close

Вход

Забыли?

вход по аккаунту

?

j.jff.2018.08.015

код для вставкиСкачать
Journal of Functional Foods 49 (2018) 20–31
Contents lists available at ScienceDirect
Journal of Functional Foods
journal homepage: www.elsevier.com/locate/jff
Bamboo-shaving polysaccharide protects against high-diet induced obesity
and modulates the gut microbiota of mice
Yufeng Chena, Lu Jinb, Yunhong Lia, Guobin Xiac, Chun Chena,d, Ying Zhanga,
T
⁎
a
Department of Food Science and Nutrition, School of Biosystems Engineering and Food Science, Zhejiang Key Laboratory for Agro-Food Processing, Zhejiang Engineering
Center for Food Technology and Equipment, Zhejiang University, Hangzhou 310058, China
b
School of Medicine, Zhejiang University, Hangzhou 310058, China
c
Children's Nutrition Research Center, Department of Pediatrics, Baylor College of Medicine, Houston, TX 77030, USA
d
Department of Pathology and Laboratory Medicine, School of Medicine, Emory University, Atlanta, GA 30322, USA
A R T I C LE I N FO
A B S T R A C T
Keywords:
Bamboo-shaving polysaccharide (BSP)
Prebiotic
Gut microbiota
Inflammation
Obesity
Insulin resistance
Increasing evidence has shown that gut microbiota plays a critical role in regulating pathogenesis of low-grade
inflammation and obesity. Bamboo-shaving polysaccharide (BSP, purity: 80–85%, Mw ≈ 10,000 g/mol) is well
known for its immunomodulatory capacity. However, no study has previously investigated the anti-obesity
activity of BSP. After high fat diet-fed mice were treated with BSP for 8 weeks, we showed that BSP not only
improved community richness and diversity of gut microbiota, but also regulated the composition of gut microbiota. Specifically, mice treated with BSP showed lower ratio of Firmicutes/Bacteroidetes, lower relative
abundance of harmful bacteria (Enterobacter and Desulfovibrio) and higher relative abundance of beneficial
bacteria (Akkermansia muciniphila and Lactobacillus). Moreover, BSP meliorated intestinal barrier integrity, reduced low-grade inflammation, improved lipid metabolism and ameliorated insulin resistance in obese mice.
Our results indicated that BSP could be exploited as prebiotic to protect against obesity and insulin resistance in
obese individuals.
1. Introduction
As a major kind of chronic disease today, obesity is prevailing all
over the world, and linked to numerous health problems and a reduced
life expectancy. Growing epidemiological evidence indicates that obesity is closely linked with type 2 diabetes mellitus, insulin resistance,
fatty liver disease, cardiovascular disease and cancer (Sonnenburg &
Bäckhed, 2016). For these reasons, obesity has become a research focus
in recent years and a growing body of novel treatment strategies have
been developed. Dietary interventions, including plant-derived foods or
functional components, offer a promising therapy to ameliorate obesity
and its complications (Chang et al., 2015; Zhuang et al., 2017).
Increasing evidence suggests that chronic low-grade inflammation is
crucial to the pathogenesis of obesity. Remarkably accumulated macrophages in visceral adipose tissue of obese individuals elevate circulating diverse pro-inflammatory cytokines levels, such as interleukin
(IL)-1β, IL-6, tumor necrosis factor alpha (TNF-α), and monocyte chemoattractant protein-1 (MCP-1). Pro-inflammatory adipokines will be
further together linked to abnormal metabolism (pancreatic β cells
damage, insulin resistance and glucose intolerance) (Lackey & Olefsky,
2016). Thus, control of pro-inflammation cytokine expression is critical
to reduce chronic low-grade inflammation and insulin resistance in
obese individuals.
Gut microbiota, composed of trillions of microorganisms, is associated with the development of obesity, and has been accepted as an
“environmental factor”, which exerts a prominent influence on host
metabolism, nutrient digestion, energy utilization and storage. In obese
mice, strong evidence for this argument is that ratio of the major phyla
Firmicutes/Bacteroidetes increased significantly in fat ones as compared
with lean ones. In addition, several specific bacterial species can alter
the development of obesity in both dietary and genetic obese mice
models. For instance, a single endotoxin-producing species Enterobacter
Abbreviations: BSP, bamboo-shaving polysaccharide; IL, interleukin; TNF-α, tumor necrosis factor alpha; MCP-1, monocyte chemoattractant protein-1; LPS, lipopolysaccaride; SCFAs, short chain fatty acids; NC, normal chow diet; HFD, high fat diet; T-CHO, total cholesterol; TG, triacylglycerol; HDL-C, high density lipoproteincholesterol; LDL-C, low density lipoprotein-cholesterol; FFA, free fatty acid; H&E, Hematoxylin-Eosin; cDNA, complementary DNA; OTUs, operational taxonomic
units; ITT, insulin tolerance test; GTT, glucose tolerance test; AUC, area under curve; Pcoa, principal coordinate analysis
⁎
Corresponding author at: College of Biosystems Engineering and Food Science, Zhejiang University, 866 Yuhangtang Road, Xihu District, Hangzhou 310058,
China.
E-mail address: yzhang@zju.edu.cn (Y. Zhang).
https://doi.org/10.1016/j.jff.2018.08.015
Received 8 May 2018; Received in revised form 30 July 2018; Accepted 7 August 2018
1756-4646/ © 2018 Elsevier Ltd. All rights reserved.
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
Tables S1 and S2.
cloacae, isolated from the gut in a severely obese human, caused obesity
and insulin resistance in germ-free mice (Fei & Zhao, 2013). Moreover,
mounting studies confirmed that an increase in the Akkermansia spp.
population could relieve obesity and intestinal barrier integrity in obese
mice (Plovier et al., 2017). Other studies in obese animal models suggest that obesity-induced gut dysbiosis impairs intestinal integrity and
further induces low-grade inflammation (Bleau, Karelis, St-Pierre &
Lamontagne, 2015). High-fat diet increases intestinal permeability, thus
elevating endotoxin lipopolysaccharide (LPS) from some intestinal
Gram-negative bacteria (such as Enterobacter and Desulfovibrio) gets into
the blood circulation and leads to metabolic inflammation in obese
animal models, which is so called “metabolic endotoxemia” hypothesis.
Therefore, efforts to improve obesity have been directed to reduce
dysbiosis of the gut microbiota via one of the most effective strategies
being added dietary intervention with functional food ingredients to
reduce insulin resistance and increase systemic anti-inflammatory activities of intestine.
Polysaccharide, as a kind of abundant and active natural products,
exhibited various biological activities, including anti-tumor, anti-inflammatory and blood lipid regulation effects (Chang et al., 2015;
Hoang, Kim, Ji, You & Lee, 2015; Liu, Xie, Sun, Meng & Zhu, 2017).
When the polysaccharide was absorbed into the large intestine (colon
and cecum) in body, it would be converted to short chain fatty acids
(SCFAs) (mainly including acetic acid, propionic acid and butyric acid)
and other metabolites under the action of carbohydrate-active enzymes.
Studies have shown that SCFAs were beneficial to the body with many
biological functions, such as promoting colon epithelial cell proliferation and growth, participating in the body's energy metabolism, regulating the inflammatory response and inhibiting the intestinal pathogenic bacteria colonization, etc. (Canfora, Jocken & Blaak, 2015).
Meanwhile, other studies have confirmed that polysaccharide with
complex structure could promote the growth of beneficial microbes in
the large intestine, such as Bifidobacterium and Lactobacillus, maintained
the stability of intestinal microecology and improved the symptom of
disordered intestinal flora (Everard et al., 2014).
