close

Вход

Забыли?

вход по аккаунту

?

Морфологический анализ сперматогенеза – основа диагностики мужского идиопатического бесплодия (иммуногистохимический аспект)

код для вставкиСкачать
На правах рукописи
ДЕМЯШКИН
ГРИГОРИЙ АЛЕКСАНДРОВИЧ
МОРФОЛОГИЧЕСКИЙ АНАЛИЗ СПЕРМАТОГЕНЕЗА –
ОСНОВА ДИАГНОСТИКИ МУЖСКОГО ИДИОПАТИЧЕСКОГО
БЕСПЛОДИЯ
(ИММУНОГИСТОХИМИЧЕСКИЙ АСПЕКТ)
14.03.02. – Патологическая анатомия
А В Т О Р Е Ф Е Р А Т
на соискание учёной степени кандидата медицинских наук
Москва -2018
Работа выполнена в ФГАОУ ВО Первый Московский Государственный медицинский
университет им. И.М. Сеченова Минздрава России (Сеченовский Университет)
Научный руководитель:
доктор медицинских наук, профессор
Коган Евгения Алтаровна
Официальные оппоненты:
Астраханцев Александр Фёдорович – доктор медицинских наук, профессор; главный
внештатный специалист Центральной дирекции здравоохранения – филиала ОАО
«Российские
«Центральная
железные
дороги»,
клиническая
Негосударственное
больница
№2
им.
учреждение
Н.А.Семашко
здравоохранения
ОАО
«РЖД»,
патологоанатомическое отделение, заведующий отделением;
Дерижанова Ирина Сергеевна – доктор медицинских наук, профессор, ФГБОУ ВО
«Ростовский государственный медицинский университет» Минздрава России, кафедра
патологической анатомии, заведующая кафедрой.
Ведущая
организация:
Научно-исследовательский
институт
урологии
и
интервенционной радиологии имени Н.А. Лопаткина – филиал ФГБУ «Национальный
медицинский исследовательский центр радиологии» Минздрава России.
Защита диссертации состоится «___» «__________» 2018 г. в _____ часов на заседании
диссертационного
совета
Д
208.040.01
при
ФГАОУ
ВО
Первый
Московский
государственный медицинский университет им. И.М.Сеченова Минздрава России
(Сеченовский Университет) по адресу: 119991 Москва, Трубецкая ул., д.8, стр. 2
С диссертацией можно ознакомиться в ЦНМБ
ФГАОУ ВО Первый Московский
государственный медицинский университет им. И.М. Сеченова Минздрава России
(Сеченовский Университет) по адресу: 119034, г. Москва, Зубовский бульвар, д.37/1 и на
сайте www.sechenov.ru
Автореферат диссертации разослан «____» «________________» 2018 г.
Ученый секретарь диссертационного совета
доктор медицинских наук,
профессор
Борис Борисович Салтыков
2
ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ
Актуальность темы исследования
С каждым годом прослеживается неуклонный рост частоты мужского бесплодия в
России и в других странах Мира. При этом обеспечивается низкая эффективность
установления причин идиопатических форм. Объяснением роста бесплодия служат:
прогрессивное ухудшение экологической обстановки, оказывающей существенное
влияние на репродуктивное здоровье населения, повторяющиеся экономические кризисы
и потрясения, негативно влияющие на психику человека, массовое употребление
некачественных продуктов и лекарств, содержащих малополезные и даже вредные
ингредиенты, неблагоприятная радиационная обстановка на Планете из-за аварий
на
Чернобыльской и Фукусимской атомных станциях, сомнительное качество морепродуктов
из-за нарушения экологии моря, ухудшение состояния атмосферы по причине вредных
выбросов и др. Перечисленные факторы негативно влияют на мужскую репродуктивную
систему.
О
состоянии
репродуктивного
здоровья
мужской
части
населения
свидетельствуют данные ряда исследований. Около 30% всех случаев мужского
бесплодия составляют
идиопатические формы, причины которых не выяснены и не
понятны (Брагина Е.Е. и др, 2002; ВОЗ, 2000). По мнению Кагана С.А. (1974), Райциной
С.С. (1985), А.И. Лысенко (2008), Астраханцева А.Ф. (2017), Курило Л.Ф. и др. (2000),
совокупность нейроэндокринных нарушений механизмов регуляции могут быть также
связаны с количественными или структурными аномалиями хромосом. Нет также
единогласия в отношении этиологии, патогенеза, диагностики и лечения мужского
бесплодия.
Как известно, в
физиологии половых желез (не только мужских, но и женских)
существует тесная связь между генеративной (гаметы) и эндокринной функциями – если
страдает одна из них, вторая, как правило, не бывает полноценной. Результаты ряда
исследований (Волкова О.В., 2009; Боровая Т.Г., 2014; Коган Е.А., 2016) значительно
расширили рамки понимания эндокринной активности половых желез: сегодня эта
функция представляется более многогранно и включает не только образование и
секрецию
половых
стероидных
гормонов,
но
и
выработку множества
других
биологически активных соединений, источниками которых в половых железах являются
клетки-эндокриноциты, сами половые клетки, клетки Сертоли и даже, возможно, клетки
стромы, не принадлежащие к категории эндокринных. Кроме того, мало изучена роль
метаболитов распадающихся половых и соматических клеток, которые возможно также
3
выступают как аутокринные и паракринные регуляторы (Ярыгин К.Н., Холоденко И.В.,
Скворцова В.И. и др., 2009).
Яички являются уникальным органом. В них заключено колоссальное количество
структур, занимающих при этом мизерный объем
– множество извитых семенных
канальцев (длина одного семенного канальца составляет 80 см, а общая – 300 – 400 м).
Несмотря на малые размеры органа, они несут огромную функциональную нагрузку,
вырабатывая сперматозоиды, количеством до 200 миллионов в 1 мл, размеры которых в
пределах 5 мкм (без жгутика). При этом, жизненно важные процессы в органе проходят
при относительно небольшом количестве соединительной ткани, тем самым ограничивая
его защитные функции. Яички располагаются на периферии организма, как бы
«автономно». Подобное «отдаленное» расположение яичек не способствует защите от
химических, биологических и физических (механических, температурных), в том числе
радиационных воздействий (Bostwick D.G., 2014; В.Н. Ярыгин, Г.Г. Кругликов, 1990).
Возможно, поэтому в них сформированы плотные волокнистые оболочки (tunica
albuginea)
и
многоструктурные
гематотестикулярные
барьеры.
Учитывая
вышеперечисленные органоспецифические особенности, остаётся весьма затруднительной
диагностика и прогноз, как воспалительных изменений, так и нарушений эндокринной
функции сперматогенеза (бесплодие).
Сперматогенез протекает под контролем специфических генов развивающихся гамет и
регулируется совокупностью гормонов, цитокинов, факторов роста, синтезируемых как в
органах самой половой системы, так и вне ее.
Несмотря на совершенствование методов диагностики с каждым годом в развитых
странах прослеживается неуклонный рост мужского бесплодия в виде азооспермии (доля
пациентов с секреторной формой преобладает над обструктивной). При азооспермии
диагностически наиболее точным является гистологический анализ биопсийного
материала яичка, выявляющий степень поражения половых клеток, а также возможный
риск малигнизации. Используемые на практике критерии оценки степени поражения
половых клеток были разработаны ещё в 70-х годах ХХ века (Johnson S.G., 197; de Kretser,
1976),
поэтому
нуждаются
в
модернизации
с
учётом
современных
методов
гистологического исследования.
