close

Вход

Забыли?

вход по аккаунту

?

j.jff.2018.08.020

код для вставкиСкачать
Journal of Functional Foods 49 (2018) 32–43
Contents lists available at ScienceDirect
Journal of Functional Foods
journal homepage: www.elsevier.com/locate/jff
Sesamin suppresses LPS-induced microglial activation via regulation of
TLR4 expression
T
Sasimol Udomruk, Chayanut Kaewmool, Peraphan Pothacharoen, Thanyaluck Phitak,
⁎
Prachya Kongtawelert
Thailand Excellence Center for Tissue Engineering and Stem Cells, Department of Biochemistry, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand
A R T I C LE I N FO
A B S T R A C T
Keywords:
Sesamin
Toll-like receptor 4
Pro-inflammatory mediators
Neurodegeneration
Sesamin, one of the most abundant lignans in sesame seeds and oils, is well known for neuroprotective activity.
However, its effects on toll-like-receptor 4 (TLR4), the key innate immune receptor implicated in microglia
activation and neuroinflammation has not been reported. Our study demonstrated that sesamin significantly
diminished LPS-stimulated TLR4 expression result in the reduction of nitric oxide (NO), prostaglandin E2 (PGE2)
and pro-inflammatory cytokines (TNF-α, IL-1β and IL-6) in BV2 microglia by suppressing JNK and NF-κB
pathway. While conditioned medium from LPS-stimulated microglia-induced PC12 cell death, sesamin pretreatment on microglia abrogated the cytotoxic effects of pro-inflammatory mediators. Our result also demonstrated the direct effect of sesamin in ameliorating PC12 cell death induced by activated microglial-conditioned
medium. These results suggested that sesamin alleviated inflammation-induced neurodegeneration via inhibition of TLR4 expression and microglial activation resulting in diminishing the neurotoxicity effect. Sesamin
might be a potential agent for neurodegenerative diseases prevention.
1. Introduction
Neuroinflammation mediated-microglial activation is a major pathological cause associated with the progression of several neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease,
and multiple sclerosis (Chen, Zhang, & Juan, 2016). Microglia are the
principal cell type involved in regulating the brain’s immune defense
mechanism. However, when microglial cells sense infection or injury,
they undergo morphological and phenotypic profile changes through
the alteration of cell signaling and gene expression which leads to inflammatory cell recruitment and the release of pro-inflammatory factors. Excessive production of theses inflammatory mediators trigger
neuron cell death bring about to neurodegeneration (Kempuraj et al.,
2017). Thus, the primary cause the brain diseases is associated with
dysregulation of microglia activation leading to chronic inflammation.
Inflammatory response-mediated infectious agents are normally
initiated by interaction between pattern recognition receptors (PRRs)
and pathogen associated molecular patterns (PAMPs) (Akira &
Takeuchi, 2010). Toll-like receptor 4 (TLR4), a member of the toll-like
receptor (TLR) family, is a general type of pattern recognition receptor
that recognize with LPS. This receptor is highly expressed on the microglial surface and required for microglial activation. TLR4 is
⁎
upregulated in microglial cells during microglial activation and promotes pro-inflammatory mediator release through the NF-κB and MAPK
pathways (Kacimi, Giffard, & Yenari, 2011) leads to the appearance of
pro-inflammatory mediators such as interleukin-1β (IL-1β), interleukin6 (IL-6), tumor necrosis factor alpha (TNF-α), reactive oxygen species
(ROS), nitric oxide (NO), and other pro-inflammatory molecules such as
prostaglandin E2 (PGE2) which contribute to neuronal cell death
(Kempuraj et al., 2017). TLR4 has been suggested as a mediator of
Alzheimer disease (AD) and other neurodegenerative conditions
(Buchanan, Hutchinson, Watkins, & Yin, 2010). Recent studies demonstrating that neurodegeneration is reduced upon TLR4 inhibition
(Rahimifard et al., 2017; Suzuki & Okada, 2017). Thus, targeting the
TLR4 and its downstream signaling pathway might be a novel therapeutic strategy for impeding the progression of inflammation-mediated neurodegenerative diseases.
Sesamin, a major component of sesame lignans, exhibits many
beneficial biological properties including antioxidant antihypertension
and anti-inflammation which is of particular interest. About brain
permeability, sesamin was detected in brain tissue after rat administration while its metabolites were not found (Tomimori, Rogi, &
Shibata, 2016; Umeda-Sawada, Ogawa, & Igarashi, 1999); thus, this
study focused on sesamin which has been shown to protect against
Corresponding author.
E-mail address: prachya.k@cmu.ac.th (P. Kongtawelert).
https://doi.org/10.1016/j.jff.2018.08.020
Received 16 April 2018; Received in revised form 29 July 2018; Accepted 8 August 2018
1756-4646/ © 2018 Elsevier Ltd. All rights reserved.
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
2.2. Cytotoxicity assay
hypoxia/ischemia by reducing ROS levels and decreasing caspase-3
expression on microglia and neurons (Hsieh et al., 2011). Sesamin also
protects dopaminergic cells and PC12 from MPP+ (1-methyl-4-phenylpyridinium), high-glucose-induced oxidation and apoptosis
(Bournival, Francoeur, Renaud, & Martinoli, 2012; Bournival, Plouffe,
Renaud, Provencher, & Martinoli, 2012). However, the effect of sesamin on TLR4 and the mechanism underlying the protective effect of
sesamin on microglial-induced neural cell death is still unclear. The
present study demonstrated that sesamin can inhibit LPS-induced TLR4
expression and neurotoxic factors in microglial cells by attenuating NFκB and MAPK signaling. Moreover, sesamin can also directly neutralize
the neurotoxic effect of activated BV2 microglial cells which results in
avoidance of neuronal PC12 cell death. Results of the present study
suggest that sesamin may be effective in the prevention of neurodegenerative diseases.
The cytotoxicity of LPS and sesamin on BV2 cells was investigated
using MTT assay. BV2 cells (1 × 104 cells/well) were plated in 96-well
culture plates and treated with various concentrations of either LPS or
SE. Following incubation for 24 or 48 h, the culture media was replaced
with 100 µL of culture media containing 0.5 mg/mL MTT (SigmaAldrich, St. Louis, MO, USA) in final concentration. After 4 h incubation, 100 µL DMSO was added to solubilize the formazan crystals resulting from mitochondrial dehydrogenases action. Optical density was
measured at 540 nm using a micro-plate reader spectrophotometer. Cell
viability was calculated as: % cell survival = (OD of sample/OD of
control) × 100.
2.3. Real-time PCR (RT PCR)
Total cellular RNA was isolated using an illustra RNA spin Mini kit
(GE Healthcare Europe GmbH, Freiburg, Germany) and 500 ng total
RNA was reverse transcribed to cDNA by iScript™ cDNA Synthesis Kit
(Bio-Rad, Hercules, CA, USA) following the manufacturer’s instructions.
Polymerase chain reactions were performed on an Applied Biosystems
7500/7500 Fast Real-Time PCR system using SensiFAST™ SYBR® LoROX (Bio-Rad, Hercules, CA, USA). Interleukin-1 beta (IL1B), interleulin-6 (IL6), tumor necrosis factor alpha (TNFA), inducible nitric
oxide synthase (iNOS), and cyclooxygenase-2 (COX2) genes were
measured to determine BV2 microglial activation. The relative expression level of each gene was normalized with ACTB gene by using the
2(−ΔΔC(T)) method (Schmittgen & Livak, 2008). The primers sequences are shown in Table 1.
2. Materials and methods
2.1. Cell culture and conditioned medium preparation
The BV2 microglial cell line was obtained from ICLC (Genova,
Italy). Cells were grown in Dulbecco’s modified Eagle’s medium
(DMEM) (Gibco, Grand Island, NY, USA) containing 100 units/mL penicillin and 100 µg/mL streptomycin (Gibco, Grand Island, NY, USA)
supplemented with 10% (v/v) fetal bovine serum (FBS) (Gibco, Grand
Island, NY, USA) and maintained in a humidified atmosphere incubator
with 5% CO2 at 37 °C.