In a previous study, we acquired a kind of active polysaccharide
isolated from bamboo shavings (Caulis Bambusae In Taenia). The
bamboo-shaving polysaccharide (BSP) is the arabinoxylan with a main
carbohydrate chain of β-1,4-D-pyranoid xylose residues and a main
substituent of Arab furanose base. It belongs to the hemicellulose
polysaccharide (Mw ≈ 10,000 g/moL) and contains neutral and acidic
structure (Fig. S1). Accordingly, BSP has a significant immunomodulatory effect on immunocompromised mice (Huang, et al.,
2017). In the present study, we hypothesized that oral administration of
BSP (200 mg/kg BW and 400 mg/kg BW) could positively modulate gut
microbiota and alleviate intestinal inflammation in HFD-induced obese
mice, which may contribute to its anti-obesity activity under dietary
intervention. To test this hypothesis, C57BL/6 mice were orally administrated with high-fat diet contained two different concentrations of
BSP for 8 weeks, then lipid and glucose profile, LPS, inflammatory
markers and gut microbiota were then measured.
Supplementary data associated with this article can be found, in the
online version, at https://doi.org/10.1016/j.jff.2018.08.015.
2.2. Animals and experimental design
Forty-five eight-week-old C57BL/6J male mice, average body
weight of 23.61 ± 1.0 g, were purchased from Beijing Vital River
Laboratory Animal Technology Co., Ltd. (Laboratory animal license
number: SCXK 2012–0001, Beijing, China). The mice were randomly
assigned to five groups (nine animals each group) with free access to
food and water in a controlled environment (12:12 h light–dark cycle,
constant temperature 22 ± 2 °C with a relative humidity of 55 ± 5%,
SPF level of barrier system). After one week of adaptation, five groups
of mice were fed on different diets, as follows: (1) normal chow diet
(NC; with 10% of energy from fat as food and distilled water as drinking
water); (2) normal chow diet with 400 mg/kg BSP (NC+BSP400, with
10% of energy from fat as food and 400 mg/kg BW, BSP infusions as
drinking water); (3) high-fat diet (HFD; with 60% of energy from fat as
food and distilled water as drinking water); (4) high-fat diet with
200 mg/kg BSP (HFD+BSP200, with 60% of energy from fat as food and
200 mg/kg BW, BSP infusions as drinking water); (5) high-fat diet with
400 mg/kg BSP (HFD+BSP400, with 60% of energy from fat as food and
400 mg/kg BW, BSP infusions as drinking water). The mice were
adopted food and distilled water (or BSP infusions) ad libitum. During
the experiments, body weight and food intake were recorded weekly.
With 8th week, insulin tolerance test (ITT) and glucose tolerance test
(GTT) were performed. The mice used for GTT were fasted overnight
and given glucose intraperitoneally (1.5 g/kg BW), blood glucose was
measured with tail vein blood at 0, 30, 60, 90 and 120 min using a GA-3
glucose meter (Sinocare, Changsha, China). Similarly, the mice used for
ITT were fasted for 6 h before intraperitoneal injection of human insulin
(0.75 units/kg; Novo Nordisk, Bagsvaerd, Denmark). All animal experimental procedures were approved by the Institutional Animal Care
and Use Committee of Zhejiang University (Approval No: ZJU
20160460).
2.3. Sample collection
At the end of the experiment, faeces were collected and stored at
-80 °C for the following gut microbiota analysis. After 12 h of food deprivation, animals were anaesthetized with 5% chloral hydrate, sacrificed by decapitation to collect blood. Serum was obtained using 3K-15
centrifugal machine (Sigma, Germany) at 2500g at 4 °C for 15 min, and
stored at −80 °C for subsequent biochemical analysis. Epididymal fat,
perirenal fat, liver, heart, kidney and spleen were carefully dissected
and weighed. A section of liver and epididymal fat were filled in 10 mL
4% neutral formaldehyde at room temperature for Hematoxylin-Eosin
(H&E) staining. Specimens of colon (≈5 mm) were enclosed in 10 mL
2.5% glutaraldehyde fixation fluid at room temperature for subsequent
transmission electron microscope. The rest of adipose tissue was prepared at −80 °C for inflammatory cytokine determination.
2.4. Biochemical analysis
Plasma insulin concentration was measured using the mouse insulin
ELISA kits (JYM0351Mo, Jiyinmei, Wuhan, China), LPS in plasma was
determined by commercial ELISA-kits, (Cloud-Clone, Katy, USA), and
plasma levels of total cholesterol (T-CHO), triacylglycerol (TG), high
density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C) and free fatty acid (FFA) were determined using
commercially available kits (Jiancheng, Nanjing, China), based on the
manufacturer’s instructions.
2. Materials and methods
2.1. Preparation of animal diet
BSP was prepared by our laboratory as described previously
(Huang, et al., 2017). Major parameters of preparation of BSP were as
follows: steam pressure was 2.2 MPa, time of steam pressure was 1 min,
and the sample contains 80–85% polysaccharide. Normal chow diet:
SLACOM breeding fodder was obtained from Shanghai Pluton Biotechnology Co., Ltd. (Shanghai, China). D12492 High-fat diet (60 kcal
%) was obtained from Research Diets, Inc. Co., Ltd. (New Brunswick,
NJ, USA). The ingredients and energy densities of the diets are listed in
2.5. Histological analysis
Small pieces of epididymal adipose tissue and liver of mice were
selected and fixed in 4% neutral formaldehyde solution for 24 h. Then
21
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
hypervariable regions were generated, the primers for those regions
(515F 5′-GTGCCAGCMGCCGCGG-3′ and 907R 5′-CCGTCAATTCMTTTRAGTTT-3′) were designed with a barcode sequence that was unique to
each sample. Reaction system of PCR amplification contained template
DNA (10 ng), FastPfu DNA polymerase and primers (10 μM). The PCR
reaction conditions consisted of 95 °C for 5 min, followed by 25 cycles
of 95 °C for 30 s, 55 °C for 30 s and 72 °C for 45 s, and a final extension
of 72 °C for 10 min. Detection of PCR product was performed on the 2%
agarose gel electrophoresis (PowerPac200, Bio-Rad, Hercules, USA).
Replicate PCR products were pooled and amplicons were purified
using the AxyPrepDNA gel extraction kit (Axygen, Silicon Valley, USA).
According to preliminary results from a quantitative gel electrophoresis, quantitative determination of PCR products was conducted using
QuantiFluor™-ST blue fluorescence quantitative system (Promega,
Madison, USA), followed by sequencing using the Illumina MiSeq
PE250 platform in terms of the instructions of the manufacturer.
Original Illumina PE250 data of sequencing sequence were processed using QIIME 1.17 software. Briefly, (1) according to the barcode,
removing the sections inconsistent with barcode sequence; (2) for reducing noise signals, a 50-bp sliding window was used to reduce sequencing error in combination with an average quality score of 20
within that window for sequence trimming; (3) according to the overlap
relationship within PE reads, the two reads are spliced into a sequence
with a minimum length of 10-bp; (4) 0.2 was the maximum error ratio
allowed in the overlap area of the splicing sequence to Screen fitted
sequence. The chimeras were removed using Usearch software. In accordance with the 97% similarity, operational taxonomic units (OTUs)
were carried out to the cluster using UPARSE software (version 7.1).
