regulator in several
26
signaling pathway and plays a vital role in multiple cellular processes including cell
27
proliferation, growth, apoptosis and immune response. In this study, a GSK3β
28
homolog from L. vannamei, designed as LvGSK3β, was characterized. Sequence
29
analysis showed that LvGSK3β possessed a highly similarity with GSK3β from other
30
species, which contained a catalytic domain and serine/threonine phosphorylation
31
sites. To analyze the role of LvGSK3β in the process of white spot syndrome virus
32
(WSSV) infection, real-time quantitative PCR and western blot assays were
33
performed. The results showed that the transcription and expression levels of
34
LvGSK3β were inhibited upon WSSV challenge, accompanied with down-regulated
35
phosphorylation levels. When LvGSK3β was silenced, the transcription of WSSV
36
gene ie1 was inhibited, and the apoptosis of hemocytes induced by WSSV was
37
up-regulated remarkably as well. In addition, inactivation of LvGSK3β could also
38
depress virus infection that further validated the results. Conclusively, LvGSK3β was
39
an important protein for shrimp immunomodulation, and shrimp might promote the
40
apoptosis to restrain WSSV infection by inhibition of LvGSK3β. The study will be
41
helpful for understanding the molecular mechanism of host-virus interaction.
44
45
SC
M
AN
U
TE
D
EP
43
Key words: Litopenaeus vannamei, WSSV, GSK3β, apoptosis
AC
C
42
RI
PT
25
1. Introduction
46
As an important cultured shrimp, Litopenaeus vannamei is commonly reared
47
worldwide and contributes nearly 80% to world production of the total economic
48
penaeid shrimp [1]. However, disease outbreaks resulted from diverse pathogens have
49
severely threatened shrimp aquaculture. Among them, white spot disease (WSD)
50
which caused by white spot syndrome virus (WSSV) is the greatest menace with high
ACCEPTED MANUSCRIPT
51
mortality, and caused dramatic economic losses [2]. Although considerable scientific
52
studies have been aimed for years, the knowledge about the host-virus interaction is
53
quite limited. Thus, it’s imperative to understand the molecular mechanisms involved
54
in immune defense to improve disease control.
Innate immune system is critical for shrimp to defense against pathogens.
56
When suffered from pathogens, it can trigger a series of humoral immunity and
57
cellular immunity responses, which are always modulated by signaling transduction
58
[3, 4]. Many signaling pathways have been proved to be implicated in the process of
59
shrimp innate immune responses, such as Toll, NF-κB, PI3K/Akt, JAK/STAT and
60
Wnt/β-catenin [5-7]. Some components of these signaling pathways are critical to
61
host and virus, thus studies on these key molecules will be helpful for understanding
62
the regulations of shrimp innate immune.
M
AN
U
SC
RI
PT
55
Glycogen synthase kinase 3β (GSK3β) is a serine/threonine kinase with
64
originally function in glycogen biosynthesis [8]. Subsequently it was discovered to be
65
a crucial regulator in many signaling pathways including Wnt/β-catenin, NF-κB and
66
PI3K/AKT, and participate in various physiological processes, such as cell
67
proliferation, differentiation, apoptosis and immune response [9, 10]. In the adaptive
68
immunity, GSK3β can modulate the clonal expansion and specificity of immune cells
69
by regulating their survival and differentiation directly or influencing the repertoire of
70
cytokines secretion indirectly [11]. It has been found that the antigen-specific
71
stimulation of CD8+T cells could inactivate GSK3β to enhance the cytotoxic effects
72
[12]. And GSK3β can regulate the differentiation of CD4+T cells into Th17 cells [13].
73
Recently, GSK3β has also been established as a key regulator of innate immune
74
system. In host antiviral responses, GSK3β could not only promote the production of
75
multiple cytokines (IFN-γ, IL-1β, TNF, IL-12 etc.) by activating STAT3, NF-κB,
76
AP-1 and other transcription factors, but also limit viral proliferation through binding
77
with a variety of viral protein, such as NS5A, LANA and HBX [11,14-18]. In addition,
78
there were several researches showed that GSK3β was also closely related to virus
79
infection. For example, coxsackievirus B3 (CVB3) could decrease the expression of
AC
C
EP
TE
D
63
ACCEPTED MANUSCRIPT
80
β-catenin by activating GSK3β-dependent mechanism, thereby promoting cell
81
apoptosis and the release of virus particles [19].