Без глубокого познания факторов, воздействующих на семенник и оказывающих
положительное либо отрицательное влияние на его герминативную и эндокринную
функции, невозможно решать вопросы диагностики мужского бесплодия, в том числе,–
идиопатических форм, и, соответственно, вести поиск
4
путей
лечения в правильном
направлении. Широкая перспектива в исследовании морфофизиологии половых желез
открылась с внедрением методов иммуноцито- и иммуногистохимии, которые позволили
адресно исследовать in situ процессы синтеза разных биологически активных модуляторов
гаметогенеза. Имеющиеся в мировой литературе результаты исследований указывают на
важнейшее значение пара- и аутокринных факторов яичек и яичников в реализации
мужского и женского гаметогенеза. Однако в проблеме идиопатических форм мужского
бесплодия возможности этого метода до конца не реализованы, крайне недостаточно
работ в этом направлении проводится как в России, так и за рубежом.
Комплексное изучение особенностей структурно-функционального состояния мужских
половых клеток, эндокриноцитов и клеток стромы яичек при данной патологии,
несомненно, способствовало бы прогрессу знаний в области патогенеза идиопатических
форм мужского бесплодия. Иммуногистохимический анализ, охватывающий как общий,
так и специфический аспекты метаболизма клеточных компонентов семенных канальцев и
интерстициальной ткани семенников, несомненно, окажет действенную помощь в этом
направлении.
Степень разработанности проблемы
Среди авторов общими вопросами патоморфологии сперматогенеза при бесплодии
занимались: А.Ф. Астраханцев (НУЗ «ЦКБ №2 им. Н.А.Семашко ОАО «РЖД»,
заведующий патологоанатомическим отделением; Е.Н. Бочарова (ГБУЗ «Московский
научно-практический Центр дерматовенерологии и косметологии ДЗМ»). По многим
направлениям проблемы мужского бесплодия еще существует весомый дефицит
информации.
Большинство исследований выполняются на экспериментальных животных и полностью
экстраполировать их результаты на человека не правомерно. Что касается идиопатической
формы бесплодия у мужчин, то их экспериментальное моделирование не представляется
возможным, – и в этих случаях должен
анализироваться исключительно клинический
материал.
Цель исследования: выявление патоморфологических и молекулярных механизмов
нарушения сперматогенеза при идиопатическом бесплодии.
Задачи исследования:
а) Оценить активность иммуногистохимического маркирования мужских половых
клеток и соматических клеток яичек на факторы пролиферации и апоптоза (Ki-67, Bcl-2,
p53, каспазы-9), факторы дифференцировки (PLAP, CD117) при идиопатическом
бесплодии (при необструктивной азооспермии).
5
б) Провести сравнительный иммуногистохимический анализ перечисленных выше
факторов в структурах яичек лиц молодого (среднего) и пожилого возрастов для
выявления сходства и/или отличия от аналогичных показателей при идиопатическом
бесплодии.
в) Выявить степень активности универсального инсулиноподобного фактора роста-1
(IGF-I) в мужских половых клетках, клетках Сертоли и клетках Лейдига в норме и при
идиопатическом форме мужского бесплодия с использованием иммуногистохимического
метода.
г) Определить степень экспрессии генов-регуляторов клеточного цикла мужских гамет
при идиопатическом бесплодии (проапоптотические BAK и BAX и антиапоптотические
BCL2 и BCLW).
д) Разработать алгоритм клинико-морфологического исследования сперматогенеза для
диагностики идиопатическом бесплодия.
Научная новизна
В
работе
выявлены
молекулярно-биологические
особенности
пролиферации,
дифференцировки и апоптоза мужских гамет (прежде всего сперматогоний) при
патологическом сперматогенезе в сравнении с нормальным гаметогенезом в молодом и
пожилом возрастах:
Впервые доказано, что в сперматогониях при мужском идиопатическом бесплодии на
фоне низкой степени пролиферации (Ki-67 – 12.0±0.34%, р<0.05) отмечается увеличение
показателей готовности к апоптозу (Bcl-2 – 1.0±0.1%; р53 – 40,0±0.44%; р<0.05) в то
время,
как
при
течении
нормального
сперматогенеза
выявляется
значительное
преобладание процесса пролиферации над апоптозом у молодых мужчин по данным
иммуногистохимического анализа и ПЦР-РВ.
Впервые установлено, что в норме соотношение активности иммунофенотипирования
клеток на факторы пролиферации и апоптоза сперматогенеза меняется в зависимости от
возраста: у молодых лиц показатели пролиферации (Ki-67 – 42.0±0.34%, р<0.05) и
апоптоза (caspasa-9 – 39.5±0.33%, р<0.05) выше чем у пожилых (Ki-67 – 34.1±0.6%,
р<0.05; caspasa-9 – 35.6±0.4%, р<0.05). Факторы антиапоптоза также преобладают у
молодых мужчин (р53 – 17.2±0.33%, р<0.05; Bcl-2 – 43.2±0.44%, р<0.05).
Впервые выявлено, что в сперматогониях при фокальном варианте Сертоли-клеточного
синдрома (гипосперматогенезе, субтотальной герминальной аплазии) позитивная реакция
на PLAP (ve+/1), в норме экспрессируемого только в сперматогониях в антенатальном
развитии, является характерным для идиопатического бесплодия и указывает на
6
присутствие в семенных канальцах малодифференцированных форм сперматогоний
(гоницитов).
В сперматогониях при необструктивной азооспермии впервые показана отрицательная
иммунологическая реакция на антитела к CD117, что свидетельствует об отсутствии
перспективы вступления их в мейоз. Впервые выявлено, что положительная реакция на
CD117 в гаметах мужчин пожилого возраста (начиная со второго (эквационного)
мейотического деления) на стадии вторичного сперматоцита указывает на снижение
степени дальнейшей дифференцировки гамет, в отличие от лиц молодого возраста, где
данный фактор выявляется уже на стадии митоза сперматогоний.
Впервые доказано, что степень иммуномечения в сперматогониях на IGF-I у лиц с
идиопатическим бесплодием значительно ниже (гипосперматогенез – 7.0±0.1%, р<0.05;
блок созревания – 5.3±0.6%, р<0.05) или отсутствует по сравнению со здоровыми
мужчинами молодого возраста (40.0±0.33%, р<0.05).
Появление и последующее усиление фактора митохондриального (внутреннего) пути
апоптоза (каспазы-9) в клетках Сертоли напрямую зависит от степени поражения
семенных канальцев при необструктивной азооспермии в динамике: гипосперматогенез→
Сертоли-клеточный синдром→ тубулярная атрофия семенных канальцев.
Теоретическая и практическая значимость
Теоретическая значимость ретроспективного исследования заключается в том,
патогенез идиопатической формы мужского бесплодия связан с нарушением регуляции
сперматогенеза, приводящие к снижению пролиферации и дифференцировки гамет и
увеличению уровня апоптоза при участии таких регуляторных белков, как Ki-67, Bcl-2,
p53, caspase-9, PLAP, CD117, IGF-I.