Taxonomic analysis of each 16S rRNA gene sequence was conducted in
comparison with Silva database using RDP Classifier software, the
confidence coefficient was 0.7 (Quast et al., 2013). Mothur software
was used to analyze alpha-diversity (within samples) and Rarefaction,
and R language tool was used to draw Rarefaction curve and Venn
diagram. OTUs, Ace index, Chao index, Shannon index and Simpson
index in different groups of gut microbiota were analyzed by GraphPad
Prism 6.0 software.
all tissues were dehydrated in graded ethanol (30%, 50%, 70%, 80%,
95%, 100% ethanol) for each 45 min. Xylene and alcohol were used to
make tissue more clear (1 h). Then the tissues were dipped in wax three
times at 55–60 °C 20–30 min each time and paraffin embedded at the
same temperature. Fat and liver tissue blocks were cut into 5–10 μm
sections and baked at 40 °C, finally, they were stained with hematoxylin
and eosin for observation using the binocular microscope (Eclipse E100,
Nikon, Tokyo, Japan).
Fixed colon tissues (5 mm) were rinsed with 0.1 mol/L phosphate
buffer (pH 7.0) for three times. Then they were added a proper amount
of 1% osmium acid solution to keep static treatment for 1.5 h and dehydrated in graded ethanol (30%, 50%, 70%, 80%, 95%, 100% ethanol)
for each 15 min. The dehydrated tissues were embedded a different
proportion of embedding agent (epoxy resin: acetone = 1:1 for 1 h,
epoxy resin: acetone = 3:1 for 3 h and pure embedding agent for 12 h.).
Then the embedded samples were cut into 70–90 nm sections and
stained with lead citrate and uranyl acetate-50% alcohol saturated solution. Representative photomicrographs were captured using the
transmission electron microscope (H-7650, Hitachi, Tokyo, Japan).
2.6. Real-time quantitative PCR
Total RNA was isolated from epididymal fat tissue using TRIzol
reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instruction. Quality of total RNA was analyzed by agarose gel
electrophoresis using electrophoresis apparatus (PowerPac200, BioRad, Hercules, USA) and gel imager (Tanon-3500, Tanon Ltd, Shanghai,
China). Purity and concentration determination of total RNA were on
the microplate reader (Eon, BioTek, USA). Complementary DNA
(cDNA) was prepared by reverse transcription from 1 μg total RNA
using the PrimeScript™RT reagent Kit with gDNA Eraser (Takara,
Japan). Real-time quantitative PCR detection of inflammatory cytokine
gene expression was performed using an SYBR® Premix Ex Taq™ II
(Takara, Japan) on the double color real-time fluorescence quantitative
PCR meter (MyiQ2, Bio-Rad, Hercules, USA). Primer information of
detected genes was shown in Table 1. The running condition was as
follows: initial denaturation at 95 °C for 30 s, PCR reaction about 40
cycles at 95 °C for 25 s , solution curve analysis at 95 °C for 0 s, 65 °C for
15 s and 95 °C for 0 s. The expression data of each gene was analyzed
according to the 2-ΔΔCt method (Livak & Schmittgen, 2001).
2.8. Statistical analysis
All data obtained from three replicate experiments were presented
as the mean ± SEM. Differences in two groups were assessed using the
unpaired two-tailed Student’s t-tests. Data sets that involved more than
two groups were assessed by one-way ANOVA followed by Tukey’s
honest significant difference post hoc tests. A p-value of 0.05 was considered statistically significant. All analyses were performed using
GraphPad Prism version 6.0 (GraphPad Sofware, San Diego, CA).
2.7. Gut microbiota analysis by 16S rRNA gene sequencing
Different groups of mouse feces were stored at −80 °C to be prepared for 16S rRNA gene sequencing analysis. Total DNA was extracted
from the faeces using a DNA isolation kit (Omega Bio-tek, Norcross,
USA) following the manufacturer’s instructions and selective DNA was
stored at −20 °C for the application. PCR amplification and product
testing were referred to the literature (Xiong et al., 2012), as follows:
target sequencing segment of the regions V4 and V5 of the 16S rDNA
3. Results
3.1. BSP relieved obesity in HFD-fed obese mice but not affected food intake
We first compared the preventive effect of BSP against HFD-induced
obesity. At the baseline (0 week), no significant difference in body
weight was observed among all diet groups. After 8 weeks, body weight
of mice fed the HFD diet was made highly significant increases compared to NC group, whereas, mice fed NC+BSP400 exhibited no difference in body weight from the NC mice (Fig. 1 A). At 8th week, body
weight of mice fed high dose group (HFD+BSP400) and low dose group
(HFD+BSP200) were significantly lower than the HFD group (high dose
group, p < 0.01; low dose group, p < 0.05). Beginning at 4th week,
HFD+BSP400 group showed a significant difference in contrast to HFD
group (p < 0.05), and, HFD+BSP200 group exhibited a significant
difference as compared with HFD group since when 6th week
(p < 0.05) (Fig. 1A and B). Meanwhile, food intake of mice in each
group was also tracked regularly. From the statistical analysis of the
results, although food intake of dietary BSP supplement of three groups
Table 1
Primer information of detected genes.
Gene
Primer sequence (5′–3′)
Length (bp)
TNF-α
Former primer: CCCTCACACTCAGATCATCTTCT
Reverse primer: GCTACGACGTGGGCTACAG
60
IL-1β
Former primer: GCAACTGTTCCTGAACTCAACT
Reverse primer: ATCTTTTGGGGTCCGTCAACT
88
IL-6
Former primer: TAGTCCTTCCTACCCCAATTTCC
Reverse primer: TTGGTCCTTAGCCACTCCTTC
75
MCP-1
Former primer: TCACTGAAGCCAGCTCTCTCT
Reverse primer: GTGGGGCGTTAACTGCAT
126
GAPDH
Former primer: GCATCCACTGGTGCTGCC
Reverse primer: TCATCATACTTGGCAGGTTTC
145
22
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
Fig. 1. Effect of BSP on body weight
and food intake in HFD-fed mice. (A)
Growth curve of mice in different
groups (n = 8–9 per group, data were
shown as mean ± SEM. Body weight
differences in A were analysed using
unpaired two-tailed Student’s t test,
#
p < 0.05, ##p < 0.01, HFD vs HFD
+BSP200; *p < 0.05, **p < 0.01, HFD
vs HFD+BSP400). (B) Body size of representative mice. (C) Average food
intake (g/d) of a mouse fed with NC and
NC+BSP400 in each week. (D) Average
food intake (g/d) of a mouse fed with
HFD in each week, HFD+BSP 200, HFD
+BSP400.
level (TC, T-CHO, LDL-C, HDL-C and FFA) in mice fed with NC (Fig. S2).
Insulin resistance is one of the most typical complications of obesity,
which is a status that a normal amount of insulin is not enough to
produce adequate insulin response (Chan et al., 2015), so, we then
assessed both GTT and ITT. Interestingly, in comparison with NC group
of mice, HFD mice produced a significant rise of fasting blood insulin
levels (p < 0.05), showing a certain degree of insulin resistance and
hyperinsulinemia (Fig. 3F and G). However, the blood glucose content
and AUC for ITT or GTT of HFD mice for BSP intervention group (HFD
+BSP200 and HFD+BSP400) were lower than that of HFD mice
(p < 0.05), we documented that BSP-fed mice showed even more
glucose tolerant and less insulin resistant than the HFD group.