Rat pheochromocytoma (PC12) cells were purchased from CLS,
Germany. Cells were cultured in 10% (v/v) horse serum (HS) (Gibco,
Grand Island, NY, USA), 5% FBS in DMEM. PC12 cell differentiation
was induced by 40 ng/mL nerve growth factor (NGF, R&D Systems,
Minneapolis, MN) for neuron-like cells in DMEM containing 1% HS and
0.5% FBS. Neural growth was induced for 3–6 days. Under NGF stimulation, PC12 cells exhibiting neurite extension longer than 1–1.5 fold
of the cell body were defined as differentiated cells (Morooka &
Nishida, 1998). Cell percentage with neuritis relative to total number of
cells was calculated. At 70–80% cell differentiation, the PC12 culture
medium was replaced with a conditioned medium of BV2 cells.
Conditioned medium preparation, BV2 cells (1 × 106 cells per well)
were seeded in 6-well plates coated with 0.1 mg/mL poly-L-lysine
(Sigma-Aldrich, St. Louis, MO, USA). After starvation, cells were pretreated with sesamin at 12.5, 25, and 50 µM for 4 h followed by 1 μg/
mL LPS to induce microglial activation. Sesamin was prepared as previously described (Phitak et al., 2012). In this study, 50 µM indomethacin was selected as positive control for inhibiting microglial
activation. Earlier studies have reported that indomethacin has shown a
high ability to inhibit PGE2 synthesis in LPS induced rat microglial cells
(Ajmone-Cat, Bernardo, Greco, & Minghetti, 2010). Furthermore, indomethacin treatment reduced microglia activation and increased the
number of neuroblast cells in an ischemia rat model (Lopes et al.,
2016). After 48 h, the culture media was collected and centrifuged at
150g to remove cell debris. The supernatant (conditioned medium or
CM) was used for neurotoxic factor detection and PC12 cell death stimulation. Although, BV2 cells are a mouse-derived cell line while PC12
cells are rat-derived; nevertheless, this model has been widely used to
investigate the relationship between microglia and neuron cells (Dai
et al., 2015).
The abbreviations represented to conditional medium in each
treatment condition were described. (LPS_CM; conditioned medium
from LPS-treated BV2 cells alone), (SE+LPS_CM; conditioned medium
from SE pretreated BV2 cells induced with 1 μg/mL LPS), (Indo
+LPS_CM; conditioned medium from Indomethacin pretreated BV2
cells induced with 1 μg/mL LPS) and (SE_CM; and conditioned medium
from SE treated BV2 cells alone).
2.4. Inflammatory mediator production
The inhibitory effects of sesamin on pro-inflammatory cytokines and
other mediator production by the activated microglia was measured.
The levels of IL-1β, IL-6, TNF-α and PGE2 in CM were determined using
an enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems,
Minneapolis, MN, USA). The ELISA assays were carried out according to
the manufacturer’s instructions and the concentrations of IL-1β, IL-6,
TNF-α and PGE2 were calculated according to the standard curve using
the recombinant cytokines provided with the ELISA kits. The results are
expressed as pictograms per milliliter (pg/mL).
2.5. Nitric oxide assay
NO production was measured by the Griess reaction. 50 µL of each
CM was reacted with an equal volume of Griess reagent (Sigma-Aldrich,
Table 1
Primers used for determination of gene expression using RT PCR.
Genes
Sequence (5′-3′):
Forward (F); Reverse (R)
Accession number
TNFA
F: CTCCAGCTGGAAGACTCCTCCCAG
R: CCCGACTACGTGCTCCTCACC
F: GACCTGCTTCTTTGAGGCTGAC
R: TTCATCTCGAAGCCTGCAGTG
F: AAAGAGTTGTGCAATGGCAATTCT
R: AAGTGCATCATCGTTGTTCATACA
F: CGTGAAGAAAACCCCTTGTG
R: CAAAATCTCTCCACTGCCCC
F: ACACTCTATCACTGGCATCC
R: GAAGGGACACCCTTTCACAT
F: GTAAAGACCTCTATGCCAACA
R: GGACTCATCGTACTCCTGCT
NM_012675.3 21
IL1B
IL6
iNOS
COX2
ACTB
NM_031512.2
NM_012589.2
NM_010927.4
NM_017232.3
NM_031144.3
Abbreviations: TNFA; tumor necrosis factor-alpha, IL1B; interleukin-1 beta, IL6;
interleukin-6, iNOS; inducible nitric oxide synthase, COX2; cyclooxygenase-2
and ACTB; Beta-actin.
33
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
conjugate and PI, gently mixed, and incubated for 15 min in the dark at
room temperature. After incubation the cells were immediately analyzed using flow cytometry (FACSCAtia™ III Cell Sorter; BD Biosciences,
Franklin Lakes, NJ, USA). The annexin-V positive and PI negative
(normal permeability) cells were considered to be early apoptotic,
whereas cells that were PI positive (increased permeability) were considered to be either late apoptotic or necrotic.
St. Louis, MO, USA) in 96-well plates which were shaken for 10 min.
The absorbance at 540 nm was determined using a microplate reader.
NO concentrations were calculated by plotting a standard curve using
NaNO2 standard solution.
2.6. Immunofluorescence staining
TLR4 expression was determined by immunofluorescence staining.
The BV2 cells were seeded at 1 × 105 cells/slide on poly-L-lysine
coated-10 mm ∅ glass slides (Menzel™ Microscope Coverslips). The
cells were pre-treated either with or without sesamin for 4 h and exposed to LPS for 24 h as described above. At the end of treatment, cells
were rinsed briefly with PBS-T (1× PBS 0.1% Tween 20) and fixed in
4% paraformaldehyde for 10 min at room temperature. The cells were
then permeabilized with PBS containing 0.1% Triton X-100, washed,
and incubated with 1% BSA, 22.52 mg/mL glycine in PBS-T for 30 min
to block non-specific binding. The cells were next incubated overnight
at 4 °C with primary anti-TLR4 (Invitrogen, Carlsbad, CA, USA) at 1:500
dilution. Afterward, cells were washed and incubated with goat antimouse IgG (Alexa Fluor® 488) (Cambridge, United Kingdom) secondary
antibody for 1 h at room temperature in the dark. Finally, mounting and
counterstaining with DAPI were performed. The TLR-4 positive cells
were visualized and photographed using a confocal fluorescence microscope (Zeiss Axio Scope A1, Gottingen, Germany). Quantitative
analysis of fluorescence intensity was measured using ImageJ software.
2.10. Statistical analysis
All tests were repeated in three independent experiments. Data are
expressed as the mean ± SD of the three experiments. Statistical analysis was performed using SPSS software including one-way ANOVA
and the Tukey HSD post hoc test. P values at were < 0.05 or < 0.01
considered statistically significant.
3. Results
3.1. Cytotoxic effects of sesamin and LPS on BV2 microglia
To determine the cytotoxic effect of sesamin on BV2 cells, cell
viability was measured using MTT assay. The results showed that BV2
cell viability was not affected when the cells were stimulated with
0.8–50 μM sesamin after either 24 or 48 h (Fig. 1A), so concentrations
of sesamin at 12.5, 25 and 50 µM were utilized in further experiments.
LPS is a potent activator of inflammatory response in microglial
cells, so it is crucial to ascertain the non-toxic concentration of LPS in
BV2 cells. Treatment with LPS at 0.1–8 µg/mL for 24 h did not affect
cell viability (Fig. 1B), whereas high concentrations of LPS (100 µg/mL)
significantly decreased cell viability to 6.16%. However, 48 h of incubation with exposure to 4 µg/mL of LPS significantly reduced cell
viability.
2.7. Western blotting assay
A total of 1 × 105 cells/well of BV2 were seeded in a 6 well-plate
and treated in each condition. After treatment, cells were harvested by
scraping with 200 µL RIPA buffer containing both protease and phosphatase inhibitors. The harvested cell lysates were vortexed and debris
was discarded after centrifugation at 15,000g for 10 min at 4 °C.