Thus it is implied that GSK3β might execute multiple functions in the host-virus
83
interaction. However, knowledge about its role in the invertebrate’s immune
84
regulation is little. In this study, a GSK3β homolog from L. vannamei, designed as
85
LvGSK3β, was characterized. And its role in the host-virus interaction in L. vannamei
86
was investigated. It was found that WSSV infection could down-regulate the
87
transcription and translation of LvGSK3β. Further studies revealed that silencing of
88
LvGSK3β could inhibit the viral gene transcription, accompanied by induction of cell
89
apoptosis. The results implied that LvGSK3β might be a key molecule involved in
90
immune regulation, and could helpfully improve our knowledge of the host-virus
91
interaction.
92
2. Materials and methods
94
2.1 Reagents and antibodies
TE
D
93
M
AN
U
SC
RI
PT
82
The antibody against LvGSK3β was prepared in Xiamen University Laboratory
96
Animal Center by immunizing the mice with recombinant protein. Anti-p-GSK3β
97
(Ser9) was purchased from Cell Signaling Technology. Anti-p-GSK3β (Y216) and
98
anti-β-tubulin were bought from Sigma. Horseradish peroxidase (HRP)-conjugated
99
secondary antibodies were obtained from Thermo Scientific. GSK-3 Inhibitor IX was
101
102
AC
C
100
EP
95
purchased from Merck Millipore
2.2 Shrimp culture and WSSV preparation
103
Healthy adult shrimp, L. vannamei, weight in 12-15g, were purchased from local
104
seafood market, and kept in air-pumped circulating seawater at 25°C for 3 days before
105
experiments.
ACCEPTED MANUSCRIPT
106
107
WSSV used in the study was prepared from hemocytes of the viral infected
crayfish and quantified as described before [20, 21].
108
2.3 cDNA clone and sequence analysis
RI
PT
109
110
The full-length cDNA sequence of LvGSK3β, obtained from the L. vannamei
111
transcriptome, was cloned and deposited in NCBI database with accession no.
112
MG680178. The primers used for the PCR amplification was listed in Table1. The
113
sequence
114
(http://www.ncbi.nlm.nih.gov/BLAST/). The conserved domain within LvGSK3β was
115
predicted by the SMART program (http://smart.embl-heidelberg.de). Multiple
116
sequence alignment was performed using DNAMAN (Lynnon Biosoft), and the
117
phylogenic tree of GSK3β from various species was constructed by using Mega 6.06
118
with the Neighbor-Joining method (NJ).
analysis
LvGSk3β
was
analyzed
by
BLAST
M
AN
U
TE
D
119
120
of
SC
homology
2.4 Total RNA extraction and reverse transcription PCR
Total RNA originated from selected tissues of L. vannamei was extracted with
122
TRIzol reagent (Molecular Research Center) according to the instructions. After
123
digestion with DNaseI (Takara) at 37°C for 30 min, 2 µg of total RNA was used to
124
synthesis the first-strand cDNA by reverse transcriptase M-MLV (Takara) with
125
oligo(dT)18 primer (Fermentas) as described in the manuals.
127
AC
C
126
EP
121
2.5 Real-time quantitative PCR
128
Real-time quantitative PCR was used for analyzing the mRNA levels of
129
LvGSK3β. Selected tissues from three individual shrimp were collected. Total RNA
130
extraction and cDNA synthesis were performed as described above. Rotor-Gene™
131
6000 (Corbett Life Science) was used to perform real-time quantitative PCR assay.
ACCEPTED MANUSCRIPT
132
The PCR procedure was as follows, 1 cycle of 95°C for 1 min, 40 cycles of 95°C for
133
10 s, 56°C for 15 s, and 72°C for 15 s. Lvtubulin was used as the reference control
134
and results were calculated with 2-∆∆CT methods. The primers used were listed in
135
Table 1.
137
RI
PT
136
2.6 Tissue distribution analysis
Total RNAs were isolated from various tissues including hemocyte, gill, heart,
139
hepatopancreas, muscle and intestine, according to the protocol mentioned above.
140
Then the first-strand cDNA was synthesized and real-time quantitative PCR was
141
performed with the primer pairs LvGSK3β-F2/LvGSK3β-R2 (Table 1).
M
AN
U
SC
138
142
143
2.7 Analysis of transcription post WSSV infection
Healthy adult shrimps were cultured under laboratory environment for 3 days.
145
Then each shrimp was injected with 1×107 WSSV particles diluted in 100 µL PBS
146
(140 mM NaCl, 3 mM KCl, 8 mMNa2HPO4, 1.5 mM KH2PO4, pH 7.4), and shrimps
147
injected with 100 µL PBS were served as control. Gills and hemocytes from three
148
individual shrimp were sampled at 0, 6, 12, 24, 48 and 72 h post injection (hpi),
149
respectively. Thereafter the total RNAs were isolated, and transcriptional levels were
150
analyzed by real-time quantitative PCR.