Предложен клинико-морфологический алгоритм диагностики идиопатической формы
мужского бесплодия, который
включает
в
себя
комплекс
морфологических,
иммуногистохимических и молекулярных методов исследования. На первом этапе
диагностического поиска при обращении к урологу-андрологу осуществляется: сбор
анамнеза,
физикальный
осмотр,
лабораторная
цитогенетическая
и
молекулярно-
генетическая диагностика, исследование гормонов. На втором этапе проводится биопсия
яичка, по результатам которой выставляется предварительный диагноз по данным
гистологического анализа. Для окончательной верификации, на третьем этапе, проводят
иммуногистохимические реакции (Ki-67, Вcl-2, p53, каспаза-9, PLAP, CD117, IGF-I) и
ПЦР-диагностику.
7
Основные положения, выносимые на защиту
1.
Идиопатическая форма мужского бесплодия характеризуется снижением уровня
пролиферации сперматогоний на её ранних стадиях (гипосперматогенез, блок созревания)
по сравнению с нормальными показателями и отсутствием пролиферации сперматогоний
на более поздних формах-фазах развития этой патологии (фокальный вариант Сертоликлеточного синдрома) на фоне резкого снижения их численности. В сперматогониях, в
которых определяется PLAP-позитивная реакция, расцениваются как эмбриональные, а
отсутствие мечения на фактор дифференцировки CD117 указывает на бесперспективность
дальнейшего развития этих клеток.
2.
Патогенез блока созревания мужских половых клеток при гипосперматогенезе
связан, в том числе, со снижением содержания IGF-I в сперматогониях.
3.
Физиологический
сперматогенез
характеризуется
доминированием
процесса
пролиферации сперматогоний над их апоптозом. Данная закономерность присутствует и в
популяции первичных сперматоцитов у мужчин пожилого возраста, что отличает
механизм старение от патогенеза идиопатического бесплодия.
4.
Клинико-морфологическая
диагностика
идиопатической
формы
мужского
бесплодия должна включать в себя комплекс морфологических и молекулярных методов
исследования: иммуногистохимический (Ki-67, Bcl-2, p53, caspase-9, PLAP, CD117, IGF-I),
ПЦР-РВ (на гены BAK, BAX, BCL2, BCLW), выявление которых указывает на характер
течения сперматогенеза.
Степень достоверности и апробация результатов
Достоверность результатов обусловлена адекватностью сформированных контрольных
групп в сочетании с достаточным количеством пациентов, отражённых в настоящем
клиническом ретроспективном научном
исследовании и сравнением результатов,
полученных различными гистологическими методами, закреплены предложенными
количественными тестами морфометрии и подтверждены проведённым статистическим
анализом.
Основные результаты исследования были представлены на: Всероссийской научной
конференции «Бабухинские чтения в Орле» (г. Орёл, 2006 г.); совместной научной
конференции кафедр гистологии, цитологии, эмбриологии педиатрического и лечебного
факультетов РГМУ им. Н.И. Пирогова (г. Москва, 2009 г.), заседании Учёного совета
Факультета социальной медицины ГКА им. Маймонида (г. Москва, 2014 г.); семинаре
ФГБНУ НИИ Морфологии человека РАН (г. Москва, 2016 г.); семинаре в Институте
биологии развития им. Н.К. Кольцова РАН (г. Москва, 2016 г.); «International Conference
8
and exhibition on Cytology and Histology» (Birmingham, UK, 2016); 23rd meeting of the EAU
section of Urological research (Parma, Italy, 2016); European association of Urology (EAU),
section of Andrological urology (ESAU), Scientific meeting (Turkey, Bodrum, 2017).
Апробация диссертации состоялась на научной конференции кафедры патологической
анатомии имени академика А.И. Струкова Первого Московского государственного
медицинского университета им. И.М. Сеченова (Сеченовский Университет) «01»
«ноября» 2017 года.
Личный вклад автора
Автору принадлежит ведущая роль в клинико-морфологической реализации заявленной
научной работы. Выполненные морфологические (гистологическое, гистохимическое)
пособия, анализ и интерпретация, полученных данных ретроспективного исследования
проведены автором самостоятельно. Он присутствовал при заборе биопсийного материала
урологом-андрологом у пациентов. Автором лично были освоены и применены методы
иммуногистохимического анализа, компьютерного моделирования структур яичка,
проведено исследование морфофункционального состояния яичек здоровых мужчин
разных возрастов (контрольная группа) и страдающих бесплодием, для сравнения с
результатами клинико-лабораторных исследований пациентов, математическая обработка
полученных данных, выбор и описание иллюстративного материала, написание выводов и
практических рекомендаций. Вклад автора является определяющим в обсуждении
результатов исследования в научных публикациях и их внедрения в практику. Автором
установлены
определённые
патогенетические
механизмы
идиопатической
формы
мужского бесплодия, а также иммунофенотипические признаки интраорганной регуляции
сперматогенеза в норме.
Внедрение результатов исследования в практику
Результаты исследований используются при диагностики идиопатических форм
мужского бесплодия в Центральном патологоанатомическом отделении ФГАОУ ВО
Первый МГМУ им. И.М. Сеченова, при чтении лекций и проведении практических
занятий на кафедре патологической анатомии им. академика А.И. Струкова.
Соответствие диссертации паспорту научной специальности
Диссертация соответствует паспорту научной специальности 14.03.02. – Патологическая
анатомия, а также области исследования согласно пунктам 1, 2, 3, и 4.
Публикации материалов и результатов исследования
Основное содержание диссертации отражено в 12 научных работах соискателя, в том
числе в 9 статьях в журналах, рекомендованных ВАК Минобрнауки России.
9
Объём и структура диссертации
Диссертационная работа состоит из введения, обзора литературы, описания материалов и
методов, собственных результатов и их обсуждения, заключения, выводов и списка
литературы, включающего 145 источников отечественных (38) и зарубежных (107)
авторов. Материалы диссертации изложены на 141 странице машинописного текста и
иллюстрированы 57 микрофотографиями, 16 графиками, 24 таблицами, а также
приложение (7 страниц иллюстративного материала).
СОДЕРЖАНИЕ ДИССЕРТАЦИОННОЙ РАБОТЫ
Материал и методы исследования
Ретроспективное исследование проводили на кафедре патологической анатомии имени
академика Анатолия Ивановича Струкова (заведующая кафедрой – д.м.н., профессор Е.А.
Коган) ФГАОУ ВО Первый МГМУ им. И. М. Сеченова.
Исследуемый материал представлен двумя группами:
I. – группа с условным контролем физиологического течения сперматогенеза, в
семейном анамнезе – одно и более деторождений (возрастная выборка проводилась по
Г.Г. Автандилову, 1998; A.C. Леонтюк с соавт., 2000): А – мужчины 22–35 лет (28.5±6.5,
n=10); Б. – мужчины 64–75 лет (69.5±5.5, n=10). Объектом исследования в этой группе
служил аутопсийный материал правых яичек, полученные при ранних вскрытиях трупов
мужчин (не более 6 часов после констатации биологической exitus letalis). Яички изучали
макроскопически на предмет наличия/отсутствия воспалительного и/или опухолевого
процесса.
Во II группу были включены мужчины зрелого возраста 22–35 лет (28.5±6.5) с
клинически (и морфологически) подтверждённым диагнозом идиопатического бесплодия
(азооспермия) (n=30). Объектом исследования в этой группе служили биоптаты правых
яичек. Медицинскими показаниями для получения биоптатов яичек была азооспермия.
Клинический материал (биоптаты яичек у 30 мужчин, страдающих идиопатическим
бесплодием) был получен при биопсии под местной анестезией (Клиника урологии им.