Supernatants were collected and protein concentration was determined
using the Bradford protein assay. Ten µg of protein from each group was
separated with 12% SDS-PAGE and electrophoretically transferred to
nitrocellulose membranes (GE Healthcare Europe GmbH, Freiburg,
Germany). Each of the proteins was probed with specific antibodies
against signaling molecules in both phosphorylated and total form including IKKα/β, IκBα, p65, p38, ERK and JNK (Cell Signaling
Technology, Massachusetts, USA.) and TLR4 (Invitrogen, Carlsbad, CA).
The level of β-actin was measured as an internal control (Cell Signaling
Technology, Massachusetts, USA.). The immuno-positive bands were
visualized using a SuperSignal West Femto Maximum Sensitivity
Substrate kit (Thermo Fisher, Life technologies) and the band intensities
were calculated using TotalLab TL120 software.
3.2. Optimal model of activated BV2 microglia induced PC12 neuronal cell
death by using LPS stimulation
Optimal concentration of LPS which caused the microglial conditioned medium (CM) to induce neuronal cell death was determined to
develop a microglia-neuron model. We initially verified the effect of
LPS on microglial activation using NO detection and found that LPS
significantly induced NO production in a dose and time-dependent
manner with level of NO at 48 h higher than at 24 h (Fig. 1C). LPS_CM
of BV2 activation from various LPS concentrations were transferred to
PC12 to investigate neurotoxic factors inducing PC12 cell death. Conditioned medium at 1 and 2 µg/mL of LPS-induced BV2 cells at 48 h
significantly reduced PC12 cell viability by more than 50%, while
conditioned medium at 24 h incubation slightly affected PC12 cell
death (Fig. 1D). Accordingly, LPS at 1 µg/mL was used to induce microglial activation and incubation time at 48 h was performed for
conditioned medium preparation in our BV2 microglia- PC12 neuronal
model.
2.8. Alamar blue
To detect metabolically active PC12 cells, Alamar blue assay was
used. The culture medium was aspirated and 100 µL of sterile 10% v/v
Alamar blue (Sigma-Aldrich, St. Louis, MO, USA) was added to all wells
and incubated at 37 °C and 5% CO2 for 4 h. Fluorescence intensity was
measured using a Synergy™ H4 Hybrid Multi-Mode Microplate Reader
at an excitation wavelength of 530 nm and an emission wavelength of
590 nm. The fluorescence intensity correlation with cellular metabolic
activity was quantified to be percentage cell viability.
3.3. Effects of sesamin on LPS-induced inflammatory cytokine production
and mRNA expression
Pro-inflammatory cytokines are the major downstream product of
LPS/TLR4 pathway activation. To ascertain if LPS induced inflammatory cytokine production in BV2 microglial cells, BV2 cells were
stimulated with LPS for 24 and 48 h to determine the transcriptional
and translational levels of inflammatory cytokines, respectively. The
results showed that LPS-stimulated BV2 microglial cells markedly amplified mRNA levels of IL-1β, IL-6, and TNF-α and also strongly increased pro-inflammatory cytokine production in the conditioned
media, while pre-treatment with sesamin at 12.5, 25, and 50 µM and
with indomethacin at 50 µM for 4 h before exposure to LPS significantly
reduced IL-1β and IL-6 mRNA gene expression but affected TNF-α only
2.9. Flow cytometric analysis
The direct and indirect effects of sesamin on activated microgliainduced PC12 cell death was analyzed by staining with annexin V-FITC
and propidium iodide (PI). After treatment, PC12 cells were collected
and resuspended in binding buffer provided in an Annexin-V-FLUOS
Staining Kit (Roche, Basel, Switzerland) as described in the manufacturer’s instructions. Then the cells were stained with annexin-V
34
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
Fig. 1. Effect of sesamin (SE) and lipopolysaccharide (LPS) on BV2 microglial cells. To study cell viability, BV2 cells were treated with various concentrations of SE
(A) or exposed to different concentrations of LPS for 24 or 48 h (B). To investigate the effect of LPS on BV2 microglial activation, 1 × 105 cells/well of BV2 were
seeded in a 6-well plate and stimulated with LPS at concentrations of 0, 0.125, 0.25, 0.5, 1 and 2 µg/mL. Nitric oxide production was measured at 24 and 48 h (C). To
optimize the BV2 microglial and PC12 neuron-like cells model, BV2 cells were stimulated with various LPS concentrations at 24 or 48 h. The PC12 medium was then
replaced with LPS_CM from each condition and PC12 cell viability was determined after 24 h incubation. Results were displayed as percentage of control with data
represented as mean ± S.D. of three independent experiments (** p < 0.01 compared with untreated control).
slightly (Fig. 2A). Interestingly, the protein levels of all three pro-inflammatory cytokines (IL-1β, IL-6 TNF-α) in the conditioned media
were significantly reduced in the sesamin and indomethacin pre-treatments in a dose-dependent manner (Fig. 2B).
gene and NO production in the LPS-stimulated BV2 cells in a dose-dependent manner (Fig. 3B)
3.4. Effects of sesamin on the production of neurotoxic factors
Toll-like receptor 4 (TLR4) acts as the major LPS receptor and is
important in the microglial activation. The high expression of TLR4 on
microglial surface is found during neuroinflammatory process such as
hypoxia, injury and infection. Prior results have established that the
production of inflammatory factors was apparently relieved in LPS induced microglial activation when pre-treated with sesamin. To investigate whether the anti-inflammatory activity of sesamin is associated with the modulation of TLR4 receptor, we examined the effect of
sesamin on TLR4 expression in LPS-induced BV2 cells. The results
showed that LPS stimulation appeared to increase TLR4 protein expression in a dose and time-dependent manner (Fig. 4A, B). Interestingly, pre-treatment with 50 µM sesamin significantly decreased LPSinduced TLR4 expression (Fig. 4C). The inhibitory effect of sesamin was
also observed in immunofluorescence staining, a result which is consistent with the Western blot data. We found that sesamin attenuated
LPS-induced TLR4 expression in a dose-dependent manner (Fig. 4D).
Taken together, these findings strongly suggest that sesamin affected
TLR4 expression on microglial cells under LPS induced inflammatory
3.5. Effect of sesamin on TLR4 expression
Prostaglandin E2 (PGE2), an important pro-inflammatory mediator
produced by the cyclooxygenase-2 (COX-2) enzyme, is upregulated
during pathophysiological conditions in response to inflammatory stimuli. To investigate the effect of sesamin on PGE2 production in microglial-stimulated conditions, RT-PCR was performed to detect COX-2
mRNA gene expression. An ELISA was carried out to measure the
amount of PGE2 released in the conditioned media. BV2 cells exposed to
LPS appeared to cause an increase in the mRNA levels of COX-2, and
thereby PGE2 production, in culture medium. However, the levels of
COX-2 gene expression and PGE2 production were significantly suppressed in cells pretreated with indomethacin as well as those pretreated with 25 and 50 µM of sesamin (Fig. 3A).
Microglial activation also causes an increase in free radicals, resulting in oxidative stress. Nitric oxide (NO) is a well-known free radical
molecule which is generated by inducible nitric oxide synthase (iNOS).
In this study, sesamin significantly reduced the expression of the iNOS
35
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
Fig. 2. The suppressive effect of SE on cytokine production in LPS-stimulated BV2 cells. Cells were pre-treated with 12.5–50 μM sesamin and 50 μM indomethacin
(Indo) for 4 h, then exposed to 1 µg/mL LPS for 24 h. mRNA levels of pro-inflammatory cytokines (IL1-β, IL-6, and TNF-α) were determined by Real-time PCR.
Relative mRNA expression was normalized using ACTB expression (A). For cytokine measurement, culture media was collected after 48 h incubation of LPS, then the
levels of IL1-β, IL-6 and TNF-α were determined using ELISA (B). Data represent the means ± SD of three independent experiments. # p < 0.05 compared with the
control group; * p < 0.05 and ** p < 0.01 compared with the LPS-treated group.