152
153
EP
AC
C
151
TE
D
144
2.8 Western blot analysis
The shrimps were challenged as mentioned in section 2.7. Hemocytes collected
154
from WSSV-injected shrimps or PBS-injected shrimps were lysed with RIPA lysis
155
buffer (Beyotime) containing PMSF (1:100), protease inhibitor (Calbiochem, 1:200)
156
and phosphatase inhibitor (Merck Millipore, 1:50) on ice for 30 mins. The
157
supernatants of cell lysate were boiled for 7 mins mixed with 5×loading buffer (250
ACCEPTED MANUSCRIPT
mM Tris-HCl pH 6.8, 10% SDS, 50% glycerol, 5% β-mercaptoethanol, 0.5%
159
bromophenol blue). Then the samples were separated by SDS-PAGE and transferred
160
onto PVDF membranes (GE Healthcare). After blocked with 5% (w/v) skim milk or
161
BSA resolved in TBST buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% Tween 20) for
162
1h at room temperature (RT), the membranes were incubated with corresponding
163
primary antibodies at 4°C with gentle shaking overnight. Thereafter, the membranes
164
were washed with TBST for 3 times and subsequently incubated with
165
HRP-conjugated secondary antibody for 1h at RT. The signals on the membranes
166
were detected by using Super-Signal West Pico Chemiluminescent (ECL) Substrates
167
(Thermo Scientific).
SC
RI
PT
158
169
M
AN
U
168
2.9 RNAi assays
Silencing the transcription of LvGSK3β was performed to explore its role in the
171
innate immune of shrimp in vivo. The LvGSK3β-dsRNA and eGFP (enhanced Green
172
Fluorescent Protein)-dsRNA (control) were synthesized according to the instructions
173
by using T7 RiboMAXTM express RNAi system (Promega). The primers designed for
174
dsRNA synthesis were listed in Table1.
TE
D
170
For RNAi assays, dsRNA (20 µg) diluted with PBS was intramuscularly injected
176
into abdominal segment of shrimps. And there was a twice injection with the
177
corresponding dsRNA after 24h to ensure the RNAi efficiency. After 12h post the
178
second injection, shrimps were challenged with 1×107 WSSV diluted in 100 µL PBS,
179
and the shrimps injected with 100 µL PBS were also served as control. Hemocytes
180
were collected at 1, 9, 24 hpi. Then the transcriptional levels of LvGSK3β and WSSV
181
immediate-early (IE) gene ie1 were detected by real-time quantitative PCR.
AC
C
EP
175
182
183
2.10 Detection of caspase3/7 activity
ACCEPTED MANUSCRIPT
RNAi was performed as mentioned above and the hemocytes with different
185
treatments were collected. Portions of hemocytes were used to determine the
186
transcriptional levels of LvGSK3β and ie1. The remaining was used to analyze the
187
cell apoptosis by Caspase-Glo®3/7 Assay (Promega). The details were shown as
188
follows: 4×104 shrimp hemocytes were mixed with 50 µl Caspase-Glo®3/7, and
189
incubated at RT in the dark. After 1h, the mixture was analyzed by GloMax20/20
190
Luminometer (Promega) to detect the activity of caspase3/7. A paired Student’s t-test
191
was used to statistically analyze the data.
2.11 Shrimp hemocytes culture and inhibitor treatment
M
AN
U
193
SC
192
RI
PT
184
Hemocytes from L. vannamei were extracted with addition of anticoagulants (26
195
mM sodium citrate, 100 mM glucose, 140 mM NaCl, 30 mM citric acid, pH6.0), and
196
cultivated in cell culture dishes for 45 min at 27℃. Adherent cells were washed
197
carefully with PBS before seeded in L15 medium (Gibco) supplemented with 15%
198
FBS (Gibco), penicillin (60 µg/mL) and streptomycin (50 µg/mL). 5 µM GSK-3
199
Inhibitor IX or DMSO (control) were added. Firstly, Cell Counting Kit-8 (CCK-8,
200
Dojindo) was used to determine the cytotoxicity of the reagents on cells according to
201
the instructions. Then western blot was applied to detect the effect of GSK-3 Inhibitor
202
IX on LvGSK3β. After being pretreated with reagents for 1h, the hemocytes were
203
incubated with 1×107 WSSV particles diluted in L15 medium for another 5h.