(Fig. 3F–I). In this test, the mice fasting serum insulin concentration
was further determined. Results showed that HFD mice insulin concentrations had obvious recovery after the intervention of BSP, therein,
HFD+BSP400 group significantly decreased insulin concentration in
HFD-fed mice (Fig. 3H).
was slightly lower than the corresponding control group, there were no
significant differences among each group. Therefore, BSP intervention
possessed no effect on food intake of mice (Fig. 1C and D).
3.2. BSP suppressed fat mass development and hyperplasia of adipocytes in
HFD-fed obese mice
Using a mouse model of obesity, we observed that HFD feeding for
8 weeks led to significant increases of epididymal fat accumulation, and
lipid deposition in adipocytes and hepatocytes as compared with NC
feeding (Fig. 2A, D, E). While 400 mg/kg BW BSP did not generate any
apparent effects in normal chow-fed mice. Supplementation with BSP
prevented epididymal fat weight gain and hyperplasia of adipocytes in
a dose-dependent manner in HFD-fed mice. Additionally, decrement of
epididymal fat weight of mice fed HFD+BSP400 group showed a significant difference as compared with NC group (p < 0.05) (Fig. 2A–C).
In comparison with NC group, although the adipocyte size of HFD
group was obviously increased, BSP treatments reduced adipocyte size
within epididymal adipose tissues, especially in high dose group
(Fig. 2D). From the perspective of the H&E staining for liver tissue, as
compared with NC group, HFD mice liver biopsy had more visible white
lipid droplets, suggesting that HFD-fed mice have appeared a certain
degree of fat metabolism disorder in liver. We also observed a significant decrease in the level of fat accumulation of hepatocytes after
BSP intervention in comparison with HFD group, especially 400 mg/kg
BW BSP treatment (Fig. 2 E).
3.4. BSP reduced pro-inflammatory cytokines, systemic level of LPS and
improved colon epithelium structure in high fat diet obese mice
To examine the inhibit inflammation effect of BSP, we mainly investigated the relative mRNA expression levels of MCP-1 and representative inflammation factors, such as, TNF-α, IL-6 and IL-1β.
Similar with previous reports, the relative mRNA expression of MCP-1,
TNF-α, IL-6 and IL-1β in the fatty tissue of HFD mice was increased
significantly, indicating that the obese mice induced by HFD have
produced low-grade inflammation in adipose tissue. Meanwhile, the
supplement of 400 mg/kg BW BSP in HFD mice prompted to make the
expression of these inflammatory factors in fatty tissue declined significantly (p < 0.05). Some inflammatory cytokines (such as MCP-1,
IL-6) were close to the expression of the NC group, showing that high
doses of BSP have a beneficial influence in inhibiting chronic inflammation in HFD mice (Fig. 4A–D). Next, we examined the effects of
BSP supplementation on LPS blood levels. Although the HFD induced a
large increase of serum LPS level compared to NC or NC+BSP400 group
(p < 0.05), BSP supplementation reduced endotoxin level in a dose-
3.3. BSP improved serum lipid profile and insulin sensitivity in HFD-fed
obese mice
Excessive fat accumulation in obese individuals often causes dyslipidemia (including triglycerides, cholesterol, etc.). As shown in Fig A-E,
corresponding to the influence of BSP on body weight in HFD-fed mice,
BSP intervention improved dyslipidemia caused by HFD. The HFD
+BSP400 mice exhibited significantly decreased serum TC, T-CHO, LDLC and FFA as compared with HFD but did not significantly affected
HDL-C level. Furthermore, BSP intervention did not affect blood lipid
23
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
Fig. 2. BSP reduced fat accumulation in HFD-fed mice. (A) The weight of epididymal fat of mice (n = 8–9 per group, data were shown as mean ± SEM. Graph bars
with different letters on top correspond to statistically significant results (p < 0.05) based on one-way ANOVA analysis followed by Tukey’s honest significant
difference post hoc tests). Anatomy (B) and epididymal fat tissue size (C) of representative mice fed with HFD, HFD+BSP200 and HFD+BSP400. (D) H&E staining of
epididymal fat of mice in NC, NC+BSP400, HFD, HFD+BSP200 and HFD+BSP400 group (It was photographed at 200× magnification using the binocular microscope,
scale bar, 50 μm). (E) H&E staining of liver section of mice fed with NC, NC+BSP400, HFD, HFD+BSP200 and HFD+BSP400 group (It was photographed at 200×
magnification using the binocular microscope, scale bar, 50 μm).
at the top of intercellular space surface was clear and inerratic.
Nevertheless, intestinal structure of HFD-fed mice exhibited a certain
damage: microvilli differed in length along with a fracture phenomenon, tight connection was widened and irregular (red arrow marked).
dependent manner (p < 0.05) (Fig. 4E). Under the transmission electron microscopy, the epithelial cell membrane of colon mucosa in NC
and NC+BSP400 group exhibited a complete structure, had rich, length
uniform and arrangement regular microvilli, in addition, tight junction
24
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
Fig. 3. Effect of BSP on blood lipid level and insulin
sensitivity in mice fed with HFD. (A)–(E) TG, T-CHO,
LDL-C, HDL-C and FFA (n = 8–9, #p < 0.05, HFD vs
HFD+BSP200; *p < 0.05, ***p < 0.005, HFD vs
HFD+BSP400; §p < 0.05, HFD+BSP200 vs HFD
+BSP400; §§p < 0.01, HFD+BSP200 vs HFD
+BSP400, the significant differences were analysed
by unpaired two-tailed Student’s t test between any
two groups in turn). (F) insulin tolerance test (ITT),
(G) glucose tolerance test (GTT) (F-G: n = 8–9, ITT
and GTT differences between two groups were analysed using unpaired two-tailed Student’s t test,
#
p < 0.05, HFD vs HFD+BSP200; *p < 0.05, HFD
vs HFD+BSP400; &&p < 0.01, &p < 0.05, HFD vs
NC). (H)–(I) Area under curve (AUC) from ITT and
GTT (H–I: n = 8–9. Graph bars with different letters
on top correspond to statistically significant results
(p < 0.05) based on one-way ANOVA analysis followed by Tukey’s honest significant difference post
hoc tests). (J) Effect of BSP on fasting insulin concentration in serum of mice (n = 8–9. Graph bars
with different letters on top correspond to statistically significant results (p < 0.05) based on oneway ANOVA analysis followed by Tukey’s honest
significant difference post hoc tests).
BW BSP intervention improved this kind of phenomenon (Fig. 4F).
Under BSP intervention of two groups, microvilli and tight connection
have been improved certainly, high dose group was more obvious.
Besides, although some organelle cavitations were occured in cells of
HFD group, such as mitochondria (yellow arrow marked), 400 mg/kg
25
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
Fig. 4. BSP improved inflammation in
high-fat diet obese mice. (A)–(D) MCP1, TNF-α, IL-1β and IL-6 level in adipose
tissue of mice (n = 8–9. Graph bars with
different letters on top correspond to
statistically
significant
results
(p < 0.05) based on one-way ANOVA
analysis followed by Tukey’s honest
significant difference post hoc tests). (E)
LPS level in serum of mice (n = 8–9.