JNK and slightly decreased the phosphoryated-p38 level. However,
reduction of phosphorylated ERK was not observed after pre-treatment
with sesamin (Fig. 5B), suggesting that sesamin inhibits the LPS-induced inflammatory response through NF-κB, JNK, and p38 independently of ERK molecule
process.
3.6. Effect of sesamin on NF-κB and MAPK signaling pathways in LPSStimulated BV2 cells
Previous studies have demonstrated the inhibitory capability of
sesamin on both TLR4 and pro-inflammatory factors expression. The
NF-κB and MAPK signaling pathways have been identified as the major
mediator downstream signaling molecule of the TLR4 signaling
pathway and associated on TLR4 expression regulation. To characterize
the mechanism underlying the pro-inflammatory reaction, the efficacy
of sesamin to arrest NF-κB and MAPK signaling was examined. Western
blot analysis showed that the phosphorylated NF-κB subunit, including
p-IKKα/β, p-IκBα and p-p65, was markedly enhanced up to ∼2- to 5fold over the basal level after exposure to LPS 1 µg/mL for 15 min.
However, LPS-induced IκBα degradation was significantly suppressed
by pre-treatment with sesamin at concentrations of 25 and 50 µM for
4 h, resulting in the observed reduction of the p-p65 subunit (Fig. 5A).
While LPS induced the phosphorylation of JNK, p38, and ERK, pretreatment with sesamin significantly reduced the phosphorylation of
3.7. Effect of sesamin on microglial activation induced PC12 cell death
To investigate the effects of inflammatory mediators produced by
LPS-stimulated microglia on neuronal cell death. PC12 cell viability
with direct LPS exposure and with LPS-treated BV2 cell conditioned
medium (CM) was compared. Initially, we induced BV2 cells with LPS
in various concentrations (0.125, 0.25, 0.5, 1, and 2 µg/mL). The culture medium from each group was defined as the LPS_CM. As showed in
Fig. 6A, PC12 cell viability in LPS_CM-treated cells gradually decreased
in a dose-dependent manner and was significantly more greatly exacerbated at doses of 0.5, 1, and 2 µg/mL of LPS_CM when compared
with direct LPS treatment. This result demonstrates that LPS-activated
microglia-produced inflammatory factors strongly affect neurotoxicity,
although LPS alone has no apparent effect. These findings suggest that
36
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
Fig. 3. The inhibitory effect of sesamin on COX-2 and iNOS expression, PGE2 and NO production in LPS-stimulated BV2 cells. Cells were pre-treated with sesamin
(12.5, 25, 50 μM) and indomethacin (50 μM) for 4 h and then activated with LPS (1 μg/mL). 24 h after incubation with LPS, Real-time PCR was performed to assess
the effect of sesamin on COX-2 and iNOS mRNA levels (A, C). At 48 h, the amounts of PGE2 and NO in the culture supernatant were determined by ELISA kit and
Griess’s reagent assay, respectively (B, D). Data represent the means ± SD of three independent experiments. # p < 0.05 compared with the control group;
*
p < 0.05 and ** p < 0.01 compared with the LPS-treated group.
treatment with sesamin protected PC12 cells from the effect of LPS_CM
in a dose-dependent manner (Fig. 7B, C). We confirmed the direct
protective effect of sesamin against neuronal cell death in mediated LPS
conditioned media using flow cytometry analysis. Annexin V/PI
staining showed that incubation of the cells with LPS_CM induced PC12
cell death as indicated by early apoptotic, late apoptotic, and necrotic
cells, while co-treatment with sesamin reversed this effect. The results
show that a concentration of sesamin of 20 µM significantly attenuates
LPS_CM-induced PC12 cell death. The proportion of cell death as
measured by early apoptosis, late apoptosis, and necrosis decreased
from 23.7%, 12.7% and 14.6% to 11.5%, 7.0% and 2.5%, respectively
(Fig. 7D).
attenuation of microglial activation may be crucial to the reduction of
neuronal cell death.
Our initial results demonstrated the potential of sesamin in reduction of inflammatory mediator production by activated microglia
(Figs. 2 and 3). That finding suggests that it is highly probable that
sesamin can reduce microglial-mediated neurotoxicity. In fact, we observed the effect of sesamin on LPS-mediated microglial activation-induced PC12 cell death (Fig. 6B). Additionally, pre-treatment of LPSstimulated BV2 microglial cells (SE+LPS_CM) with 25 and 50 µM sesamin markedly reduced PC12 cell death by ∼40% when compared
with LPS_CM alone while the sesamin (alone) conditioned medium
(SE_CM) did not affected on PC12 (Fig. 6C), a result is comparable to
the effect of pretreatment with indomethacin.
A quantitative evaluation of cell death was conducted using flow
cytometry in PC12 cells. Data is presented as percentage of cell death,
including early apoptosis, late apoptosis, and necrosis. The untreated
and control sesamin-treated cells showed cell viability of about 96%
and 91%, respectively, while cells exposed to LPS_CM had a cell viability of about 63%. PC12 cells exposed to BV2 conditioned media
obtained from pre-treatment with 25 and 50 µM sesamin showed a
significant decrease in cell death (Fig. 6D) which is consistent with data
on cytokine and neurotoxic factor production in BV2 cells. These data
demonstrate that sesamin mitigates neuronal cell death through inhibition of microglial activation.
4. Discussion
Sesamin is a major component of sesame lignans with a number of
beneficial health effects. Our previous studies demonstrated about effect of sesamin on chondroprotective effect (Khansai, Boonmaleerat,
Pothacharoen, Phitak, & Kongtawelert, 2016; Kiso, 2004; Miyawaki
et al., 2009; Phitak et al., 2012), regulating of bone remodeling
(Wanachewin et al., 2015; Wanachewin, Pothacharoen, Kongtawelert,
& Phitak, 2017) and cytokine production (Fanhchaksai, Kodchakorn,
Pothacharoen, & Kongtawelert, 2016). Recently, sesamin has been
studied extensively about its neuroprotective effects. However, this is
the first report demonstrating that sesamin inhibited microglial activation via TLR4 modulation lead to decrease of neuron PC12 cell death.
TLR4, a member of the toll-like receptor (TLR) family, is a general
type of pattern recognition receptor which is most abundantly expressed on the innate immune cell types such as macrophages, leukocytes and microglia. TLR4 has an important role in pathogen recognition and innate immune activation. Several research indicate the
involvement of TLR4 in pathogenesis of inflammation-related diseases
including
cancer,
influenza,
diabetes,
atherosclerosis
and
3.8. Direct effect of sesamin on neuronal cell death induced by inflamed
microglia
The direct protective effect of sesamin against LPS-activated BV2conditioned medium against PC12 cell death was studied using a sesamin and LPS_CM co-treatment system (Fig. 7A). We found that conditioned medium from LPS-stimulated BV2 microglia markedly decreased PC12 cell viability in a dose-dependent manner. Surprisingly,
37
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
Fig. 4. Effect of sesamin on TLR4 protein expression in LPS-stimulated microglial BV2 cells. To investigate the effect of LPS induced TLR4 expression, BV2 cells were
treated with LPS on various concentrations (0.1, 0.5 and 1 µg/mL) at 24 h (A) and various times at 6, 12 or 24 h. under 1 µg/mL LPS stimulation (B). Cell lysates were
prepared and subjected to Western blot analysis for TLR4 expression. Β-action was used as an internal control. Band intensities were quantified using TotalLab TL120
software. To determine the effect of sesamin on LPS-induced TLR4 expression, cells were pretreated with sesamin and then stimulated with LPS for 24 h. TLR4 protein
expression was determined by Western blot analysis (C) and immunocytochemistry (D). Data represent the means ± SD of three independent experiments.
#
p < 0.05 compared with the control group; * p < 0.05 compared with the LPS-treated group.
not (Lehnardt et al., 2003). Our results are consistent with these studies.
We found that the conditioned medium from LPS-treated BV2 strongly
induced PC12 cell death in LPS in a dose-dependent manner, while
direct LPS stimulation had no ability to induce neuronal cell death.