204
Subsequently, the samples were collected and the total RNA extraction and reverse
205
transcription were achieved by Single Cell-to-CT™ qRT-PCR Kit (Ambio). Finally,
206
the synthetic cDNA was applied to analyze the transcription of ie1 using real-time
207
quantitative PCR
AC
C
EP
TE
D
194
208
209
3 Results
210
3.1 Cloning and sequence analysis of LvGSK3β
ACCEPTED MANUSCRIPT
The cDNA sequence of LvGSK3β contained an open reading frame (ORF) of
212
1233 bp, which encoded 410 amino acid residues with a calculated molecular weight
213
of 46.029 KDa (Fig. 1A). SMART analysis displayed that LvGSK3β protein had
214
characteristic catalytic domain of serine/threonine protein kinase from residues 54 to
215
338, namely protein kinase domain (PKD) (Fig. 1A). Multiple sequence alignment
216
revealed that LvGSK3β shared 88.78%, 77.38%, 77.29%, 76.21% and 75% identity to
217
Eriocheir sinensis GSK3β (EsGSK3β), Branchiostoma floridae GSK3β (BfGSK3β),
218
Cerapachys biroi GSK3β (CbGSK3β), Picoides pubescens GSK3β (PpGSK3β) and
219
Homo sapiens GSK3β (HsGSK3β), respectively, suggesting that GSK3β proteins
220
were highly conserved from invertebrates to vertebrates (Fig. 1B). In addition, we
221
found that the LvGSK3β Ser9 and Tyr214 phosphorylation residues were respectively
222
corresponded to the Ser9 and Tyr216 residues of GSK3β in mammalian (Fig. 1B).
223
Furthermore, phylogenetic analysis showed that LvGSK3β was clustered together
224
with arthropods (Fig. 1C).
226
TE
D
225
M
AN
U
SC
RI
PT
211
3.2 Tissue distribution of LvGSK3β
To analyze the tissue distribution of LvGSK3β, total RNA of the hemocytes, gill,
228
heart, hepatopancreas, muscle and intestine were extracted and reversely transcribed
229
into cDNA for real-time quantitative PCR assays. As shown in Fig. 2, transcripts of
230
LvGSK3β could be detected in all selected tissues, with a highest level in heart.
232
233
AC
C
231
EP
227
3.3 Transcription analysis of LvGSK3β post WSSV infection
In order to investigate the relationship between LvGSK3β and WSSV infection,
234
hemocytes and gills from shrimp challenged with WSSV were collected at different
235
time points post WSSV infection, and the total RNA was isolated for cDNA synthesis.
236
Then the transcriptional profiles of LvGSK3β were analyzed by real-time quantitative
237
PCR. WSSV IE genes have important regulatory roles in the process of viral infection
ACCEPTED MANUSCRIPT
and proliferation. And the transcriptional level of ie1, a well-recognized IE gene of
239
WSSV, was used as an index for determining the infection of WSSV. As shown in
240
Fig. 3A, C, the transcription of ie1 increased gradually with lastingness of infection,
241
indicating WSSV infected successfully in shrimp. Then the transcription profiles of
242
LvGSK3β were analyzed. In hemocytes, it was not significantly changed at the early
243
stage of WSSV infection (6h), and decreased with the virus infection (12h-72h) (Fig.
244
3B). Similarly, WSSV challenge also had inhibited effects on LvGSK3β transcription
245
in gill before 48h post challenge (Fig. 3D). Taken together, WSSV infection could
246
down-regulate the transcription of LvGSK3β.
SC
M
AN
U
247
248
RI
PT
238
3.4 Expression and phosphorylation level of LvGSK3β upon WSSV challenge
To further study whether WSSV infection can affect the translation of LvGSK3β,
250
shrimps were intramuscularly injected with WSSV or PBS as mentioned above.
251
Hemocytes lysates were prepared at different time points post injection. Then western
252
blot analysis was performed, and the results showed that WSSV infection could also
253
significantly reduce the total protein level of LvGSK3β in shrimp, while no much
254
improvement showed in control group (Fig. 4A, B). As a serine/threonine kinase, the
255
activity of GSK3β is mainly regulated by its phosphorylation. Furthermore, the
256
phosphorylation of Ser9 and Tyr214 residues were also tested. The results displayed
257
that the phosphorylation of LvGSK3β at these two residues were both prominently
258
down-regulated after WSSV challenge (Fig. 4A). In sum, the results displayed that the
259
transcription, translation and phosphorylation of LvGSK3β were all down-regulated
260
by WSSV infection, suggesting LvGSK3β had close relationship with WSSV
261
infection.
AC
C
EP
TE
D
249
262
263
264
3.5 Knockdown of LvGSK3β inhibited WSSV infection by promoting hemocytes
apoptosis
ACCEPTED MANUSCRIPT
To further investigate the role of LvGSK3β in the process of WSSV infection,
266
RNAi was performed to silence LvGSK3β in vivo. Firstly, shrimps were injected with
267
dsLvGSK3β, and the knock-down efficiency of LvGSK3β was detected using
268
real-time quantitative PCR. The results displayed that the transcriptional levels of
269
LvGSK3β was significantly repressed in dsLvGSK3β-treated shrimps, while there
270
was no obvious changes in the control groups, which were injected with dseGFP (Fig.