Graph bars with different letters on top
correspond to statistically significant
results (p < 0.05) based on one-way
ANOVA analysis followed by Tukey’s
honest significant difference post hoc
tests). (F) Histologic traits in the colon
of mice in NC, NC+BSP400, HFD, HFD
+BSP200 and HFD+BSP400 group
(Micro-examination by transmission
electron microscope, 30,000× magnification) .
range of 351–400 (Table S3). According to 350-bp of sequence length
(Xiong et al., 2012), the optimized sequence length met test requirement. Sequencing the number and average length of reads was detailed
in Table S4. In order to facilitate analysis, OTUs are the symbol artificial
to set up a particular taxon (strain, species, genus or group) in phylogenetics research or population genetics study. In this paper, according
to the similarity of 97%, we received 380 OTUs by classifying the optimized reads to OTUs, and OTUs of NC, NC+BSP400, HFD, HFD
+BSP400 and HFD+BSP200 group were 319, 318, 238, 318 and 238,
3.5. BSP altered the diversity and composition of the gut microbiota in HFDfed obese mice
We examined the effects of BSP on gut microbiota composition by
performing Illumina MiSeq PE250 sequence platform-based analysis
bacterial 16S rRNA (V4–V5 region) in caecal faeces. After quality filtered, a total of 571,770 optimized reads with a total length of 214,328,
090-bp of 15 samples were obtained. Average length per sample was
374.85-bp and sequence length of more than 99.9% was still in the
26
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
Fig. 5. BSP modulated gut microbiota in high-fat diet obese mice. (A)–(D) Community richness and diversity of gut microbiota (n = 3, $$p < 0.01, HFD vs
NC+BSP200; #p < 0.05, ##p < 0.01, HFD vs HFD+BSP200; *p < 0.05, **p < 0.01, HFD vs HFD+BSP400; §p < 0.05, NC+BSP400 vs HFD+BSP200, the significant
differences of the results were analysed by unpaired two-tailed Student’s t-test between any two groups in turn). (E) Rarefaction curve. (F)–(G) OTU numbers of
intestinal bacteria (F: OTU Venn analysis of samples of different groups, G: The shared OTUs between NC and any other group). (H) The plots shown were generated
using the weighted version of UniFrac-based Pcoa. (I) Microbial community. (J) The relative abundance ratio of Firmicutes to Bacteroidetes (n = 3. Graph bars with
different letters on top correspond to statistically significant results (p < 0.05) based on one-way ANOVA analysis followed by Tukey’s honest significant difference
post hoc tests). (K)–(O) Richness of some obesity-related intestinal bacteria in mice (J: Enterobacter, K: Desulfovibrio, L: Akkermansia muciniphila, M: Lactobacillus, N:
Bifidobacterium, n = 3. Graph bars with different letters on top correspond to statistically significant results (p < 0.05) based on one-way ANOVA analysis followed
by Tukey’s honest significant difference post hoc tests).
27
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
Fig. 5. (continued)
respectively.
When microbial diversity was analyzed, rarefaction curve was used
to verify whether sample sequencing data were enough to reflect
species diversity or not. Random samples were carried out from the
optimal reads, in order to draw rarefaction curve based on the sequence
numbers and their OTUs. We found that rarefaction curve was changing
28
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
from steep to flat gradually with the increase of optimized sequence
numbers, reflecting sample sequencing data were reasonable (Fig. 5E).
We investigated species richness and diversity of different groups,
library coverage of each sample was greater than 0.99, meaning that
the probability of unmeasured sequences of each samples was low and
the sequencing results were authentic and dependable (Table S4). For
Chao and Ace index, richness of gut microbiota trended to decrease in
HFD-fed mice as compared with NC group, however, BSP intervention
made the richness of microbial community increased significantly
(p < 0.05), no matter HFD+BSP200 group or HFD+HFD+BSP400
group (Fig. 5B and C). In BSP intervention groups (HFD+BSP200 and
HFD+BSP400 group), Shannon index and Simpson index were significantly (p < 0.05) increased and decreased as compared with HFD
group respectively, reflecting that supplement of BSP increased the
diversity of intestinal microbial in HFD-fed mice (Fig. 5A and D).
In the study of intestinal microbial analysis, Venn analysis is used to
count the number of OTUs shared and unique in multiple samples,
which can directly present the similarity and overlap of OTUs in samples from five groups. As shown in Fig. 5F and G, OTUs of NC+BSP400,
HFD, HFD+BSP400 and HFD+BSP200 group shared with NC group
were 294, 193, 220, 240, respectively. This showed that BSP intervention has increased the similarity of OTUs of HFD-fed mice. The
phylogenetic differences within the intestinal microbiota were assessed
by Principal Coordinate Analysis (Pcoa) analysis (Fig. 5H). The HFD
diet fed mice had a distinct microbiota composition that clustered separately from the NC and NC+BSP400 mice. The BSP fed mice formed a
distinct cluster from the HFD and NC mice.
After the species annotation of OTUs, we found that Firmicutes,
Bacteroidetes, Actinobacteria, Proteobacteria and Deferribacteres were
common phyla in all groups. Based on relative abundance of different
phylum in the intestinal microbial of each sample, it was obvious that
the Firmicutes and Bacteroidetes had an absolute advantage in all samples, and their relative abundance was above 90% (Fig. 5I). Meanwhile,
the relative abundance ratio of the major phyla Firmicutes/Bacteroidetes
in each sample was also analyzed, it showed that the relative abundance ratio of Firmicutes/Bacteroidetes in HFD mice intestine was significantly increased in comparison with NC group (p < 0.05). However, after 8 weeks of BSP intervention on HFD-fed mice, the relative
abundance ratio of Firmicutes/Bacteroidetes was significantly decreased,
especially the high dose group (p < 0.05) (Fig. 5J). Furthermore, we
analyzed the effect of BSP on relative abundance of four phyla in this
paper, in order to further understand the BSP effect on intestinal microbial. Relative abundance of Enterobacter in NC-fed mice was extremely low, but relative abundance of this kind of phylum was increased about 0.3% in mice treated with high fat diet (p < 0.05). After
feeding BSP to HFD mice, the relative abundance was fell to about
0.05% (p < 0.05) (Fig. 5K). In comparison with NC group, relative
abundance of Desulfovibrio in HFD group was significantly enhanced
(p < 0.05), and the situation was improved after the BSP intervention,
but it has not yet reached a significant result (Fig. 5L). Notably, we also
noticed that relative abundance of Akkermansia muciniphila was significantly reduced in HFD group, even close to the detection threshold
compared with NC group, however, high dose of BSP intervention
significantly increased relative abundance of Akkermansia muciniphila in
HFD-fed mice (p < 0.05) (Fig. 5M). Finally, we explored relative
abundance of common probiotics (such as Lactobacillus and Bifidobacterium), as shown in Fig. 5N and O, 400 mg/kg BW BSP intervention
could significantly improve relative abundance of Lactobacillus as
compared with HFD-fed mice group (p < 0.05), but relative abundance of Bifidobacterium was not detected in HFD group and HFD+BSP
group.
were varied (Ben et al., 2015; Choi, et al., 2016; Li, et al., 2017; Wu,
Guo, Liu, Wang & Zhang, 2016). In the present study, we showed BSP
prevented HFD-induced obesity and alleviated inflammation probably
by modulating the composition and diversity of the gut microbiota and
maintaining intestinal barrier integrity, in which high molecular weight
BSP were identified as the major bioactive ingredient.
Obesity is accompanied with the increase of adipose tissue and fat
accumulation in liver that caused corresponding metabolism dysfunction. In our study, we found that BSP (400 mg/kg BW) intake reduced
the weight and cell size of adipose tissue, particularly epididymal fat of
HFD mice (Fig. 2A–D). Meanwhile, with the increase of BSP dose (from
200 to 400 mg/kg BW), lipid droplets gradually reduced in hepatic,
indicating BSP was helpful to reduce fat accumulation in liver (Fig. 2E).