These findings substantiate that LPS/TLR4 activation in microglia is
associated with neurodegeneration. However, previous studies have
shown that the TLR4 receptor-interfering peptides reduce cytokine
production and suppress the induction of symptoms of sickness resulting from LPS-induced microglial activation in an in vivo model
(Dustin et al., 2013). Moreover, the deficiency of TLR4 decreases microglial activation, increase neuronal survival rate and improve cognitive functions in mouse model of Alzheimer's disease. Accordingly,
the targeting of TLR4 pathway might be the novel therapeutic strategy
for neuroinflammation. Interestingly, Qiang et al. reported that sesamin
suppressed inflammatory cytokine production in LPS-induced acute
lung injury (ALI) by inhibition of TLR4 expression (Qiang et al., 2015).
Nevertheless, the effect of sesamin on TLR4 expression in microglial cell
has not yet been studied. This study, we firstly proved the potential of
sesamin to reduce TLR4 expression in LPS-stimulated BV2 cells. That
inhibitory effect of sesamin may result from the inhibition of the NF-κB
and JNK signaling pathways, because its expression is regulated
through transcriptional activation of the NF-kB and MAPK signal
transduction pathways (Yan, 2006).
The NF-kB pathway is an important regulator of genes involved in
neurodegenerative diseases (Gaikwad, Naveen, & Agrawal-Rajput,
2016).
Microglia is the crucial cell type in resting CNS that express TLR4mediated innate immune activation and pathogen clearance. It is
widely known that TLR4 recognizes bacterial lipopolysaccharide (LPS).
However, the stimulation by the endogenous molecules like β-amyloid
and β-synuclein are effective as well. Many researches indicate that the
TLR4 mediated-microglial activation by these molecules implicated in
neuroinflammation in the central nervous system (CNS) (Dustin, Hyun,
Rochelle, Anthony, & Brian, 2013). The production of neurotoxic factors from immune activation are capable of inducing neuronal loss in
specific areas of the CNS resulting in neurodegenerative disorders including amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's
disease, and Huntington's disease. TLR4 upregulation is also reported in
neurodegenerative disease patient (Okun et al., 2010).
Several types of evidence support the role of TLR4 on neurodegeneration. In the rat brain, microglia are activated by a single intranigral injection of LPS, and the loss of dopaminergic neurons can be
observed (Arai et al., 2004). Other studies have demonstrated that
microinjection of LPS into the substantia nigra or hippocampus induced
microglial activation followed by a gradual loss of neurons at the site of
the injection (Castano, Herrera, Cano, & Machado, 1998). Concurrently,
an in vitro study showed that LPS/TLR4 activation in wild-type microglia induces neuronal cell death but that TLR4 mutant microglia do
38
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
Fig. 5. Inhibitory effects of sesamin on the phosphorylation of the NF-κB subunit. BV2 cells were pre-incubated with sesamin or BAY 11-7082, an inhibitor of IKK and
phosphorylation of IκBα, for 4 h prior to LPS stimulation at 1 μg/mL for 15 min. The expression levels of p-IKKα/β, p-IκBα, and p-p65 were measured by Western blot
analysis. Band density was quantified by TotalLab TL120. Total forms of IKKα/β, IκBα, and p65 were used as internal controls (A). The phospho-JNKs, phospho-p38
and phospho-EKR, major subunits of MAPK in BV2 cells, were investigated by Western blot analysis. BV2 cells were pre-treated with either sesamin or 10 μM of
MAPKs inhibitor (SP600125; p-JNK inhibitor SB203580; p-p38 inhibitor and U1026; p-ERK inhibitor) for 4 h and then exposed to 1 μg/mL LPS for 15 min. Band
density was quantified by TotalLab TL120. Total JNK, p38, and ERK were used as internal controls (B). Data represent the means ± SD of three independent
experiments. # p < 0.05 compared with the control group; * p < 0.05 and ** p < 0.01 compared with the LPS-treated group.
39
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
Fig. 6. The effect of sesamin on microglial activation induced PC12 cell death. To investigate the effect of inflammatory mediators which are produced by microglial
activation on PC12 neuronal cells, the production of inflammatory factors in BV2 microglial cells was induced by various concentration of LPS (0, 0.125, 0.25, 0.5, 1,
and 2 μg/mL) for 48 h. Conditioned medium (LPS_CM) was collected and transferred to PC12 neuron cells. Alamar blue assay was performed for PC12 cell viability.
The toxicity of LPS_CM-induced neuron cell death was compared with LPS directly treated PC12 cells at 24 h. Data is shown as the percentage of control (A).
Experimental design for study the effect of sesamin on microglial activation induced PC12 cell death (B). BV2 cells were pretreated with sesamin (0, 12.5, 25, and
50 μM) for 4 h and then exposed to 1 μg/mL LPS. After 48 h, conditioned media was collected and used to treat PC12 cells for 24 h. Cell viability was measured using
Alamar blue assay. The bar graph indicates the percentage of cell survival compared with control (C). Differentiated PC12 cells were exposed to conditioned media of
each groups for 5 h. After that, early apoptosis (AV+/PI−), late apoptosis (AV+/PI+), and necrosis (AV−/PI+) were determined by flow cytometry. The percentage of each group is summarized in the bar graph (D). Data represent the means ± SD of three independent experiments. # p < 0.05 compared with the control
group; * p < 0.05 and ** p < 0.01 compared with the LPS-treated group.
family: c-Jun N-terminal kinase (JNK), extracellular signal-regulated
kinase (ERK), and p38 MAPKs (Seon, Carolyn, & Linda, 2004). While
activation of ERK1/2 is involved in cell proliferation and survival,
several studies have shown that LPS induced neuroinflammation is
associated with JNK and p38 MAPKs (Gaikwad, Patel, Naveen, &
Agrawal-Rajput, 2015; Wang, Tu, Huang, & Ho, 2012). Specific inhibitors of JNK and p38 significantly reduced neuron cell death from
TLR4 activation in microglia, while inhibition of ERK1/2 did not show
a neuroprotective effect (Kim & Choi, 2010). Our results indicate that
LPS causes rapid phosphorylation of NF-κB and MAPK pathway at
15 min, while sesamin significantly decreases LPS-induced phosphorylated IκB-α and p65 subunits. Moreover, it also powerfully suppresses
the inflammatory response. Activation of this pathway has been identified as the primary response to LPS-stimulated microglial activation
(Baeuerle & Henkel, 1994). The phosphorylation of the NF-κB subunit is
directly responsible for instigation of pro-inflammatory gene transcription. Previous studies have reported that expression of iNOS, COX2, and pro-inflammatory cytokines was suppressed by inhibition of NFκB transcriptional activity in microglial nuclei (Santa-Cecilia et al.,
2016). In vitro studies have demonstrated that selective inhibition of
NF-κB activation prevents dopaminergic neuron loss in mouse models
of Parkinson’s disease (Ghosh et al., 2007). In addition to the NF-κB
pathway, MAPKs is also known as the instigator of the cascades in LPSstimulated microglia. There are three primary members of the MAPK
40
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
Fig. 7. Direct effect of sesamin on PC12 neuronal cell death induced by inflamed microglia. Experimental design for study the effect of sesamin on conditioned
medium induced PC12 cell death (A). Conditioned medium was generated from LPS-induced BV2 cells (0.125, 0.25, 0.5, and 1 μg/mL). PC12 cells were exposed to
LPS_CM either in the presence or absence of sesamin at concentrations of 5, 10, and 20 μM for 24 h. Cell viability was determined by Alamar blue assay (B). The bar
graph represents cell viability of PC12 cells after treatment with culture media from activated BV2 cells either in the presence or absence of sesamin (C).