271
5A, D). Upon WSSV stimulated, silencing of LvGSK3β would remarkably inhibit the
272
transcription level of ie1 at 9 hpi and 24 hpi (Fig. 5B), indicating that WSSV infection
273
was restrained in shrimp. Moreover, the hemocytes apoptosis was determined by
274
testing the caspase3/7 activity. Compared with dseGFP group, silence of LvGSK3β
275
could significantly increase caspase3/7 activity of shrimp hemocytes at the early stage
276
of WSSV infection (Fig. 5C), while it was repressed with no virus stimulation (Fig.
277
5E). These data gave a clue that LvGSK3β had an important role in WSSV infection,
278
and shrimp might restrain the virus infection through inducing cell apoptosis, which
279
was mediated by inhibiting the expression of LvGSK3β expression.
281
SC
M
AN
U
TE
D
280
RI
PT
265
3.6 Effects of the LvGSK3β on virus infection
GSK3β functions as a phosphorylated kinase to regulate multiple substrates in
283
mammalians. In the study, GSK-3 Inhibitor IX, an effective and specific
284
ATP-competitive inhibitor of GSK3β, was used to inhibit the LvGSK3β activity to
285
further explore the relationship between LvGSK3β and WSSV infection. Firstly,
286
cytotoxicity test using CCK-8 was performed, and the results displayed that the
287
reagent had little effect on hemocytes. The survival rate of cells treated with GSK-3
288
Inhibitor IX (5 µM) were more than 80%, which was similar to those treated with
289
DMSO (control) (Fig. 6A). Then the effect of GSK-3 Inhibitor IX was validated by
290
western blot, and it showed that GSK-3 Inhibitor IX could really inhibit the
291
phosphorylation of LvGSK3β (Fig. 6B). Furthermore, the role of LvGSK3β on
292
WSSV infection was investigated. Comparing to the control group, the primary
293
hemocytes pretreated with GSK-3 Inhibitor IX could repress the transcription of ie1
AC
C
EP
282
ACCEPTED MANUSCRIPT
294
(Fig. 6C). The results were consistent with that of RNAi, implied that LvGSK3β
295
might be necessary for WSSV infection.
296
Discussion
RI
PT
297
Cell signaling transduction pathway plays an important role in the regulation of
299
shrimp antiviral immune response, including Wnt/β-catenin, JAK-STAT, PI3K/Akt
300
and NF-kB. Moreover, increasing evidences have found that several key molecules,
301
such as NF-kB, β-catenin, AP-1 and STAT, are key modulated points in the
302
shrimp-WSSV interaction. As a highly conserved multifunctional serine/threonine
303
kinase, GSK3β is broadly involved in many cellular functions, particularly in
304
regulating many components of the innate immune response. Most of studies about
305
innate immune mediated by GSK3β were focused on vertebrates, while the
306
knowledge about its role in regulating innate immunity of invertebrates is limited.
M
AN
U
SC
298
In the present study, we cloned and characterized a GSK3β homolog, named as
308
LvGSK3β, from L. vannamei. Sequence analysis displayed that LvGSK3β shared a
309
high similarity with identified GSK3β from other species and contained a conserved
310
protein kinase domain (PKD), which is the characteristic of serine/threonine protein
311
kinases family. By multiple sequence alignment, we found that LvGSK3β also had
312
Ser9 and Tyr214 phosphorylation sites, which were corresponded to Ser9 and Tyr216
313
phosphorylation sites of GSK3β from mammalian, respectively. The results suggested
314
that LvGSK3β belonged to the GSK3 family, and might share similar biological
315
functions with other known GSK3β.
EP
AC
C
316
TE
D
307
In order to reveal the function of LvGSK3β in the shrimp-WSSV interaction, the
317
transcriptional and translational profiles of LvGSK3β post WSSV infection were
318
firstly analyzed by real-time quantitative PCR and western blot. It was shown that
319
WSSV infection could decrease the transcription and expression levels of LvGSK3β,
320
accompanied with down-regulating the phosphorylation of Ser9 and Tyr214 sites (Fig.
ACCEPTED MANUSCRIPT
3, 4). These data implied that LvGSK3β had a close relationship with WSSV infection.