Numerous studies have already shown some indigestible polysaccharides, such as polyfructose and green tea polysaccharide, could
reduce appetite by increasing satiety to achieve weight reduction
(Amandine et al., 2011; Shen, Obin & Zhao; Xu, et al., 2015). Nevertheless, we did not find any changes in food intake among groups,
which suggested that BSP modulated body weight via a possible mechanism other than food intake regulation (Wu, Clark & Palmiter,
2012), which is not consistent with a previous paper (Brooks et al.,
2016). Previous studies have demonstrated that HFD-induced oxidative
stress weakened the oxidation resistance of the digestive and blood
system leading to abnormal lipid metabolism and consequently dyslipidemia (Yang, Le, Li, Zheng & Shi, 2006). To further verify the modulatory effect of BSP on dyslipidemia, we found that BSP (200 or
400 mg/kg BW) significantly decreased concentrations of serum TC, TCHO, LDL-C and FFA compared to HFD-fed mice, which is consistent
with previous literatures (Li, Guo, Ji & Zhang, 2016; Wang, Tang,
Cheserek, Shi & Le, 2015). Taken together, this result suggests that BSP
may play a potent role in alleviating obesity-induced abnormal lipid
metabolism and dyslipidemia.
Given that obesity is often accompanied with insulin resistance, thus
it will increase the risk of type II diabetes (Barlow, Yu & Mathur, 2015;
Mathur & Barlow, 2015). Insulin resistance promotes triglyceride hydrolysis thus improving plasma FFA levels in adipocyte, reduces the
absorption of glucose in muscle cell and the reservation of glucose in
live cell, which consequently resulting in an increase in blood sugar
levels. In addition, decreased insulin sensitivity is compensatory to
further stimulate islet cells to produce more insulin to promote the
recovery of blood glucose levels, thus leading to the presence of hyperinsulinemia. However, the glucose homeostasis-improving effect of
BSP has not been fully elucidated and the influence of BSP on insulin
also received little attention. Based on BSP’s remarkable or notable
prevention on weight gain and fat accumulation, we speculated that
BSP might improve insulin sensitivity in HFD mice. As shown in
Fig. 3F–I, on one hand, as compared with NC group of mice, HFD mice
has produced a certain degree of insulin resistance and hyperinsulinemia, on the other hand, BSP treatment enhanced the insulin
signaling to improve the ability of glucose uptake and utilization, and
suppression in blood sugar rise. We also determined fasting serum insulin concentration in mice, demonstrating that BSP had a positive effect on improving insulin sensitivity (Fig. 3J). Therefore, the BSP supplement exerts important effects on the regulation of insulin sensitivity
to guarantee glucose homeostasis in obese individuals.
Obesity is characterized by chronic low-degree inflammation.
Previous studies have shown that over-production of pro-inflammatory
cytokines including TNF-α, IL-1β, IL-6 and MCP-1 could enter into
blood circulation to destroy related organizations metabolism of insulin
signaling pathways and reduce the adipocyte insulin sensitivity in obese
animals and human. In addition, these inflammatory cytokines in adipose tissue can also give rise to the triglyceride hydrolysis in adipocyte
that produces a large amount of FFA into the blood circulation, so as to
further induce insulin resistance. Similar to previous studies about
polysaccharide (Shang et al., 2017; Wang et al., 2017), BSP supplement
surprisingly reduced the production of pro-inflammatory cytokines in
4. Discussion
Although previous studies have shown that dietary polysaccharide
lowered body weight in HFD-fed mice model, the mechanisms of action
29
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
probiotics, play an important role in balancing gut microbiota and
protecting the intestinal epithelial cells (Di, Aloisio, Mazzola & Biavati,
2014; Million et al., 2012). In our study, we discovered that 400 mg/kg
BW BSP intervention could significantly improve relative abundance of
Lactobacillus as compared with HFD-fed mice group, which is similar to
previous report on apple polysaccharide (Wang et al., 2017). Unfortunately, we did not observe any significant increase of Bifidobacterium after BSP treatment, which indicates that blood glucose and
lipid metabolism in obese mice is irrelevant to Bifidobacterium after BSP
intervention and it requires further study to confirm. Taken together,
we tentatively put forward that it provides a robust evidence for the
potential application of BSP on modulation of gut microbiota during its
beneficial effect on alleviation of obesity in obese mice.
the present study (Fig. 4A–D), which may account for the ameliorative
insulin sensitivity observed in the treated HFD mice. Furthermore, lowgrade inflammation is mainly related to early trigger factors-LPS which
was derived from the release of some gram-negative bacteria in the
intestinal. Although the specific pathway linking intestinal inflammation and obesity has not been fully understood yet, studies demonstrated that intestinal inflammation is often associated with impaired
intestinal integrity (Shan et al., 2013), which plays a central role in the
leakage of LPS into the blood circulation (Caesar, Tremaroli,
Kovatchevadatchary, Cani & Bäckhed, 2015; Shan et al., 2013). In this
study, we observed that BSP-treatment significantly reduced LPS levels
in HFD-fed mice (Fig. 4E), indicating that it alleviates the symptoms of
metabolic endotoxemia, which is similar to the related previous report
(Sun, Ren, Xiong, Zhao & Guo, 2016). Also, after an analysis of transmission electron microscope, we found that dietary BSP intervention
protected the gut barrier integrity (Fig. 4F), which partially explains the
reason for systemic LPS levels decline. Thus, these data might indicate
that the decrease of inflammation reaction in HFD group can be partly
explained by the lower leakage of LPS from the intact gut lumen.
Finally, given that obesity is associated with gut microbiota dysbiosis, which also leads to increased blood levels of LPS toxins and
intestinal mucosa permeability. It is required for us to detect the effect
of BSP on diversity and composition of the gut microbiota in HFD-fed
obese mice. Community richness mainly includes the Chao and the Ace
index, and community diversity mainly includes Shannon and Simpson
index. Thus, as shown in Fig. 5A–D, community richness and community diversity of gut microbiota were significantly enhanced after the
dietary BSP intervention. In addition, the gut microbiota of obese humans and animals is associated with increased levels of intestinal Firmicutes and decreased levels of Bacteroidetes, indicating that these major
phyla may play a role in obesity-related inflammation (Chang et al.,
2015). In our case, we observed that 400 mg/kg BW BSP supplementation in HFD-fed mice exhibited a significantly lower ratio of
Firmicutes/Bacteroidetes (Fig. 5J), which is consistent with previous report (Shi, Li, Wang & Feng, 2015). Interestingly, in accordance with
previous studies (Guo, et al., 2008; Ley, et al., 2005), we also observed
that Firmicutes and Bacteroidetes occupied more than 90% in the sum of
relative abundance of intestinal microbial phyla. Enterobacter and Desulfovibrio are two kinds of conditional pathogenic bacteria to produce
LPS endotoxin (Xu et al., 2017), their relative abundance and related
LPS level are higher in the intestinal tract of obese patients than healthy
people (Fei & Zhao, 2013; Zou et al., 2015). Besides, high levels of
Enterobacter and Desulfovibrio will damage intestinal epithelial cells and
the intestinal barrier integrity. Corresponding with these observations,
relative abundance of Enterobacter and Desulfovibrio in HFD group was
significantly enhanced in comparison with NC group, but after
switching back to the BSP intervention, the situation was reversed
significantly. It appeared that BSP could exert an anti-obesity effect by
reducing the generation of LPS and protecting the intestinal barrier
integrity via suppressing the overgrowth of harmful bacteria (Enterobacter and Desulfovibrio). We also started to speculate whether the
beneficial bacteria could be conducive to the anti-obesity capacity by
inhibiting inflammation reaction and maintaining intestinal barrier
function. Akkermansia muciniphila is one kind of bacteria distributed in
the intestinal mucous layer, playing an important role in promoting
intestinal barrier integrity (Everard et al., 2013; Plovier et al., 2017).