Р.М. Фронштейна Первого МГМУ им. И. М. Сеченова, урологический центр НКЦ ОАО
«РЖД», клиника «Мать и дитя»). Причиной обращения в медицинские учреждения
пациенты называли нарушение фертильности (первичное бесплодие) (n=24), а также
невынашивания беременности, неудач экстракорпорального оплодотворения и переноса
эмбрионов или неудач интрацитоплазматической инъекции сперматозоидов (ICSI) (n=6).
Изначально было обследовано 50 мужчин, обратившихся на приём к урологам-андрологам
с проблемами фертильности (возраст 22 – 35 лет). Из дальнейшего исследования были
10
исключены 20 пациентов (критерии исключения): отягощённый лекарственный анамнез
(n=4; андрогены или анти-эстрогены), системные заболевания (n=9), хромосомные
транслокации (n=1), гипогонадотропный гипогонадизм (n=6), а также другие эндокринные
заболевания, ведущие к снижению секреции тестостерона: гипотиреоз, тиреотоксикоз,
гиперпролактинемия (определяется на основании уровней тиреотропного гормона,
свободного
тироксина
Т 4,
пролактина),
декомпенсация
сахарного
диабета,
гиперкортицизм, а также почечная или печеночная недостаточность, воспалительные
заболевания урогенитального тракта в стадии обострения.
Все исследования проведены с соблюдением требований протокола № 10-16 от
09.11.16, одобренного Этическим комитетом ФГАОУ ВО Первый МГМУ им. И.М.
Сеченова, а также соответствуют Хельсинкской декларации (WMA Declaration of Helsinki
– ethical principles for Medical research involving Human subjects, 64th WMA General
Assembly, Fortaleza, Brazil, October, 2013).
Методы исследования мужчин (n=30), страдающих бесплодием включали: физикальный
осмотр
(без
особенностей),
сбор
anamnesis
morbi
et
vitae,
инструментальные
(ультразвуковое исследование) и лабораторные данные (уровни гормонов ФСГ, ЛГ,
тестостерон и спермограмма с MAR-тестом были в пределах возрастной нормы),
цитогенетическая и молекулярно-генетическая диагностика – без аномалий хромосом, а
также биопсия яичка (оценка проводилась по шкале S. Johnsen, от 0 до 10, где 8 – 10
баллов это показатель нормального сперматогенеза).
Полученные аутопсийный (мужчины 22 – 35 и 64 – 75 лет) и биопсийный материал
(мужчины 22 – 35 лет с идиопатическим бесплодием) фиксировали в 10% нейтральном
формалине, забуференным по Лили (при рН 7,2 – 7,4), обрабатывали в аппарате
гистологической проводки тканей фирмы «Pool scientific instruments» (Швейцария) и
заливался в парафин. Суммарное время фиксации, проводки и заливки материала не
превышало 48 часов. Затем с каждого блока готовилось 25 ступенчатых парафиновых
срезов толщиной 4–5 мкм, которые фиксировали на предметные полилизиновые стекла
(Mаinzel glаser, polylisine, Германия) и инкубировали в термостате при температуре 37°С в
течение 12 часов. Далее срезы депарафинировали и регидратировали последовательно в
ряде растворов, состоящем из 3-х ксилолов, 2-х абсолютных спиртов, 2-х 95% спиртов,
80% и 70% спирта и дистилированной воды. По одному препарату от каждого случая
окрашивали гематоксилином и эозином; на волокнистый компонент – пикрофуксином по
van Gieson, по Masson, по Weigert; на гликоген – PAS-реакция. В группе с нормальным
сперматогенезом для верификации мужских половых клеток (идентификации стадий
11
мейоза) и клеток Сертоли в извитых семенных канальцах использовали метод
цитологических отпечатков. Изучение и морфометрический анализ аутопсийного и
биопсийного материала выполняли на светооптическом микроскопе «Carl Zeiss Lab.A1»
(Carl Zeiss, Германия), совмещённом с видеокамерой «AxioCam ERc5s» (Carl Zeiss
Microscopy GmbH, Германия) и программным обеспечением ZEN Lite.
Иммуногистохимические реакции проводили по стандартной методике с термической
демаскировкой антигенов. Используемые первичные антитела, их разведение и фирма
производитель представлены в табл. 1.
Таблица 1
Перечень и характеристики первичных антител, используемых для
иммуногистохимического исследования
Антитела
Ig класс, фирма
Специфичность и характеристика
БЕЛКИ – МАРКЕРЫ ЖИЗНЕННОГО ЦИКЛА КЛЕТКИ
Mouse monoclonal
Clone MM1 IgG1
Ядерный антиген; выявляется во всех пролиферирующих
TM
antibody
клетках в G1 (поздней), S, M и G2 фазах клеточного цикла
Novocastra
Ki-67 Antigen
1:100
Mouse monoclonal Clone DO-7 IgG2b
Ядерный антиген; для восстановления целостности
antibody
повреждённой ДНК или р53 запускает в клетке механизм
NovocastraTM
р53 Protein
1:100
апоптоза.
Mouse monoclonal Clone bcl-2/100/D5
Цитоплазматический антиген; белок внутренней
antibody
IgG1
митохондриальной мембраны, который действует в
Bcl-2 Oncoprotein
качестве ингибитора апоптоза.
NovocastraTM
1:100
Rabbit polyclonal
IgG Abcam
Цитоплазматический антиген внутреннего пути апоптоза;
antibody caspase-9
1:100
активирует гибель ядра и цитолиз.
ФАКТОРЫ ДИФФЕРЕНЦИРОВКИ (МУЖСКИХ ПОЛОВЫХ КЛЕТОК)
Mouse monoclonal
Clone 8A9
Цитолеммальный антиген; в норме – выявляется в
antibody
IgG1
мембране синцитиотрофобласта ворсин хориона,
Placental alkaline
BondTM 1:100
плаценты и в гонобластах/гоноцитах.
phosphatase (PLAP)
Mouse monoclonal
antibody c-kit
(CD117)
Rabbit polyclonal
antibody
Insulin-like Growth
Factors-I
Clone T595 IgG1
NovocastraTM
1:100
IgG1
Santa Cruz
Biotechnology
1:100
Цитоплазматический антиген дифференцировки; в норме
– обнаруживается в гонобластах/гоноцитах.
ФАКТОР РОСТА
Цитоплазматический антиген;
показатель пролиферативной митотической активности
клеток; аутокринный/паракринный стимулятор роста.
Вторичные антитела – универсальные (HiDef Detectionтм HRP Polymer system, «Cell
Marque», США), позволяющие выявлять мышиные и кроличьи первичные антитела,
конъюгированные с ферментным комплексом на основе пероксидазы хрена. Результаты
иммуногистохимических реакций оценивали количественными и полуколичественными
методами.
12
Согласно рекомендациям (Dabbs D.J. 2014. Diagnostic immunohistochemistry. 4th ed., 2014.
Philadelphia, PA: Elsevier/Saunders. 960 р.) и учитывая специфику исследуемого объекта
(яички), где половые клетки при световой микроскопии «перекрывают» друг друга,
проводили подсчёт числа иммунопозитивных клеток (в 100 клетках в 10 полях зрения
светового микроскопа при увеличении объектива ×40, в %) и оценивали степень их
экспрессии (в баллах, ve +/–): «–» – отсутствие, «+/1» – слабая (1 – 10% клеток), «+/2» –
умеренная (11 –50% клеток), «+/3» – выраженная иммунопероксидазная реакция (≥51%
клеток).