322
Then the role of LvGSK3β was further investigated to determine whether LvGSK3β
323
is beneficial to immunomodulation. RNAi assays were performed to silence the
324
expression of LvGSK3β. Meanwhile, an effective and specific inhibitor of GSK3β,
325
GSK-3 Inhibitor IX, was used to inactivate LvGSK3β. Both of the results showed that
326
once LvGSK3β was down-regulated, WSSV infection could be repressed (Fig. 5, 6).
327
Moreover, cell apoptosis induced by WSSV could be promoted significantly. The
328
results suggested that LvGSK3β was an important molecule for antiviral immune
329
regulation in shrimp, which might mediate apoptosis to facilitate the clearance of
330
WSSV. In the study of influenza infection, similar results were presented.
331
Down-regulation of GSK3β expression could also positively regulated the
332
virus-induced host cell apoptosis to inhibit replication of influenza virus [22].
M
AN
U
SC
RI
PT
321
In previous study, we have found that WSSV infection could promote the
334
ubiquitination of Lvβ-catenin, which resulted in restrictions on nuclear translocation.
335
When the protein levels of Lvβ-catenin were up-regulated by GSK-3 Inhibitor IX,
336
WSSV infection was also significantly inhibited [23], which was consistent with the
337
results. Phosphorylation by GSK3β on β-catenin is the switch of the degradation of
338
β-catenin mediated by ubiquitination. It is reasonable that shrimp might inactivate
339
LvGSK3β to repress the ubiquitination and promote the nuclear translocation of
340
Lvβ-catenin for immune regulation. As GSK3β is a cross point in several signal
341
pathway, and it has extensive substrates, the specific regulation mechanism of
342
LvGSK3β on the antiviral immune response of shrimp needs to be further studied.
EP
AC
C
343
TE
D
333
In sum, a novel GSK3β homolog was identified in L. vannamei, which had a
344
close relationship with WSSV infection. Further study revealed that silencing the
345
transcription or inactivation of LvGSK3β could repress WSSV infection. The process
346
might be mediated by promoting the cell apoptosis induced by WSSV. This study will
347
be helpful to clarify the molecular mechanism of host-virus interaction and to advance
348
the control of shrimp disease.
349
ACCEPTED MANUSCRIPT
350
Acknowledgements
This work was funded by the National Natural Science Foundation of China (No.
352
31472297), the China Agriculture Research System-48, and Natural Science
353
Foundation of Fujian Province of China (2018J01048).
RI
PT
351
354
References
356
1.
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
M
AN
U
360
TE
D
359
EP
358
Briggs M, Fungesmith S, Subasinghe RP, Phillips M. Introductions and
movement of two penaeid shrimp species in Asia and the Pacific. Fao Fisheries
Technical Paper. 2005.
2. Lightner DV. Virus diseases of farmed shrimp in the Western Hemisphere (the
Americas): a review. Journal of Invertebrate Pathology. 2011 106:110-30.
3. Borregaard N, Elsbach P, Ganz T, Garred P, Svejgaard A. Innate immunity: from
plants to humans. Immunology Today. 2000 21:68.
4. Hoffmann JA, Kafatos FC, Janeway CA, Ezekowitz RAB. Phylogenetic
Perspectives in Innate Immunity. Science. 1999 284:1313-8.
5. Li F, Xiang J. Signaling pathways regulating innate immune responses in shrimp.
Fish & Shellfish Immunology. 2013 34:973-80.
6. Song X, Zhang Z, Wang S, Li H, Zuo H, Xu X, et al. A Janus Kinase in the
JAK/STAT signaling pathway from Litopenaeus vannamei is involved in
antiviral immune response. Fish Shellfish Immunol. 2015 44:662-73.
7. Xie YK, Ding D, Wang HM, Kang CJ. A homologue gene of β-catenin
participates in the development of shrimps and immune response to bacteria and
viruses. Fish & Shellfish Immunology. 2015 47:147-56.
8. Embi N, Rylatt DB, Cohen P. Glycogen synthase kinase-3 from rabbit skeletal
muscle. Separation from cyclic-AMP-dependent protein kinase and
phosphorylase kinase. FEBS Journal. 2005 107:519-27.
9. Forde JE, Dale TC. Glycogen synthase kinase 3: a key regulator of cellular fate.
Cellular & Molecular Life Sciences Cmls. 2007 64:1930.
10. Jope RS, Yuskaitis CJ, Beurel E. Glycogen Synthase Kinase-3 (GSK3):
Inflammation, Diseases, and Therapeutics. Neurochemical Research. 2007
32:577-95.
11. Beurel E, Michalek SM, Jope RS. Innate and adaptive immune responses
regulated by glycogen synthase kinase-3 (GSK3). Trends in Immunology. 2010
31:24-31.