Clinical work also confirmed that the abundance of Akkermansia muciniphila is negatively correlated with biomarkers of obesity (Kim, Song
& Kim, 2014). Along with these literatures, our results indicated that
BSP induced enrichment in Akkermansia muciniphila was sufficient to
reverse HFD-induced obesity, which maybe partially due to that Akkermansia muciniphila can promote polysaccharide transform into
SCFAs. Meanwhile, SCFAs contributes hugely to ameliorate glucose
homeostasis and insulin sensitivity via suppressing production of proinflammatory cytokines in liver, muscle and adipose tissue (Canfora
et al., 2015). Lactobacillus and Bifidobacterium, as important intestinal
5. Conclusions
In summary, present study demonstrated that high molecular
weight polysaccharide derived from bamboo shavings exhibited antiobesogenic, antidiabetic and anti-inflammatory properties in an animal
model of HFD-induced obesity. BSP improved community richness and
community diversity of gut microbiota, also, BSP regulated the composition of gut microbiota, showing the lower ratio of Firmicutes/
Bacteroidetes, lower number of Enterobacter and Desulfovibrio and higher
number of Akkermansia muciniphila and Lactobacillus. Moreover, BSP
improved intestinal barrier integrity to prevent the leakage of LPS into
blood circulation consequently resulting in a reduced chronic inflammation and insulin resistance in HFD-fed mice. Above all our results suggest that BSP may be used as a potential prebiotic or functional
food against obesity, insulin resistance and chronic inflammation in
obese individuals.
Conflict of interest
The authors declared that there is no conflict of interest, financial or
otherwise to this work.
Ethics statement
(a) The material has not been published in whole or in part elsewhere.
(b) The paper is not currently being considered for publication elsewhere.
(c) All authors have been personally and actively involved in substantive work leading to the report, and will hold themselves jointly
and individually responsible for its content.
(d) All relevant ethical safeguards have been met in relation to animal
experimentation.
(e) The relevant animal ethics certificate was approved by approved by
the Institutional Animal Care and Use Committee of Zhejiang
University (Approval No: ZJU 20160460), and animal ethics certificate written by Chinese will be uploaded JPG file in submission
system.
Acknowledgments
This work was supported by the National Natural Science
Foundation of China [grant number: 31371754]. The authors are
grateful to the enthusiastic subjects including PhD candidate Lingyan
Ye, etc. who participated in the study.
References
Amandine, E., Vladimir, L., Muriel, D., Myriam, G., Muccioli, G. M., Neyrinck, A. M., ...
De, V. W. M. (2011). Responses of gut microbiota and glucose and lipid metabolism
to prebiotics in genetic obese and diet-induced leptin-resistant mice. Diabetes, 60(11),
2775–2786.
Barlow, G. M., Yu, A., & Mathur, R. (2015). Role of the gut microbiome in obesity and
diabetes mellitus. Nutrition in Clinical Practice Official Publication of the American
30
Journal of Functional Foods 49 (2018) 20–31
Y. Chen et al.
Liu, W. B., Xie, F., Sun, H. Q., Meng, M., & Zhu, Z. Y. (2017). Anti-tumor effect of
polysaccharide from Hirsutella sinensis on human non-small cell lung cancer and
nude mice through intrinsic mitochondrial pathway. International Journal of Biological
Macromolecules, 99, 258–264.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using
real-time quantitative PCR and the 2ΔΔCt Method. Methods, 25, 402–408.
Mathur, R., & Barlow, G. M. (2015). Obesity and the microbiome. Canadian Journal of
Diabetes, 39(8) S**7–S**7.
Million, M., Maraninchi, M., Henry, M., Armougom, F., Richet, H., Carrieri, P., ... Raoult,
D. (2012). Obesity-associated gut microbiota is enriched in Lactobacillus reuteri and
depleted in Bifidobacterium animalis and Methanobrevibacter smithii. International
Journal of Obesity, 36(6), 817–825.
Plovier, H., Everard, A., Druart, C., Depommier, C., Hul, M. V., Geurts, L., ... Lichtenstein,
L. (2017). A purified membrane protein from Akkermansia muciniphila or the pasteurized bacterium improves metabolism in obese and diabetic mice. Nature Medicine,
23(1), 107–116.
Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., ... Glöckner, F. O.
(2013). The SILVA ribosomal RNA gene database project: Improved data processing
and web-based tools. Nucleic Acids Research, 41(Database, issue), 590–596.
Shan, C. Y., Yang, J. H., Kong, Y., Wang, X. Y., Zheng, M. Y., Xu, Y. G., ... Chen, L. M.
(2013). Alteration of the intestinal barrier and GLP2 secretion in Berberine-treated
type 2 diabetic rats. Journal of Endocrinology, 218(3), 255–262.
Shang, Q., Song, G., Zhang, M., Shi, J., Xu, C., Hao, J., ... Yu, G. (2017). Dietary fucoidan
improves metabolic syndrome in association with increased Akkermansia population
in the gut microbiota of high-fat diet-fed mice. Journal of Functional Foods, 28,
138–146.
Shen, J., Obin, M. S., & Zhao, L. (2013). The gut microbiota, obesity and insulin resistance. Molecular Aspects of Medicine, 34(1), 39–58.
Shi, L. L., Li, Y., Wang, Y., & Feng, Y. (2015). MDG-1, an Ophiopogon polysaccharide,
regulate gut microbiota in high-fat diet-induced obese C57BL/6 mice. International
Journal of Biological Macromolecules, 81, 576–583.
Sonnenburg, J. L., & Bäckhed, F. (2016). Diet-microbiota interactions as moderators of
human metabolism. Natrue, 535(7610), 56–64.
Sun, J., Ren, F., Xiong, L., Zhao, L., & Guo, H. (2016). Bovine lactoferrin suppresses highfat diet induced obesity and modulates gut microbiota in C57BL/6J mice. Journal of
Functional Foods, 22, 189–200.
Wang, S., Li, Q., Zang, Y., Zhao, Y., Liu, N., Wang, Y., ... Mei, Q. (2017). Apple
Polysaccharide inhibits microbial dysbiosis and chronic inflammation and modulates
gut permeability in HFD-fed rats. International Journal of Biological Macromolecules,
99, 282–292.
Wang, H., Tang, X., Cheserek, M. J., Shi, Y., & Le, G. (2015). Obesity prevention of
synthetic polysaccharides in high-fat diet fed C57BL/6 mice. Journal of Functional
Foods, 17, 563–574.
Wu, Q., Clark, M. S., & Palmiter, R. D. (2012). Deciphering a neuronal circuit that
mediates appetite. Natrue, 483(7391), 594–598.
Wu, T., Guo, Y., Liu, R., Wang, K., & Zhang, M. (2016). Black tea polyphenols and
polysaccharides improve body composition, increase fecal fatty acid, and regulate fat
metabolism in high-fat diet-induced obese rats. Food & Function, 7(5), 2469–2478.
Xiong, J., Liu, Y., Lin, X., Zhang, H., Zeng, J., Hou, J., ... Chu, H. (2012). Geographic
distance and pH drive bacterial distribution in alkaline lake sediments across Tibetan
Plateau. Environmental Microbiology, 14(9), 2457–2466.