Полимеразная цепная реакция в режиме реального времени (ПЦР-РВ). Фрагменты
биоптатов яичек были помещены в стабилизирующий раствор RNAlater (QIAGEN,
Нидерланды) и хранились при –70°C. Впоследствии образцы подвергли гомогенизации
согласно
стандартному протоколу.
Экстракцию
тотальной
РНК
производили
с
использованием набора готовых реактивов RNeasy plus mini kit (QIAGEN, Нидерланды).
Синтез комплементарной ДНК (кДНК) с матрицы полученной РНК осуществляли с
помощью набора SuperScript™ VILO™ master mix (Invitrogen). Выделенные к-ДНК
подверглись ПЦР-РВ с использованием готовой смеси реагентов Absolute blue QPCR mix
(Thermo scientific, США) с интеркалирующим флуоресцентным красителем SYBR green I.
ПЦР-РВ проводилась с использованием StepOne System (Applied Biosystems, CША) и
штатного
программного
обеспечения.
Анализ
экспрессии
генов
проведен
с
использованием метода определения порогового цикла (Ct) и вычисления относительной
экспрессии генов согласно протоколу (Schmittgen T., Livak K. Analyzing real-time PCR data
by the comparative C(T) method, 2008). Нормирование и внутренний контроль выполнены
относительно референсного гена GAPDH. Статистический контроль проводился
относительно I.А. группы с нормальным сперматогенезом (аналогичного возраста с
бесплодными
мужчинами).
Подбор
праймеров
был
осуществлён
на
основании
общедоступных материалов о последовательностях ДНК и м-РНК генов в базе данных
NCBI с использованием программы Primer-BLAST (табл. 2).
Таблица 2
Используемые праймеры
Ген
BAK
BAX
BCL2
BCLW
GAPDH
5´-праймер
CACGGCAGAGAATGCCTATGA
GTCGCCCTTTTCTACTTTGCCAG
TCCGATCAGGAAGGCTAGAGTT
TCCAGCCCAACAGCCGCTCC
GAAGGTGAAGGTCGGAGTCA
13
3´-праймер
CCCAATTGATGCCACTCTCAA
TCCAGCCCAACAGCCGCTCC
TCGGTCTCCTAAAAGCAGGC
CAGTGGTTCCATCTCCTTGTTG
GAAGATGGTGATGGGATTTC
Статистические методы и обработка данных. Полученные в результате подсчёта данные
обрабатывали с использованием компьютерной программы SPSS 7.5 for Windows statistical
software package (IBM Analytics, США). При этом определяли вариационные ряды,
среднюю арифметическую, среднеквадратическое отклонения, среднюю ошибку и
вероятность различия. Затем оценивали соответствие/ несоответствие полученных
результатов нормальному распределению с применением критерия Колмагорова–
Смирнова. При статистической обработке для оценки достоверности различий средних
значений между группами использовались следующие непараметрические критерии: Uкритерий Манна–Уитни, Н-критерий Краскалла-Уоллеса. При отсутствии нормального
распределения данных использовали непараметрический критерий F. Wilcoxon (Statistical
methods for research workers) с уровнем значимости p<0.05. Количественные данные,
полученные в ходе ПЦР-РВ, были проанализированы с использованием рангового
дисперсионного анализа ANOVA.
Результаты исследования и их обсуждение
Микроскопическое описание яичек мужчин IА и IБ группы. Стенки семенных канальцев
образованы клетками Сертоли и половыми клетками, находящимися на различных
стадиях сперматогенеза. Во всех исследуемых образцах в каждой подгруппе выявляются
морфологические признаки нормального сперматогенеза (8 – 10 баллов по шкале S.
Johnsen). Сперматогонии лежат на базальной мембране, образуя базальные отсеки
семенных канальцев, клетки последующих стадий сперматогенеза локализуются в
адлюминальном отсеке, а сперматозоиды – в просветах. В большинстве семенных
канальцев гаметы образуют отдельную функциональную «колонку», в которой все они
находятся на одной из шести стадий сперматогенного цикла. Сперматогонии, которые ещё
не вступили в мейоз, несут функцию сперматогониальных стволовых клеток (SSC),
пополняющие
сперматогониальный
пул.
В
семенниках
лиц пожилого
возраста
выявляются дистрофические изменения половых клеток, местами отмечается уплотнение
волокнистого компонента перитубулярных пространств и стенок кровеносных сосудов.
Появление ангиотрофических нарушений вызывает снижение транспорта биологически
активных
веществ
через
гематотестикулярный
барьер,
приводя
к
выраженным
дегенеративным процессам в половых клетках. Кроме того, с возрастом постепенно
уменьшается количество клеток Лейдига.
Микроскопическое описание
яичек мужчин
II группы, с идиопатической формой
бесплодия (n=30). У 3-х – гипосперматогенез (в семенных канальцах располагаются
сперматогонии и разрушенные первичные сперматоциты), оценка сперматогенеза по
14
шкале S. Johnson (JS) – 4 бала; у 21-го – блок созревания с фокусами субтотальной
аплазии гамет (слущенные единичные сперматогонии, клетки Сертоли), JS=3 балла; у 5-ти
– Сертоли-клеточный синдром (только клетки Сертоли), JS=2 балла; у 1-го – тубулярная
атрофия канальцев, JS=1 балл. Также, во всех исследуемых случаях выявили гиперплазию
клеток Лейдига. Выявленные морфологические различия подтверждают наличие
нескольких гистологических вариантов изменения извитых семенных канальцев при
идиопатической форме мужского бесплодия.
Данные иммуногистохимического исследования яичек I и II групп (табл. 3) (прил. I)
(уровень значимости p<0.05).
Анализ маркеров клеточного цикла. Белок Ki-67 был обнаружен во всех половых
клетках, как в нормальном, так и патологическом сперматогенезе. Клетки Сертоли и
Лейдига, миоидные клетки были иммунонегативными. Индекс пролиферации (Ki-67)
сперматогоний мужчин 22 – 35 лет контрольной группы составляет 42.0±0.34%, что в 3,5
раза выше чем при идиопатическом бесплодии (12.0±0.1%). Проапоптотический индекс
(p53) сперматогоний в контрольной I.A. (57.2±0.66%; у пожилых – 12.2±0.3%) группе
выше чему у сперматоцитов I в 2,0 раза (28.5±0.5%) и в 3,9 раза у сперматоцитов II
(14.5±0.33%). Количество окрашенных на р53 сперматогоний при необструктивной
азооспермии в 2,6 раза выше, чем в контроле у мужчин 22 – 35 лет. Степень маркирования
на caspase-9, активация которой происходит при реализации митохондриального пути
апоптоза, в сперматогониях с нормальным сперматогенезом находится примерно на
одном уровне (доля меченых сперматогоний составляет у молодых мужчин – 39.5±0.33%,
у пожилых – 35.6±0.44%) и снижен при идиопатической форме мужского бесплодия на
стадии гипосперматогенеза (22.0±0.22%). При дальнейшем развитии патологических
изменений этот показатель возрастает и при фокальном варианте Сертоли-клеточного
синдрома составляет уже 72.0±0.41%. Ни в одной из гистологических форм
идиопатического бесплодия в клетках Лейдига и в миоидных клетках caspase-9 не
выявлено (ve–). Анализ маркирования на Bcl-2 показывает, что антиапоптотическая
активность превалирует в половых клетках у мужчин 22 – 35 лет (43.2±0.44%), снижается
в пожилом возрасте (14.1±0.2%) и практически исчезает на всех стадиях нарушенного
сперматогенеза (1.0±0.1%). Доля ИГХ-позитивных половых клеток на Bcl-2 в пожилом
возрасте составило: сперматогонии – 11.3±0.1%, сперматоциты I – 53.2±0.3%,
сперматоциты II – 27.4±0.2%, сперматиды – 9.1±0.3%. Таким образом, в норме
наибольшей антиапоптотической активностью обладают сперматоциты первого порядка
(у молодых – 46.0±0.55%) – клетки, вступившие в редукционное деление мейоза.
