close

Вход

Забыли?

вход по аккаунту

?

Патент BY 13127

код для вставкиСкачать
ОПИСАНИЕ
ИЗОБРЕТЕНИЯ
К ПАТЕНТУ
РЕСПУБЛИКА БЕЛАРУСЬ
BY (11) 13127
(13) C1
(19)
(46) 2010.04.30
(12)
(51) МПК (2009)
C 12N 1/21
C 12N 9/10
НАЦИОНАЛЬНЫЙ ЦЕНТР
ИНТЕЛЛЕКТУАЛЬНОЙ
СОБСТВЕННОСТИ
ШТАММ БАКТЕРИЙ ESCHERICHIA COLI - ПРОДУЦЕНТ
ПУРИННУКЛЕОЗИДФОСФОРИЛАЗЫ
(54)
BY 13127 C1 2010.04.30
(21) Номер заявки: a 20080951
(22) 2008.07.17
(43) 2010.02.28
(71) Заявители: Государственное научное
учреждение "Институт микробиологии Национальной академии наук
Беларуси"; Государственное научное
учреждение "Институт генетики и
цитологии Национальной академии
наук Беларуси" (BY)
(72) Авторы: Квач Сергей Вячеславович;
Ерошевская Людмила Анатольевна;
Зинченко Анатолий Иванович; Шахбазов Антон Валерьевич; Картель
Николай Александрович (BY)
(73) Патентообладатели: Государственное
научное учреждение "Институт микробиологии Национальной академии наук
Беларуси"; Государственное научное
учреждение "Институт генетики и цитологии Национальной академии наук
Беларуси" (BY)
(56) LEE J. et al. Protein Expr. Purif. - 2001. V. 22. - No. 2 - P. 180-188.
RU 2239656 С2, 2004.
US 20030059870 А1.
JP 2003339384 A.
ДУДЧИК Н.В. Получение штаммов
Esherichia coli с повышенной продукцией нуклеозидфосфорилаз и их использование при синтезе нуклеозидов.
Автореф. дис. - Минск, 1992. - C. 7-14,
16, 19-20.
ТАРАН С.А. и др. Прикладная биохимия и микробиология, 2008. - Т. 44,
№ 2. - C. 181-186.
(57)
Штамм бактерий Escherichia coli БИМ В-452 - продуцент пуриннуклеозидфосфорилазы.
Изобретение относится к микробиологии и биотехнологии, в частности к генной инженерии, и решает задачу получения нового высокопродуктивного рекомбинантного бактериального штамма-продуцента пуриннуклеозидфосфорилазы (ПНФ).
ПНФ (КФ 2.4.2.1) катализирует фосфоролитическое расщепление молекулы пуриновых нуклеозидов (например, инозина) на пентозо-1-фосфат и пуриновое основание согласно реакции:
O
N
NH
O
OH
OH
O
N
N
НРO4
HO
OH
O
ПНФаза
2-
N
NH
OP32- +
HO
OH
N
H
N
.
BY 13127 C1 2010.04.30
Обратимый характер реакции позволяет ее использовать для синтеза фармакологически важных модифицированных нуклеозидов [1-5].
Известны штаммы бактерий, продуцирующие ПНФ: Escherichia coli БМТ-38, используемый для получения 3'-амино-2',3'-дидезоксигуанозина [6], Escherichia coli БМТ-3Д/1А,
используемый для получения рибавирина [7], Escherichia coli БМТ-2Д/1А, предназначенный для получения 2'-дезоксиаденозина [8], Escherichia coli БМ-21, используемый в способе получения 2-хлор-2'-дезоксиаденозина [9], Bacillus stearothermophilus ТН6-2, Bacillus
stearothermophilus P-21, Bacillus stearothermophilus P-23, предложенные для получения аденозина, 2'-дезоксиаденозина и 2',3'-дидезоксиаденозина [10].
Общим недостатком перечисленных штаммов является низкая продуктивность в отношении ПНФ, так как они получены стандартными методами микробиологической селекции и их клетки содержат одну копию гена, кодирующего ПНФ.
Известен рекомбинантный штамм бактерий Escherichia coli BL21(DE3)/pETPPHO1 продуцент ПНФ [11]. Удельная активность ПНФ после разрушения клеток этого штамма
ультразвуком составляет 72 ед./мг белка. За единицу активности принято количество фермента, расщепляющее 1 мкмоль инозина за 1 мин при 25 °С. Данные по продуктивности
штамма в отношении ПНФ (в ед. активности/мл культуральной жидкости) в работе не
приведены, и рассчитать их не представляется возможным.