Differentiated PC12 cells were exposed to LPS_CM and either co-treated with sesamin at concentrations of 5, 10, or 20 μM for 5 h or left untreated. The proportion of
early apoptosis, late apoptosis, and necrosis were detected using flow cytometry (D). Data represent the means ± SD of three independent experiments. # p < 0.05
compared with the control group; * p < 0.05 and ** p < 0.01 compared with the LPS-treated group.
mitochondrial apoptotic pathway (Guadagno, Swan, Shaikh, & Cregan,
2015). PC12 cells pretreated with interleukin-1 receptor antagonist (IL1RA) significantly alleviate LPS-conditioned media induced PC12 cell
apoptosis (Dai et al., 2015). Simultaneously, soluble IL-6-receptor/IL-6
complex stimulates the synthesis of beta-amyloid precursor protein
(APP) which is the major cause of progression of Alzheimer’s disease
(Ringheim et al., 1998). The correlation between inflammation and
neurodegenerative diseases was confirmed when elevated levels of
TNF-α, IL-1β, IL-6, and PGE2 were detected in cerebrospinal fluid (CSF)
of neurodegenerative disorder patients (Farias et al., 2015). In this
study, we demonstrated the strong potential of sesamin to diminish proinflammatory cytokines including TNF-α, IL-1β, and IL-6, in both the
mRNA and protein levels in LPS stimulated microglial cells.
In addition, the effect of sesamin on PGE2 production in microglia
was clearly indicated by decrease in PGE2 level. Results indicated that
all sesamin concentrations were effective while levels of COX-2 mRNA
significantly decreased at 25 and 50 µM sesamin concentration.
However, regulation of PGE2 did not only depend on COX-2 expression.
JNK phosphorylation and but only slightly suppresses p38 MAPK. ERK
was found not to be involved in these processes, an indication that
inhibition of the NF-κB and JNK signaling pathways in microglia may
be the result of an anti-inflammatory effect of sesamin. While, the inhibition of microglial activation by indomethacin did not affected via
NF-κB and MAPK pathway, because indomethacin inhibits the activation of PPAR-γ (Ajmone-Cat et al., 2010).
An increasing number of studies have reported that the excessive
production of inflammatory factors particularly high levels of nitric
oxide (NO), and pro-inflammatory cytokines (e.g., IL-1β, IL-6, and TNFα) lead to neuron cell death through apoptotic and necrotic induction.
Importantly, previous studies have demonstrated that TNF-α produced
by lipopolysaccharide-activated microglia is necessary and sufficient to
trigger apoptosis in mouse neural precursor cells (NPCs) in vitro via the
regulation of the Bcl-2 family protein, Bax (Guadagno, Xu, Karajgikar,
Brown, & Cregan, 2013). Moreover, the microglia-derived IL-1β activated by LPS/interferon-γ has been shown to be essential in triggering
p-53-mediated cell cycle arrest and inducing NPC apoptosis through the
41
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
indirect microglial-mediated LPS neurotoxicity.
The pharmacokinetics of sesamin was investigated in healthy
human subjects administered at 50 mg of sesame lignans (sesamin/
episesamin at 1/1). Sesamin was detected in blood circulation at 5 h
after ingestion. However, metabolites as mainly SC-1 were found simultaneously in large amounts in blood. Sesamin has a half-life of 2.4 h
and completely eliminated from the body within 24 h following administration (Tomimori et al., 2013). There is no evidence in humans
concerning concentration of sesamin in the brain after administration;
however, research regarding absorption and distribution of sesamin in
rat models demonstrated that sesamin but not its metabolites was found
in the brain after administration (Tomimori et al., 2016; UmedaSawada et al., 1999). Although maximum concentrations in serum and
brain were very low, our results demonstrated an effective dose of sesamin at 12.5–50 µM. High dose consumption in a continuous period is
one alternative to increase sesamin bioavailability since no accumulation was observed in the body within 24 h and sesame lignans were
confirmed to be safe in healthy subjects. Moreover, several pharmacological technologies including structural modifications and nanotechnology have recently been developed to increase therapeutic potential by improving drug bioavailability (Khadka et al., 2014). These
applied technologies might increase bioavailability and blood-brainbarrier ability of sesamin which is important for drug effectiveness and
leads to successful therapy.
Thus, these results might implicate modulation of prostaglandin biosynthesis by NO associated with cross-talk between since the COX and
NOS pathways (Salvemini, Kim, & Mollace, 2013). This theory explicates the role of NO on COX activity regulation since the COX enzyme can be activated by modifying S-nitrosylate cysteine through interaction between NO and the free cysteine residue of COX. Salvemini
et al. demonstrated that endogenous or exogenous NO plays a critical
role in the production of PGE2 by direct activation of COX-2. The PGE2
level was markedly reduced in LPS-stimulated RAW264.7 cells using
inhibitors of NOS (Salvemini et al., 1993). Moreover, interaction between inducible NOS (iNOS) itself and COX-2 also participated in COX2 control as indicated by Kim, Huri, and Snyder (2005). Our results
showed that sesamin also diminished iNOS expression and NO production. Thus, the effective dose of sesamin was equivalent to a usual
dose of indomethacin, a COX-2 inhibitor, to decrease PGE2 production.
NO, a well-known free radical molecule of the reactive nitrogen
species, is generally accepted as having a key role in neurodegeneration
(Dawson & Dawson, 1998). High level of NO induces neuronal death by
either apoptotic or necrotic pathways (Bal-Price & Brown, 2000). NO
induce apoptosis by enhancing mitochondrial pore transition, leading
to cytochrome c release and induction of caspase activity or to triggering endoplasmic reticulum (ER) stress (Borutaite, Morkuniene, &
Brown, 2000). NO-induced necrosis can be motivated by damage to the
mitochondria which results in depletion of cell energy (Bal-Price &
Brown, 2000). Moreover, NO reacts with lipid membrane and induces
lipid peroxidation. The peroxynitrite, a highly reactive intermediate
form of a combination of NO– and superoxide can induce DNA strand
breaks (Beckman, 1996). While activation of iNOS and high levels of
NO induce neuronal cell death, lower concentrations of NO following
nNOS or eNOS activity induction present a neuroprotective effect
(Bonthius, Luong, Bonthius, Hostager, & Karacay, 2009). Previous reports have demonstrated that pre-treatment with S-methylisothiourea,
an iNOS inhibitor, leads to a significant reduction of LPS-induced DA
cell death in animal models (Ruano et al., 2006). In this study, we
demonstrated the powerful effect of sesamin on the reduction of iNOS,
mRNA, and NO release in LPS-stimulated BV2 cells in a dose-dependent
manner. Our findings indicate that sesamin reduced NO release through
downregulation of iNOS mRNA expression, results which are consistent
with previous studies.
To investigate whether the neuroprotective effect of sesamin on
neuronal cell death mediated by activated microglia in both direct and
indirect effect, BV2 microglia and PC12 neuron-like cells were used to
representative of microglial cell and neuron cells, respectively. Our
results indicate that neuronal cell death increased by ∼37.0% (11.7%
early apoptosis, 10.7% late apoptosis, and 14.6% necrosis) after being
treated with LPS-stimulated BV2 microglial medium. Interestingly, pretreatment of BV2 cells with sesamin effectively reduced PC12 cell
death. There is a high possibility that sesamin decreases PC12 cell death
through downregulation of pro-inflammatory mediators (TNF-α, IL-1β,
IL-6, NO and PGE2) in LPS-stimulated BV2 cells. These result showed
the effect of sesamin on the microglial cells. However, in the veritable
nervous system during neuroinflammation, while the neurotoxic factors
released from activated microglia induced neuronal cell death, it's
possible that sesamin might be affective on the nerve cells as well. In
this study indicated that the conditioned medium from LPS-induced
microglial activation strongly increased PC12 cell death. Moreover cotreatment between sesamin and LPS_CM on PC12, showed the direct
treatment of sesamin on PC12 cells protected the LPS-conditioned
medium, containing high level of neurotoxic factor induced cell death.