15
Учитывая данные пролиферации и апоптоза, а также про- и антиапоптотической
активности сперматогоний при бесплодии можно говорить о выраженном дисбалансе –
преобладание апоптоза над пролиферацией. При этом причина инициирования апоптоза в
сперматогониях
вероятнее
всего
связана
с
аутокринными
нарушениями
либо
повреждениями митохондрий, а также увеличением уровней окислительного стресса.
Анализ факторов дифференцировки половых клеток. У мужчин пожилого возраста
отсутствие реакции на CD117 в сперматогониях (ve–) и первичных сперматоцитах
указывает на снижение степени дифференцировки, в отличие от среднего возраста, где
данный фактор выявляется уже в сперматогониях. Иммуномечение на CD117 у пожилых
мужчин обнаружено лишь в гаметах, начиная со второго (эквационного) мейотического
деления (на стадии вторичного сперматоцита) (ve+/3). Таким образом, в группе мужчин 64
– 75 существует преобладание процесса дифференцировки гамет на фоне сниженной
пролиферативной активности. В связи с чем, у пожилых людей возникает высокий риск
передачи хронических заболеваний потомству при деторождении в этом возрасте.
Исследуемый маркёр в сперматогониях при идиопатическом бесплодии не выявляется, то
есть, сперматогониальные клетки (SSC) в семенных канальцах отсутствуют, равно как и
нет клеток, обладающих унипотентными свойствами и обновляющихся популяций
половых клеток. Один из факторов эмбриональной дифференцировки мужских гамет
(PLAP) у мужчин молодого и пожилого возрастов в норме не обнаружен. В то время, как в
10.2±0.13%
сохранившихся
сперматогоний
при
гипосперматогенезе
отмечается
положительная мембранная ИГХ-реакция с антителами к PLAP, что не исключает наличие
в семенных канальцах единичных малодифференцированных клеток. А также, учитывая,
что PLAP является маркером тестикулярной интроэпителиальной неоплазии, нельзя
исключить, что бесплодие попадает в группу риска по малигнизации.
Анализ фактора роста (IGF-I). В контрольной группе наиболее ярко маркируются
половые и в меньшей степени соматические клетки семенных канальцев и их
микроокружения. Выраженность иммунологической реакции с антителами к IGF-I в
мужских гаметах снижается в процессе сперматогенеза: от сперматогоний («ve+/3») до
сперматозоидов («ve+/2»). Окрашивание на IGF-I в половых клетках и клетках Сертоли
подтверждает функциональную необходимость данного фактора роста в региональном
механизме ауто- и паракринной регуляции текущих процессов в яичке и семенных
канальцах в частности.
Отсутствие специфического маркирования стромальных
компонентов свидетельствует о её вспомогательной роли в этих процессах. В то время,
как при идиопатическом бесплодии отмечается слабое окрашивание на IGF-I в
16
сперматогониях и снижение его количества в 8,8 раза (7.0±0.22%) по сравнению с таковой
возрастной группой в контроле (62.0±0.33%) и на 5,7% у пожилых мужчин (40.0±0.33%).
Более
вероятно,
что
существует
нарушение
паракринной
регуляции
синтеза
инсулиноподобного фактора роста-1 при бесплодии.
Таблица 3
Доля ИГХ-позитивных сперматогоний в семенных канальцах на исследуемые
маркеры в нормальном сперматогенезе и при идиопатическом бесплодии (%)
Антитела
Ki-67
р53
Bcl-2
caspase-9
PLAP
CD117
IGF-I
нормальный
сперматогенез
22 – 35
61 – 74
лет
года
42.0±0.34
34.1±0.6 ⃰
57.2±0.66
12.2±0.3 ⃰
7.5±0.44
11.3±0.1 ⃰
39.5±0.33
35.6±0.44 ⃰
0
10.0±0.33
39.5±0.33
0
6.0±0.3 ⃰
35.6±0.44 ⃰
идиопатическое бесплодие
гипосперматогенез
15.0±0.1⃰ ⃰
40.0±0.44⃰ ⃰
1.0±0.1⃰ ⃰
22.0±0.22**
блок
созревания
12.0±0.1⃰ ⃰
64.3±0.39⃰ ⃰
0
64.3±0.39⃰ ⃰
фокальный
вариант СКС
9.0±0.2⃰ ⃰
72.0±0.41⃰ ⃰
0
72.0±0.41⃰ ⃰
10.2±0.13% ⃰ ⃰
0
7.0±0.1⃰ ⃰
0
0
5.3±0.6⃰ ⃰
0
0
1.0±0.2⃰ ⃰
⃰– статистически достоверные различия (при p<0.05) между I.A. и I.Б. контрольными подгруппами.
⃰ ⃰ – статистически достоверные различия (при p<0.05) между контрольной группой I.A. и группой лиц,
страдающих бесплодием.
Анализ экспрессии генов посредством ПЦР-РВ. В ходе оценки уровня экспрессии генов,
продукты которых ответственны за внутриклеточную регуляцию апоптоза, были
выявлены существенные статистические различия (p<0.05) как между исследуемыми
образцами
биоптатов яичек
группы
II
(идиопатическое
бесплодие
c
разными
патоморфологическими формами), так и при их сравнении с контролем. Выявлено
значительное повышение относительного уровня экспрессии проапоптических генов
внутреннего пути BAX и BAK, наиболее выраженное в группе пациентов с
гипосперматогенезом (рис. 1). Напротив, экспрессия антиапоптотических генов BCL2 и
BCLW оказалась снижена. При этом обнаружено, что значения относительной экспрессии
гена BCLW значительно ниже контрольного уровня во всех патоморфологических формах
пациентов с идиопатическим бесплодием, в то время как уровень экспрессии BCL2
изменен умеренно (рис. 2).
Заключение. При бесплодии изменение баланса генов в сторону увеличения экспрессии
проапоптотических генов (BAK, BAX) и снижения антиапоптотических генов (BCL2,
BCLW) способствует индукции апоптоза уже на ранних этапах.
17
BAK
BAX
2 .5
4
*
*
2 .0
3
*
1 .5
*
*
БМ
C КС
2
1 .0
1
0 .5
0 .0
0
КР
ГС
БМ
C КС
КР
ГС
Рисунок 1. Экспрессия проапоптотических генов BAK и BAX в яичках пациентов с
нормальным сперматогенезом (группа IА) и при идиопатическом бесплодии (группа II).
По вертикали: относительный уровень экспрессии, усл. ед.; КР – контроль (IА группа, 22 – 35
лет); ГС – гипосперматогенез; БМ – блок мейоза; СКС – Сертоли-клеточный синдром.