Известен штамм бактерий Escherichia coli BL21(DE3)/pERPUPHO1, использующийся в
способе получения рекомбинантной ПНФ [12]. ПНФ накапливается в клетках этого
штамма в количестве 60-70 % от суммарного белка клеток. Данные по продуктивности
штамма в отношении ПНФ (в ед. активности/мл культуральной жидкости) в работе также
отсутствуют.
Известен рекомбинантный штамм бактерий Escherichia coli MG1655/pGM707, продуцирующий ПНФ в количестве 2400 ед./г сырых клеток [13]. За единицу активности принято количество фермента, расщепляющее 1 мкмоль инозина за 1 мин при 30 °С. Данные по
продуктивности штамма MG1655/pGM707 в отношении ПНФ отсутствуют.
Из известных штаммов-продуцентов ПНФ наиболее близким по активности к предлагаемому является штамм Escherichia coli HS533/pSE380 (прототип) [14]. Удельная активность фермента в лизате клеток составляет 18 ед./мг белка. За единицу активности
принято количество фермента, расщепляющее 1 мкмоль инозина за 1 мин при 25 °С.
Штамм-прототип получен трансформацией Escherichia coli HS533 рекомбинантной плазмидой pSE380, в которую встроен ген deoD, ответственный за синтез ПНФ. Ген deoD, кодирующий ПНФ, изолировали с помощью ПЦР из ДНК фага λ, несущей фрагмент хромосомы
Escherichia coli с геном deoD.
Недостатком штамма-прототипа является сравнительно невысокая продуктивность в
отношении ПНФ, составляющая 14290 ед./л культуральной жидкости.
Настоящее изобретение решает задачу получения штамма Escherichia coli БМ-Д6 - более продуктивного бактериального штамма-продуцента ПНФ.
Источником структурного гена deoD, кодирующего аминокислотную последовательность ПНФ, служила хромосомная ДНК регуляторного мутанта Escherichia coli БМТ-4Д/1А
[15], характеризующегося дерепрессированным синтезом ПНФ. ДНК выделяли с помощью фенол-хлороформного метода с дополнительной очисткой при помощи цетавлона
[16]. Ген deoD синтезировали с помощью ПЦР, используя высокоточную Pfu-полимеразу
и синтетические олигонуклеотидные праймеры: GGAATTCATATGGCTACCCCACACATTAA
и CGGAATTCTATTACTCTTTATCGCCCAGCA. Продукты амплификации разделяли путем электрофореза в 1 %-ном агарозном геле. Продукт, соответствующий гену deoD, выделяли и лигировали в вектор рЕТ24b + (Novagen, США), рестрицированный по NdeI- и
EcoRI-сайтам и обработанный щелочной фосфатазой.
Полученной лигазной смесью трансформировали компетентные клетки Escherichia coli
DH5α, полученные стандартным кальциевым методом [Sambrook-1989], с последующим
высевом на плотную питательную среду LB (1 % триптон, 0,5 % дрожжевой экстракт,
2
BY 13127 C1 2010.04.30
1 % NaCl), содержащую канамицин в концентрации 100 мкг/мл. Каждую из пяти выросших одиночных колоний перенесли в колбы, содержащие 25 мл среды LB с канамицином, и
культивировали 12 ч. Из полученных биомасс стандартным щелочным методом [16] выделили плазмиды, которые проанализировали с использованием рестриктаз NdeI + EcoRI,
EcoRV + PstI, BamHI + HindIII и EcoRI. В результате была получена плазмида (названная
рЕТ_БМ-Д6), несущая ген deoD в правильной ориентации. Путем последующей трансформации плазмидой рЕТ_БМ-Д6 клеток Escherichia coli BL21(DE3) был получен рекомбинантный штамм Escherichia coli БМ-Д6 - суперпродуцент ПНФ.
Штамм-продуцент Escherichia coli БМ-Д6 отличается от штамма-реципиента BL21(DE3)
наличием нескольких копий рекомбинантной плазмиды рЕТ24b+, в которую встроен ген
deoD, ответственный за синтез гомологичной ПНФ. В качестве генетического маркера эта
плазмида содержит ген kan, придающий клеткам, трансформированным этой плазмидой,