AC
C
357
SC
355
ACCEPTED MANUSCRIPT
421
Table 1
422
Primers used in the study
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
SC
389
M
AN
U
388
TE
D
387
EP
386
AC
C
385
RI
PT
420
12. Ohteki T, Parsons M, Zakarian A, Jones RG, Nguyen LT, Woodgett JR, et al.
Negative Regulation of T Cell Proliferation and Interleukin 2 Production by the
Serine Threonine Kinase Gsk-3. Journal of Experimental Medicine. 2000
192:99-104.
13. Beurel E, Yeh WI, Michalek SM, Harrington LE, Jope RS. Glycogen synthase
kinase-3 is an early determinant in the differentiation of pathogenic Th17 cells.
Journal of Immunology. 2011 186:1391-8.
14. Martin M, Rehani K, Jope RS, Michalek SM. Toll-like receptor-mediated
cytokine production is differentially regulated by glycogen synthase kinase 3.
Nature Immunology. 2005 6:777-84.
15. Jope RS, Cheng Y, Lowell JA, Worthen RJ, Sitbon YH, Beurel E. Stressed and
Inflamed, Can GSK3 Be Blamed? Trends in Biochemical Sciences. 2016.
16. Park CY, Choi SH, Kang SM, Ahn BY, Kim H, Jung G, et al. Nonstructural 5A
protein activates beta-catenin signaling cascades: implication of hepatitis C
virus-induced liver pathogenesis. Journal of Hepatology. 2009 51:853-64.
17. Liu J, Martin HJ, Shamay M, Woodard C, Tang QQ, Hayward SD. Kaposi's
Sarcoma-Associated Herpesvirus LANA Protein Downregulates Nuclear
Glycogen Synthase Kinase 3 Activity and Consequently Blocks Differentiation.
Journal of Virology. 2007 81:4722-31.
18. Kuo CY, Wu CC, Hsu SL, Hwang GY. HBx Inhibits the growth of
CCL13-HBX-stable cells via the GSK-3beta/beta-catenin cascade. Intervirology.
2008 51:130-6.
19. Yuan J, Zhang J, Wong BW, Si X, Wong J, Yang D, et al. Inhibition of glycogen
synthase kinase 3beta suppresses coxsackievirus-induced cytopathic effect and
apoptosis via stabilization of beta-catenin. Cell Death & Differentiation. 2005
12:1097.
20. Xie X, Li H, Xu L, Yang F. A simple and efficient method for purification of
intact white spot syndrome virus (WSSV) viral particles. Virus Research. 2005
108:63.
21. Zhou Q, Qi YP, Yang F. Application of spectrophotometry to evaluate the
concentration of purified White Spot Syndrome Virus. Journal of Virological
Methods. 2007 146:288-92.
22. Dai X, Zhang L, Han H. The Impact of GSK-3β on the Replication of Influenza
Virus in A549 Cells. Open Journal of Nature Science. 2016 04:371-7.
23. Sun J, Ruan L, Shi H, Xu X. Characterization and function of a β-catenin
homolog from Litopenaeus vannamei in WSSV infection. Developmental &
Comparative Immunology. 2017 76:412.
384
ACCEPTED MANUSCRIPT
Sequence (5’-3’)
Name
For LvGSK3β cDNA clone
LvGSK3β-F1
TCCTCCTTATTTGAACCTTTCCGAC
LvGSK3β-R1
GGCAGGAAGGCTGGTGTGGAG
GTGTGGACCAGTTAGTAG
LvGSK3β-R2
CCAGGTTTATAGCGTCTTC
ie1-F
GCACAACAACAGACCCTACCC
ie1-R
GAAATACGACATAGCACCTCCAC
Lvtubulin-F
GCCTCGTGCCATCCTTGTTG
Lvtubulin-R
CCCTTAGCCCAGTTGTTTCCAG
SC
LvGSK3β-F2
For dsRNA templates amplification
dsRNA-LvGSK3β-R
GAACACCTTCTGCCATGGAT
dsRNA-LvGSK3β-T7-F
a
GGATCCTAATACGACTCACTATAGGAGGTGCTTCAGGACAAACGCTT
dsRNA-LvGSK3β-T7-R
a
GGATCCTAATACGACTCACTATAGGGAACACCTTCTGCCATGGAT
dsRNA-eGFP-F
GTGCCCATCCTGGTCGAGCT
dsRNA-eGFP-R
TGCACGCTGCCGTCCTCGAT
dsRNA- eGFP -T7-F
a
GGATCCTAATACGACTCACTATAGGGTGCCCATCCTGGTCGAGCT
dsRNA- eGFP -T7-R
a
GGATCCTAATACGACTCACTATAGGTGCACGCTGCCGTCCTCGAT
a
The sequences of T7 promoter were underlined
424
TE
D
423
AGGTGCTTCAGGACAAACGCTT
M
AN
U
dsRNA-LvGSK3β-F
RI
PT
For real-time quantitative PCR
Figure Legends
426
Fig. 1. Sequence analysis of LvGSK3β. (A) The nucleotide and deduced amino acid
427
sequences of LvGSK3β. The gray-shade region indicated the serine/tyrosine kinase
428
domain (54-338a). The predicted phosphorylation sites were indicated with
429
black-shade. (B) Multiple sequence alignment among GSK3β from L. vannamei and
430
other species. The conserved phosphorylated sites were marked with red star. (C)
431
Phylogenetic tree analysis of GSK3β from L. vannamei and other species. Genbank
432
accession number of each GSK3β was shown after their scientific names. LvGSK3β
433
was marked with a black dot.