*– статистически значимые отличия от контроля, p < 0.05.
BCL2
BCLW
1 .0
2 .5
0 .8
2 .0
*
*
0 .6
1 .5
0 .4
1 .0
0 .2
0 .5
0 .0
0 .0
КР
ГС
БМ
C КС
*
*
ГС
БМ
*
КР
C КС
Рисунок 2. Экспрессия антиапоптотических генов BCL2 и BCLW в яичках
пациентов с нормальным сперматогенезом (группа I) и при идиопатическом
бесплодии (группа II). По вертикали: относительный уровень экспрессии, усл. ед.; КР –
контроль (IА группа, 22 – 35 лет); ГС – гипосперматогенез; БМ – блок мейоза; СКС –
Сертоли-клеточный синдром. *– статистически значимые отличия от контроля, p < 0.05.
Резюме.
Таким
образом,
сперматогенез
–
сложнейший,
богатый
событиями
биологический процесс, важнейшая роль в регуляции которого принадлежит центральным
и региональным механизмам (интратестикулярным).
При мужском идиопатическом бесплодии в регуляции сперматогенеза важная роль
принадлежит соматическим и эндокринным клеткам. Очевидно, что стимуляция
паракринной
регуляции
сперматогенеза
способствует
реализации
собственных
сепаративных механизмов. Кроме того, велико значение не только синтезируемым
биологически активным веществам, но и продуктам распада погибающих половых клеток
в результате естественного отбора.
Преимущество биопсии яичка состоит в том, что при исследовании нативных половых
клеток повышается качество прижизненной диагностики, показывая более правдивую
морфологическую
картину
интраорганных
молекулярных
взаимоотношений,
обеспечивая наибольшую информативность, в отличие от аутопсийного материала.
18
и
Проведённое ретроспективное исследование выявило выраженный дисбаланс между
пролиферацией и апоптозом мужских половых клеток, а также возможное нарушение
нейроэндокринной регуляции, что является одним из ключевых звеньев патогенеза
идиопатической формы мужского бесплодия (рис. 3).
Рисунок 3. Патогенез идиопатической формы мужского бесплодия,
графологическая структура.
Сравнительный иммуногистохимический анализ изучения белковых регуляторов
гистогенеза указывает на объективное отличие микроскопической картины семенных
канальцев при идиопатической форме мужского бесплодия от таковых в возрастной
группе пожилых мужчин с нормальным сперматогенезом. Это свидетельствует о том, что
идиопатическая форма мужского бесплодия патогенетически не связана с, так
называемым, синдромом преждевременного старения половых желез.
На
основании
проведенного
исследования
разработан
алгоритм
клинико-
морфологической диагностики идиопатического бесплодия.
ВЫВОДЫ
1.
Идиопатическая
форма
мужского
бесплодия
состоит
из
форм-фаз:
гипосперматогенез, блок созревания, фокальный и классический варианты Сертоликлеточного синдрома (Sertoli-cell-only syndrome), характеризующихся прогрессирующим
нарушением сперматогенеза.
2.
Стадии гипосперматогенеза и блока созревания при идиопатической форме
мужского
бесплодия
характеризуются
снижением
19
пролиферации
сперматогоний,
нарушением дальнейшей их дифференцировки и наличием эмбриональных PLAPпозитивных клеток.
3.
При Сертоли-клеточном синдроме и его фокальном варианте отмечается
доминирование апоптоза клеток Сертоли и единичных сперматогоний на фоне отсутствия
их пролиферации.
4.
Снижение уровня пролиферации сперматогоний при идиопатической форме
мужского бесплодия является причиной гипосперматогенеза на ранних стадиях
заболевания, а отсутствие последующей дифференцировки сперматогоний вызываемое
блоком их созревания сочетанием увеличения уровня апоптоза на поздних стадиях.
5.
Отличия физиологического сперматогенеза в среднем (22 – 35 лет) и пожилом (64 –
75 лет) возрастных периодах заключаются в следующем: у молодых мужчин обнаружено
значительное доминирование пролиферации над апоптозом, а у лиц пожилого возраста –
при сохранном уровне размножения сперматогоний выявляется относительная активация
клеточной
гибели,
что
может
рассматриваться
как
механизм
физиологической
элиминации аберрантных гамет, риск возникновения которых в период старения
возрастает.
6.
от
Механизмы формирования возрастных изменений семенных канальцев отличаются
патогенеза
идиопатического
бесплодия,
что
подтверждается
сравнительными
иммуногистохимическими показателями половых клеток и клеток Сертоли: снижение и
последующее отсутствие пролиферации и дифференцировки сперматогоний при
бесплодии, что характерно для пожилых мужчин.
7.
Низкое содержание инсулиноподобного фактора роста-I в сперматогониях
приводит к гипосперматогенезу и нарушению созревания половых клеток в патогенезе
мужского бесплодия.
Практические рекомендации
Приведенные данные могут послужить основой для развития и совершенствования
методов обследования дисфункциональных состояний мужской репродуктивной системы,
для разработки новых подходов к диагностике и лечению идиопатической формы
мужского бесплодия и комбинированной адьювантной терапии опухолей яичка.
Полученные результаты по взаимодействию половых клеток с их микроокружением в
норме и при патологии целесообразно более широко использовать в учебном процессе,
учебных и методических пособиях при изложении материала, связанного с Мужской
репродуктивной системой курса Патологической анатомии, Гистологии, Онкологии,
20
Урологии и Андрологии в Медицинских ВУЗах, на биологических факультетах
университетов и педагогических институтов.
Предложен метод подсчёта на гистологических препаратах яичка мужских половых
клеток, сустентоцитов (клеток Сертоли) и интерстициальных эндокриноцитов (клеток
Лейдига) с использованием условных стандартов.
Приведены морфологические критерии для оценки степени поражения при мужском
идиопатическом бесплодии на гистологических препаратах (биоптатах) – алгоритм
тестикулярной дифференциальной диагностики.
Дальнейшие перспективы развития исследования
На основании полученных данных об особенностях патогенеза идиопатической формы
мужского
бесплодия
дальнейшей
перспективой
исследований
в
этой
области
представляется поиск эффективных методов диагностики и коррекции бесплодия у этой
группы мужчин, особенно – у мужчин с блоком созревания и фокальным вариантом
Сертоли-клеточного синдрома. В русле обозначенной проблемы в последующих работах
могут
быть
использованы:
1)
экспериментальные
исследования
лекарственных
препаратов, влияющих на функции пролиферации, дифференцировки и апоптоза гамет у
пациентов
с
идиопатической
формой
мужского
бесплодия;
2)
исследование
морфологических особенностей строения паренхимы яичка у мужчин с бесплодием
неясного генеза и другими экстрагенитальными заболеваниями, не влияющими напрямую
на репродуктивную функцию; 3) исследование прогноза и факторов риска (например,
малигнизация) при Сертоли-клеточном синдроме.
Список работ, опубликованных по теме диссертации
1.
О.В. Волкова, И.А. Бичерова, Г.Г. Кругликов, Г.А. Демяшкин. Морфо-
цитохимические особенности гамет в процессе роста // «Морфология» - Москва. – 2006.
- №4. – С.34 – 35.
2.
Г.А. Демяшкин, Н.Ш. Амиров. Паракринные механизмы регуляции функций
семенника (иммуноцитохимический аспект) // «Фундаментальные исследования» –
Москва. – 2009. – №2. – С. 88 – 90.