Xu, P., Fan, H., Wang, J., Cong, Y., Shu, D., Sheng, W., ... Jin, L. (2017). Microbiome
remodeling via the montmorillonite adsorption-excretion axis prevents obesity-related metabolic disorders. Ebiomedicine, 16(C), 251–261.
Xu, Y., Zhang, M., Wu, T., Dai, S., Xu, J., & Zhou, Z. (2015). The anti-obesity effect of
green tea polysaccharides, polyphenols and caffeine in rats fed with a high-fat diet.
Food & Function, 6(1), 297–304.
Yang, R., Le, G., Li, A., Zheng, J., & Shi, Y. (2006). Effect of antioxidant capacity on blood
lipid metabolism and lipoprotein lipase activity of rats fed a high-fat diet. Nutrition,
22(11–12), 1185–1191.
Zhuang, P., Shou, Q., Lu, Y., Wang, G., Qiu, J., Wang, J., ... Zhang, Y. (2017). Arachidonic
acid sex-dependently affects obesity through linking gut microbiota-driven inflammation to hypothalamus-adipose-liver axis. Biochimica et Biophysica Acta (BBA) –
Molecular Basis of Disease, 1863(11), 2715–2726.
Zou, Z. Y., Hu, Y. R., Hang, M., Wang, Y. Z., Kai, H., Shuang, X., ... Ye, X. L. (2015).
Coptisine attenuates obesity-related inflammation through LPS/TLR-4-mediated signaling pathway in Syrian golden hamsters. Fitoterapia, 105, 139–146.
Society for Parenteral & Enteral Nutrition, 30(6), 787–797.
Ben, A. K. R., Ben, G. A., Chaaben, R., El, F. A., Paolo, P. F., El, F. L., & Belghith, K. (2015).
Anti-obesity and lipid lowering effects of Cymodocea nodosa sulphated polysaccharide on high cholesterol-fed-rats. Archives of Physiology & Biochemistry, 121(5),
210–217.
Bleau, C., Karelis, A. D., St-Pierre, D. H., & Lamontagne, L. (2015). Crosstalk between
intestinal microbiota, adipose tissue and skeletal muscle as an early event in systemic
low grade inflammation and the development of obesity and diabetes. Diabetes/metabolism Research & Reviews, 31(6), 545–561.
Brooks, L., Viardot, A., Tsakmaki, A., Stolarczyk, E., Howard, J. K., Cani, P. D., ...
Anastasovskaj, J. (2016). Fermentable carbohydrate stimulates FFAR2-dependent
colonic PYY cell expansion to increase satiety. Molecular Metabolism, 6(1), 48–60.
Caesar, R., Tremaroli, V., Kovatchevadatchary, P., Cani, P. D., & Bäckhed, F. (2015).
Crosstalk between gut microbiota and dietary lipids aggravates WAT inflammation
through TLR signaling. Cell Metabolism, 22(4), 658–668.
Canfora, E. E., Jocken, J. W., & Blaak, E. E. (2015). Short-chain fatty acids in control of
body weight and insulin sensitivity. Nature Reviews Endocrinology, 11(10), 577–591.
Chan, C. B., Tse, M. C. L., Liu, X., Zhang, S., Schmidt, R., Otten, R., ... Ye, K. (2015).
Activation of muscular TrkB by its small molecular agonist 7,8-dihydroxyflavone sexdependently regulates energy metabolism in diet-induced obese mice. Chemistry &
Biology, 22(3), 355–368.
Chang, C. J., Lin, C. S., Lu, C. C., Martel, J., Ko, Y. F., Ojcius, D. M., ... Young, J. D. (2015).
Ganoderma lucidum reduces obesity in mice by modulating the composition of the
gut microbiota. Nature Communications, 6, 7489.
Choi, J. W., Synytsya, A., Capek, P., Bleha, R., Pohl, R., & Park, Y. I. (2016). Structural
analysis and anti-obesity effect of a pectic polysaccharide isolated from Korean
mulberry fruit Oddi (Morus alba L.). Carbohydrate Polymers, 146, 187–196.
Di, G. D., Aloisio, I., Mazzola, G., & Biavati, B. (2014). Bifidobacteria: Their impact on gut
microbiota composition and their applications as probiotics in infants. Applied
Microbiology & Biotechnology, 98(2), 563–577.
Everard, A., Belzer, C., Geurts, L., Ouwerkerk, J. P., Druart, C., Bindels, L. B., ... Cani, P. D.
(2013). Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity. Proceedings of the National Academy of Sciences of the United
States of America, 110(22), 9066–9071.
Everard, A., Lazarevic, V., Gaïa, N., Johansson, M., Ståhlman, M., Backhed, F., ... Cani, P.
D. (2014). Microbiome of prebiotic-treated mice reveals novel targets involved in
host response during obesity. ISME Journal, 8(10), 2116–2130.
Fei, N., & Zhao, L. (2013). An opportunistic pathogen isolated from the gut of an obese
human causes obesity in germfree mice. ISME Journal Multidisciplinary Journal of
Microbial Ecology, 7(4), 880–884.
Guo, X., Xia, X., Tang, R., Zhou, J., Zhao, H., & Wang, K. (2008). Development of a realtime PCR method for Firmicutes and Bacteroidetes in faeces and its application to
quantify intestinal population of obese and lean pigs. Letters in Applied Microbiology,
47(5), 367–373.
Hoang, M. H., Kim, J. Y., Ji, H. L., You, S. G., & Lee, S. J. (2015). Antioxidative, hypolipidemic, and anti-inflammatory activities of sulfated polysaccharides from
Monostroma nitidum. Food Science & Biotechnology, 24(1), 199–205.
Huang, J., Pang, M., Li, G., Wang, N., Jin, L., & Zhang, Y. (2017). Alleviation of cyclophosphamide-induced immunosuppression in mice by naturally acetylated hemicellulose from bamboo shavings. Food and Agricultural Immunology, 28(2), 328–342.
Huang, J. Q., Qi, R. T., Pang, M. R., Liu, C., Li, G. Y., & Zhang, Y. (2017). Isolation,
chemical characterization, and immunomodulatory activity of naturally acetylated
hemicelluloses from bamboo shavings. Journal of Zhejiang University.science.b, 18(2),
138–151.
Kim, B. S., Song, M. Y., & Kim, H. (2014). The anti-obesity effect of Ephedra sinica through
modulation of gut microbiota in obese Korean women. Molecular Aspects of Medicine,
152(3), 532–539.
Lackey, D. E., & Olefsky, J. M. (2016). Regulation of metabolism by the innate immune
system. Nature Reviews Endocrinology, 12(1), 15–28.
Ley, R. E., Bäckhed, F., Turnbaugh, P., Lozupone, C. A., Knight, R. D., & Gordon, J. I.
(2005). Obesity alters gut microbial ecology. Proceedings of the National Academy of
Sciences of the United States of America, 102(31), 11070–11075.
Li, X., Gong, H., Yang, S., Yang, L., Fan, Y., & Zhou, Y. (2017). Pectic bee pollen polysaccharide from rosa rugosa alleviates diet-induced hepatic steatosis and insulin resistance via induction of AMPK/mTOR-mediated autophagy. Molecules, 22(5), 699.
Li, X., Guo, J., Ji, K., & Zhang, P. (2016). Bamboo shoot fiber prevents obesity in mice by
modulating the gut microbiota. Scientific Reports, 6(32953), 32953.
31
Документ
Категория
Без категории
Просмотров
0
Размер файла
2 674 Кб
Теги
015, 2018, jff
1/--страниц
Пожаловаться на содержимое документа