However, we are not confident about the mechanism. Nevertheless, we
assumed that this effect might be associated with oxidative stress alleviation because the previous study showed sesamin protect neuronal
PC12 cells from oxidative stress induced apoptosis through increment
of superoxide dismutase activity and decrease Bax/Bcl-2 ratio
(Bournival, Francoeur, et al., 2012). Together, these results provide
evidenced that sesamin can protect neuron cells from both direct and
5. Conclusion
In summary, the inhibition of microglial activation and reduction of
neuroinflammatory factor production have been recognized as an alternative method to ameliorate the severity of neurodegenerative diseases. The present study identified a mechanism of action of sesamin
which is associated with both the direct and indirect effects of the
microglial and neuron cell neuroinflammation system. We showed that
sesamin suppressed TLR4 expression and inhibited downstream signaling molecules, including the NF-κB and JNK pathway, resulting in
downregulation of neurotoxicity in LPS-stimulated BV2 microglial cells.
When PC12 cells were incubated with conditioned media collected from
LPS-stimulated BV2 microglia, pre-treatment of BV2 cells with sesamin
increased neuronal viability and reduced the level of cell death while
concurrently reducing the direct effect of neurotoxic factors that induce
neuronal cell death. Our observations suggest that sesamin might be an
alternative agent for the prevention and reduces the risk of neurodegenerative diseases.
Acknowledgements
This research was supported by The Royal Golden Jubilee Ph.D.
Program (Grant No. PHD/0185/2557), The Graduate School of Chiang
Mai University (to SU) and Thailand Excellence Center for Tissue
Engineering and Stem Cells (to PK).
References
Ajmone-Cat, M. A., Bernardo, A., Greco, A., & Minghetti, L. (2010). Non-steroidal antiinflammatory drugs and brain inflammation: Effects on microglial functions.
Pharmaceuticals, 3, 1949–1964.
Akira, S., & Takeuchi, O. (2010). Pattern recognition receptors and inflammation. Cell,
140, 805–820.
Arai, H., Furuya, T., Yasuda, T., Miura, M., Mizuno, Y., & Mochizuki, H. (2004).
Neurotoxic effects of lipopolysaccharide on nigral dopaminergic neurons are mediated by microglial activation, interleukin-1 beta, and expression of caspase-11 in
mice. Journal of Biological Chemistry, 279, 51647–51653.
Baeuerle, P. A., & Henkel, T. (1994). Function and activation of NF- kappa B in the immunesystem. Annual Review of Immunology, 12, 141–179.
Bal-Price, A., & Brown, G. C. (2000). Nitric oxide-induced necrosis and apoptosis in PC12
cells mediated by mitochondria. Journal of Neurochemistry, 75, 1455–1464.
Beckman, J. S. (1996). Oxidative damage and tyrosine nitration from peroxynitrite.
Chemical Research in Toxicology, 9, 836–844.
Bonthius, D. J., Luong, T., Bonthius, N. E., Hostager, B. S., & Karacay, B. (2009). Nitric
42
Journal of Functional Foods 49 (2018) 32–43
S. Udomruk et al.
Kiso, Y. (2004). Antioxidative roles of sesamin, a functional lignan in sesame seed, and it's
effect on lipidand alcohol-metabolism in the liver: A DNA microarray study.
BioFactors, 21, 191–196.
Lehnardt, S., Massillon, L., Follett, P., Jensen, F. E., Ratan, R., Rosenberg, P. A., ...
Vartanian, T. (2003). Activation of innate immunity in the CNS triggers neurodegeneration through a Toll-like receptor 4-dependent pathway. Proceedings of the
National Academy of Sciences of the United States of America, 100, 8514–8519.
Lopes, R. S., Cardoso, M. M., Sampaio, A. O., Barbosa, M. J., Souza, C. C., Da Silva, M. C.,
... Gomes-Leal, W. (2016). Indomethacin treatment reduces microglia activation and
increases numbers of neuroblasts in the subventricular zone and ischaemic striatum
after focal ischaemia. Journal of Biosciences, 41, 381–394.
Miyawaki, T., Aono, H., Toyoda-Ono, Y., Meada, H., Kiso, Y., & Moriyama, K. (2009).
Antihypertensive effects of sesamin in humans. Journal of Nutritional Science and
Vitaminology, 55, 87–91.
Morooka, T., & Nishida, E. (1998). Requirement of p38 mitogen-activated protein kinase
for neuronal differentiation in PC12 cells. Journal of Biological Chemistry, 273,
24285–24288.
Okun, E., Griffioen, K., Lathia, J., Tang, S., Mattson, M., & Arumugam, T. (2010). Toll-like
receptors in neurodegeneration. Brain Research Reviews, 59, 278–292.
Phitak, T., Pothacharoen, P., Settakorn, J., Poompimol, W., Caterson, B., & Kongtawelert,
P. (2012). Chondroprotective and anti-inflammatory effects of sesamin.
Phytochemistry, 80, 77–88.
Qiang, L., Yuan, J., Shouyin, J., Yulin, L., Libing, J., & Jian-an, W. (2015). Sesamin attenuates lipopolysaccharide-induced acute lung injury by inhibition of TLR4 signaling pathways. Inflammation. https://doi.org/10.1007/s10753-10015-1027010756.
Rahimifard, M., Maqbool, F., Moeini-Nodeh, S., Niaz, K., Abdollahi, M., Braidy, N., ...
Nabavi, S. (2017). Targeting the TLR4 signaling pathway by polyphenols: A novel
therapeutic strategy for neuroinflammation. Ageing Research Reviews, 36. https://doi.
org/10.1016/j.arr.2017.1002.1004.
Ringheim, G. E., Szczepanik, A. M., Petko, W., Burgher, K. L., Zhu, S. Z., & Chao, C. C.
(1998). Enhancement of beta-amyloid precursor protein transcription and expression
by the soluble interleukin-6 receptor/interleukin-6 complex. Molecular Brain
Research, 55, 35–44.
Ruano, D., Revilla, E., Gavilan, M. P., Vizuete, M. L., Pintado, C., Vitorica, J., & Castano,
A. (2006). Role of p38 and inducible nitric oxide synthase in the in vivo dopaminergic
cells' degeneration induced by inflammatory processes after lipopolysaccharide injection. Neuroscience, 140, 1157–1168.
Salvemini, D., Kim, S., & Mollace, V. (2013). Reciprocal regulation of the nitric oxide and
cyclooxygenase pathway in pathophysiology: Relevance and clinical implications.
American Journal of Physiology: Regulatory, Integrative and Comparative Physiology,
304, 473–487.
Salvemini, D., Misko, T., Masferrer, L., Seibert, K., Currie, M., & Needleman, P. (1993).
Nitric oxide activates cyclooxygenase enzymes. Proceedings of the National Academy of
Sciences of the United States of America, 90, 7240–7244.
Santa-Cecilia, F. V., Socias, B., Ouidja, M. O., Sepulveda-Diaz, J. E., Acuna, L., Silva, R. L.,
... Raisman-Vozari, R. (2016). Doxycycline suppresses microglial activation by inhibiting the p38 MAPK and NF-kB signaling pathways neurotox. Philosophy and
Phenomenological Research, 29, 447–459.
Schmittgen, T., & Livak, K. (2008). Analyzing real-time PCR data by the comparative C(T)
method. Nature Protocols, 3(6), 1101–1108.
Seon, H. K., Carolyn, J. S., & Linda, J. V. (2004). Importance of MAPK pathways for
microglial proinflammatory cytokine IL-1β production. Neurobiology of Aging, 25,
431–439.
Suzuki, H., & Okada, T. (2017). Toll-like receptor 4 as a possible therapeutic target for
delayed brain injuries after aneurysmal subarachnoid hemorrhage. Neural
Regeneration Research, 12, 193–196.
Tomimori, N., Rogi, T., & Shibata, H. (2016). Absorption, distribution, metabolism and
excretion of [14C]sesamin in rats. Molecular Nutrition & Food Research, 61(8), https://
doi.org/10.1002/mnfr.201600844.
Tomimori, N., Tanaka, Y., Kitagawa, Y., Fujii, W., Sakakibara, Y., & Shibata, H. (2013).
Pharmacokinetics and safety of the sesame lignans, sesamin and episesamin, in
healthy subjects. Biopharmaceutics & Drug Disposition, 34, 462–473.