AC
C
EP
425
ACCEPTED MANUSCRIPT
Fig. 2. Tissue distribution analysis of LvGSK3β by real-time quantitative PCR in L.
435
vannamei. Lvtubulin was used as internal reference.
436
Fig. 3. Transcriptional profile of LvGSK3β post WSSV infection. (A) Transcriptional
437
level of ie1 after WSSV challenge in hemocytes. (B) Transcriptional level of
438
LvGSK3β after injected with WSSV or PBS in hemocytes. (C) Transcriptional level
439
of ie1 after WSSV challenge in gill. (D) Transcriptional level of LvGSK3β after
440
injected with WSSV or PBS in gill. The tissues were collected at indicated time post
441
injection for analysis. The values were normalized to shrimp tubulin by using 2-△△CT
442
methods and the data were presented as means ± SD of triplicate experiments. The
443
statistical significance was calculated using Student’s t-test (*p < 0.05, **p < 0.01).
444
Fig. 4. Expression and phosphorylation levels of LvGSK3β upon WSSV challenge. (A)
445
Expression and phosphorylation profiles of LvGSK3β post WSSV challenge. (B)
446
Expression and phosphorylation profiles of LvGSK3β post PBS injection. Western
447
blot analysis with antibodies against LvGSK3β, p-LvGSK3β (Ser9), p-LvGSK3β
448
(Tyr214) was performed. Lvtubulin was used as internal control.
449
Fig. 5. Effect of dsRNA-mediated LvGSK3β silencing on WSSV infection and the
450
shrimp hemocytes apoptosis. (A) Efficiency of dsGSK3β silencing in shrimps post
451
WSSV infection. Real-time quantitative PCR was used, and the dseGFP was served as
452
control. (B) Transcription of ie1 in dsRNA-treated shrimps post WSSV infection. (C)
453
Analysis of the hemocytes apoptosis with dsGSK3β or dseGFP treatment post WSSV
454
infection. (D) Efficiency of dsGSK3β silencing in shrimps post PBS injection.
455
Real-time quantitative PCR was used, and the dseGFP was served as control. (E)
456
Analysis of the hemocytes apoptosis with dsGSK3β or dseGFP treatment post
457
injection with PBS.
458
Fig. 6. Effect of LvGSK3β inactivation on WSSV infection. (A) Analysis of relative
459
survival rate. Hemocytes were treated with GSK-3 inhibitor IX (5 µM) or DMSO
460
(control), and the cytotoxicity of the reagents was analyzed with Cell Counting Kit-8.
461
(B) Detection of LvGSKβ in the primary shrimp hemocytes with different treatments.
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
434
ACCEPTED MANUSCRIPT
The hemocytes treated with GSK-3 inhibitor IX (5 µM) or DMSO (control) for 2h
463
were collected and analyzed by western blot. (C) Effects of GSK-3 inhibitor IX
464
treatment on WSSV gene transcription. After treatment with GSK-3 inhibitor IX (5
465
µM) or DMSO (control) for 1h, 1×107 WSSV virus particles were added and
466
incubated for 5h. Real-time quantitative PCR were used for analyzing the
467
transcription profile of ie1.
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
462
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
AC
C
EP
TE
D
M
AN
U
SC
RI
PT
ACCEPTED MANUSCRIPT
ACCEPTED MANUSCRIPT
Highlights
A GSK3β homologue of Litopenaeus vannamei was characterized.
The transcription and expression of LvGSK3β were regulated by WSSV
RI
PT
infection.
AC
C
EP
TE
D
M
AN
U
SC
LvGSK3β could regulate the apoptosis to restrain WSSV infection.
Документ
Категория
Без категории
Просмотров
2
Размер файла
6 443 Кб
Теги
fsi, 032, 2018
1/--страниц
Пожаловаться на содержимое документа