3.
О.В. Волкова, И.А. Бичерова, В.А. Степаненко, Г.А. Демяшкин. Механизмы,
управляющие базисными процессами репродукции // «Морфология» – Москва.- 2009. Т. 136. - №4.- С. 32.
4.
Г.А. Демяшкин. Морфологическая характеристика сперматогенеза в норме и при
идиопатическом бесплодии (иммуногистохимический аспект) // «Вестник медицинского
института «РЕАВИЗ»: реабилитация, врач и здоровье». – 2015. – №4. – С. 107 – 119.
21
5.
Г.А.
Демяшкин.
Структурно-функциональная
характеристика
фокального
варианта синдрома клеток Сертоли (иммуногистохимический аспект) // «Вестник
медицинского института «РЕАВИЗ»: реабилитация, врач и здоровье». – 2016. – №1
(21). - С. 123 – 130.
6.
Г.А. Демяшкин. Новые подходы к диагностике мужского бесплодия: анализ
биоптатов яичка с нормальным и нарушенным сперматогенезом» // «Вестник
медицинского института «РЕАВИЗ»: реабилитация, врач и здоровье». – 2016. – №2
(22). - С. 110 – 128.
7.
Г.А. Демяшкин. Пролиферация и
апоптоз
мужских
половых
клеток
в
сперматогенном эпителии в норме и при азооспермии // Крымский журнал
экспериментальной и клинической медицины. – 2016. – Т.7.- № 2.- С. 19 – 32.
8.
Н.Г. Кульченко, Г.А. Демяшкин. Морфологические изменения в ткани яичка при
бесплодии // Андрология и генитальная хирургия. – 2016. – №3. - С. 45 – 49.
9.
Г.А. Демяшкин, Н.Г. Кульченко, А.А. Костин, Ю.В. Самсонов, Д.В. Москвичёв.
Прогнозирование резервной функции яичек у пациентов с необструктивной азооспермией
// Научно-практический журнал «Исследования и практика в медицине». – 2016. – Т. 3,
№3. - С. 42 – 48.
10.
Г.А. Демяшкин, Е.А. Коган, Т.А. Демура. Тканевой ингибин-В – маркёр
сперматогенеза. //Патогенез. – 2016.- №14(4). – С.43 – 50.
11.
Г.А.
Демяшкин, Е.Е. Филиппов. Морфофункциональная характеристика
инсулиноподобного фактора роста 1 в нормальном сперматогенезе и при идиопатическом
бесплодии.// Международный журнал прикладных и фундаментальных исследований. 2017. - № 1-2. - С. 236-239.
12.
G. Demyashkin. Tissue testicular Inhibin-B for Sertoli cell-only syndrome. European
Association of Urology (EAU), Section of Andrological Urology (ESAU). Scientific Meeting.
May, 2017. 66-67.
Перечень принятых сокращений: H&E – англ. Hematoxylin and eosin – гематоксилин и
эозин; SCO-s – англ. Sertoli-cell-only syndrome – Сертоли-клеточный синдром; SCO-sF –
англ. Sertoli-cell-only syndrome focalis – Сертоли-клеточный синдром, фокальный вариант
(сперматогенеза); ve – интенсивность иммуногистохимического мечения (верификация);
м.о. – мерный отрезок.
22
Приложение I. Семенные канальцы в норме (контрольная группа) и при
патологическом сперматогенезе (идиопатическая форма мужского бесплодия),
иммуногистохимическая реакция
БЕЛКИ
нормальный сперматогенез
(мужчины 22 – 35 лет, IA группа)
идиопатическое бесплодие
(мужчины 22 – 35 лет, II группа)
БЕЛКИ – МАРКЕРЫ ЖИЗНЕННОГО ЦИКЛА КЛЕТКИ
Ki-67
В норме
сперматогонии
обладают
выраженной
митотической
активностью
(42.0±0.34%) по
сравнению с
идиопатическим
бесплодием
(12.0±0.1%)
Sg+
Sd–
Sg–
Sg+
SC–
увеличение ×100, м.о. – 10 мкм
p53
Индекс готовности
к апоптозу
сперматогоний
(17.2±0.33%) в
норме выше чем в
других гаметах, но
в 2,6 раза ниже у
лиц, страдающих
бесплодием
(40.0±0.44%)
Md–
Sg+
Sz–
caspase-9
в сперматогониях
значения маркера
инициации
апоптоза повышены
при блоке
созревания
(64.3±0.39%)
по сравнению с
нормой (25.2±0.44%).
SC–
Sd–
St1+
St2–
Sg+
увеличение ×40, м.о. – 50 мкм
Bcl-2
Показатели
антиапоптоза
превалируют в
половых клетках у
мужчин 22 – 35 лет
(43.2±0.44%) и
практически
исчезает при
идиопатическом
бесплодии
(1.0±0.1%)
увеличение ×100, м.о. – 10 мкм
увеличение ×40, м.о. – 50 мкм
Sd–
Md–
SC–
Md–
Sg–
Sg+
LC+
St1+
SC–
St2–
Sz–
увеличение ×40, м.о. – 50 мкм
увеличение ×40, м.о. – 50 мкм
Sg+
SC–
St1+
SC+
St2+
увеличение ×100, м.о. – 10 мкм
23
SCO-s; увеличение ×100, м.о. – 10 мкм
ФАКТОРЫ ДИФФЕРЕНЦИРОВКИ (МУЖСКИХ ПОЛОВЫХ КЛЕТОК)
PLAP
Один из
факторов
эмбриональной
дифференцировки
в нормальном
сперматогенезе
не обнаружен.
При бесплодии
он составляет
10.2±0.13%
среди
сохранившихся
сперматогоний
CD117
У молодых
мужчин в норме
показатели
фактора
Md–
St2–
Sg+
Sd–
Sg–
увеличение ×40, м.о. – 50 мкм
увеличение ×40, м.о. – 50 мкм
St1+
LC+
Sg–
SC–
дифференцировки
преобладают в
сперматогониях,
первичных
сперматоцитах, а
при бесплодии
отсутствуют
Sg–
St2–
Md–
увеличение ×100, м.о. – 10 мкм
увеличение ×100, м.о. – 10 мкм
ФАКТОР РОСТА
IGF-I
При бесплодии
отмечается
слабое
окрашивание в
сперматогониях
(7.0±0.22%) по
сравнению с
таковой
возрастной
группой в норме
(62.0±0.33%)
Sg+
Sg+
St1+
увеличение ×100, м.о. – 10 мкм
увеличение ×100, м.о. – 10 мкм
Семенные канальцы, 22 – 35 лет (слева – норма, справа – идиопатическое бесплодие).
Иммунногистохимическая реакция с антителами к белкам, которые указаны в левом
столбике, докрашивание – гематоксилином. Sg – сперматогонии, St1 – первичные
сперматоциты, St2 – вторичные сперматоциты, Sd – сперматиды (круглые), Sz –
сперматозоиды, SC – клетки Сертоли, LC – клетки Лейдига, Md – миоидные клетки.
Фотографии (цветные), таблицы, графики и дополнительная информация по
диссертации «Морфологически анализ сперматогенеза – основа диагностики
мужского идиопатического бесплодия (иммуногистохимический аспект), а
также другие материалы располагаются в облачном хранилище данных (cloud
storage).
24
1/--страниц
Пожаловаться на содержимое документа