Umeda-Sawada, R., Ogawa, M., & Igarashi, O. (1999). The metabolism and distribution of
sesame lignans (sesamin and episesamin) in rats. Lipids, 34, 633–637.
Wanachewin, O., Klangjorhora, J., Pothacharoen, P., Phitak, T., Laohapoonrungseed, A.,
Pruksakorn, D., & Kongtawelert, P. (2015). The promoting effects of sesamin on osteoblast differentiation of human mesenchymal stem cells. Journal of Functional
Foods, 14, 395–406.
Wanachewin, O., Pothacharoen, P., Kongtawelert, P., & Phitak, T. (2017). Inhibitory effects of sesamin on human osteoclastogenesis. Archives of Pharmacal Research, 40.
https://doi.org/10.1007/s12272-12017-10926-x.
Wang, L.-W., Tu, Y.-F., Huang, C.-C., & Ho, C.-J. (2012). JNK signaling is the shared
pathway linking neuroinflammation, blood–brain barrier disruption, and oligodendroglial apoptosis in the white matter injury of the immature brain. Journal of
Neuroinflammation, 9. https://doi.org/10.1186/1742-2094-1189-1175.
Yan, Z.-Q. (2006). Regulation of TLR4 expression is a tale about tail. Arteriosclerosis,
Thrombosis, and Vascular Biology, 26, 2582–2584.
oxide utilizes NFkappaB to signal its neuroprotective effect against alcohol toxicity.
Neuropharmacology, 56, 716–731.
Borutaite, V., Morkuniene, R., & Brown, G. C. (2000). Nitric oxide donors, nitrosothiols
and mitochondrial respiration inhibitors induce caspase activation by different mechanisms. FEBS Letters, 467, 155–159.
Bournival, J., Francoeur, M., Renaud, J., & Martinoli, M. (2012). Quercetin and sesamin
protect neuronal PC12 cells from high-glucose-induced oxidation, nitrosative stress,
and apoptosis. Rejuvenation Research, 15, 322–333.
Bournival, J., Plouffe, M., Renaud, J., Provencher, C., & Martinoli, M.-G. (2012).
Quercetin and sesamin protect dopaminergic cells from MPP+-induced neuroinflammation in a microglial (N9)-neuronal (PC12) coculture system. Oxidative
Medicine and Cellular Longevity, 1–11.
Buchanan, M. M., Hutchinson, M., Watkins, L. R., & Yin, H. (2010). Toll-like receptor 4 in
CNS pathologies. Journal of Neurochemistry, 114, 13027.
Castano, A., Herrera, A., Cano, J., & Machado, A. (1998). Lipopolysaccharide intranigral
injection induces inflammatory reaction and damage in nigrostriatal dopaminergic
system. Journal of Neurochemistry, 70, 1584–1592.
Chen, W.-W., Zhang, X., & Juan, W. (2016). Role of neuroinflammation in neurodegenerative diseases (Review). Molecular Medicine Reports, 13. https://doi.org/10.3892/
mmr.2016.4948.
Dai, X. J., Li, N., Yu, L., Chen, Z. Y., Hua, R., Qin, X., & Zhang, Y. M. (2015). Activation of
BV2 microglia by lipopolysaccharide triggers an inflammatory reaction in PC12 cell
apoptosis through a toll-like receptor 4-dependent pathway. Cell Stress and
Chaperones, 20, 321–331.
Dawson, V. L., & Dawson, T. M. (1998). Nitric oxide in neurodegeneration. Progress in
Brain Research, 118, 215–229.
Dustin, J. H., Hyun, B. C., Rochelle, M. H., Anthony, G. P., & Brian, A. M. (2013).
Prevention of LPS-induced microglia activation, cytokine production and sickness
behavior with TLR4 receptor interfering peptides. PLoS ONE. https://doi.org/10.
1317/journal.pone.0060388.
Fanhchaksai, K., Kodchakorn, K., Pothacharoen, P., & Kongtawelert, P. (2016). Effect of
sesamin against cytokine production from influenza type A H1N1-induced peripheral
blood mononuclear cells: Computational and experimental studies. In Vitro Cellular &
Developmental Biology-Animal, 52. https://doi.org/10.1007/s11626-11015-1995011627.
Farias, G. A., Arata, L., Guzman-Martinez, L., Morales, I., Tapia, J. P., & Maccioni, R. B.
(2015). Biochemical markers for Alzheimer’s and Parkinson’s disease. Austin Journal
of Clinical Neurology, 2 ISSN: 2381-9154.
Gaikwad, S., Naveen, C., & Agrawal-Rajput, R. (2016). Toll-like receptor-4 antagonism
mediates benefits during neuroinflammation. Neural Regeneration Research, 11,
552–553.
Gaikwad, S., Patel, D., Naveen, C. R., & Agrawal-Rajput, R. (2015). The critical role of
JNK and p38 MAPKs for TLR4 induced microglia-mediated neurotoxicity. Journal of
Experimental Biology, 5, 34–42.
Ghosh, A., Roy, A., Liu, X., Kordower, J. H., Mufson, E. J., Hartley, D. M., ... Pahan, K.
(2007). Selective inhibition of NF-κB activation prevents dopaminergic neuronal loss
in a mouse model of Parkinson's disease. Proceedings of the National Academy of
Sciences of the United States of America, 104, 18754–18759.
Guadagno, J., Swan, P., Shaikh, R., & Cregan, S. P. (2015). Microglia-derived IL-1β
triggers p53-mediated cell cycle arrest and apoptosis in neural precursor cells. Cell
Death and Disease, 6. https://doi.org/10.1038/cddis.2015.1151.
Guadagno, J., Xu, X., Karajgikar, M., Brown, A., & Cregan, S. P. (2013). Microglia-derived
TNFα induces apoptosis in neural precursor cells via transcriptional activation of the
Bcl-2 family member Puma. Cell Death and Disease, 4. https://doi.org/10.1038/cddis.
2013.1059.
Hsieh, P. F., Hou, C.-W., Yao, P.-W., Wu, S.-P., Peng, Y.-F., Shen, M.-L., ... Jeng, K.-C.
(2011). Sesamin ameliorates oxidative stress and mortality in kainic acidinduced
status epilepticus by inhibition of MAPK and COX-2 activation. Journal of
Neuroinflammation. https://doi.org/10.1186/1742-2094-1188-1157.
Kacimi, R., Giffard, R., & Yenari, M. (2011). Endotoxin-activated microglia injure brain
derived endothelial cells via NF-kappa B, JAK-STAT and JNK stress kinase pathways.
Journal of Inflammation, 8. https://doi.org/10.1186/1476-9255-1188-1187.
Kempuraj, D., Thangavel, R., Natteru, P., Selvakumar, G., Saeed, D., Zahoor, H., ...
Zaheer, A. (2017). Neuroinflammation Induces Neurodegeneration. Journal of
Neurology, Neurosurgery and Spine, 1, 1003.
Khadka, P., Ro, J., Kim, H., Kin, I., Kin, J. T., Kim, H., ... Lee, J. (2014). Pharmaceutical
particle technologies: An approach to improve drug solubility, dissolution and
bioavailability. Asian Journal of Pharmaceutical Sciences, 9, 304–316.
Khansai, M., Boonmaleerat, K., Pothacharoen, P., Phitak, T., & Kongtawelert, P. (2016).
Ex vivo model exhibits protective effects of sesamin against destruction of cartilage
induced with a combination of tumor necrosis factor-alpha and oncostatin M. BMC
Complementary and Alternative Medicine, 16. https://doi.org/10.1186/s12906- 1201611183-12900.
Kim, E. K., & Choi, E.-J. (2010). Pathological roles of MAPK signaling pathways in human
diseases. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 1802,
396–405.
Kim, S., Huri, D., & Snyder, S. (2005). Inducible nitric oxide synthase binds, S-nitrosylates, and activates cyclooxygenase-2. Science, 310, 1966–1970.
43
Документ
Категория
Без категории
Просмотров
1
Размер файла
2 647 Кб
Теги
020, 2018, jff
1/--страниц
Пожаловаться на содержимое документа