устойчивость к канамицину.
Клетки Escherichia coli БМ-Д6 проявляют способность к суперпродукции ПНФ, которая, судя по электрофоретическому анализу в полиакриламидном геле, накапливается в
клетках в количестве более 70 % от суммарного водорастворимого белка.
Штамм депонирован в Белорусской коллекции непатогенных микроорганизмов ГНУ
"Институт микробиологии НАН Беларуси" под коллекционным номером БИМ В-452 Д и
характеризуется следующими свойствами.
Генотип.
F--, dcm, ompT, hsdS(rB-mB-), gal, (LambdaDE3) [16]. Клетки содержат плазмиду
pET24b+ со встроенным геном deoD, кодирующим ПНФ, и геном kan, детерминирующим
устойчивость клеток к канамицину.
Морфологические признаки.
Клетки - прямые палочки размером (1,1-1,5)×(2,0-6,0) мкм; подвижные, перитрихальное жгутикование; грамотрицательные.
На МПА и агаризованной среде Адамса (30 °С, 3 сут) колонии гладкие, слабо выпуклые, легко сливающиеся. Цвет колоний желтый. Поверхность блестящая, рельеф однородный. Края колоний слегка волнистые.
Культуральные признаки и физиолого-биохимические свойства.
Растет на простых питательных средах, содержащих канамицин в количестве 25100 мкг/мл.
Диапазон температуры роста бактерий - 8-40 °С с оптимумом - 37 °С. pH-оптимум
роста находится в зоне 7,2-7,4. Факультативный анаэроб.
Клетки Escherichia coli БМ-Д6 могут в качестве единственного источника углерода
использовать ацетат, но не цитрат. Глюкоза и другие углеводы сбраживаются с образованием пирувата, который затем превращается в молочную, уксусную и муравьиную кислоты. Индолположительны, не образуют H2S на железо-сахарной среде, не сбраживают
лактозу и малонат, не гидролизуют желатин.
На бульоне Хоттингера к 24 ч (30 °С) рост бактерий выражен в виде легкого помутнения. На дне пробирок образуется комковатый осадок, который полностью взмучивается
при встряхивании (S-форма).
Клетки проявляют устойчивость к канамицину (до 200 мкг/мл).
Содержание Г + Ц в составе ДНК 56,5 ± 0,5 мол. % (определено оптическим методом).
Клетки Escherichia coli БМ-Д6 сохраняют жизнеспособность не менее полугода при
хранении в холодильнике (4-6 °С) на полноценной агаризованной среде (мясо-пептонный
бульон, среда Хоттингера), содержащей канамицин (100 мкг/мл), под слоем вазелинового
масла, а также в лиофилизированном (криопротектор - 10 %-ное обезжиренное молоко)
состоянии.
Клетки Escherichia coli БМ-Д6 после разрушения обладают способностью катализировать
обратимый фосфоролиз пуриновых нуклеозидов. Активность клеток, измеренная в реакции фосфоролиза инозина, составляет 1800 ед./г или 36000 ед./л культуральной жидкости.
3
BY 13127 C1 2010.04.30
Содержание ПНФ в клетках штамма Escherichia coli БМ-Д6 составляет не менее 70 %
от суммарного содержания водорастворимого белка, и фермент после разрушения клеток,
например, ультразвуком может быть использован без дополнительной очистки или очищен до гомогенного состояния стандартными методами.
Для культивирования Escherichia coli БМ-Д6 с целью получения ПНФ применяют питательную среду LB (pH 7,0), приготовленную на дистиллированной воде, следующего
состава ( %):
триптон ("Sigma", США)
1,0
дрожжевой экстракт ("Sigma", США)
0,5
NaCl
1,0
канамицин
100 мкг/мл.
Для наработки ПНФ проводят культивирование клеток Escherichia coli БМ-Д6 на LB-среде, содержащей 100 мкг/мл канамицина, до оптической плотности 0,6 (λ = 600 нм), затем
индуцируют синтез белка путем внесения изопропил-β-D-тиогалактопиранозида (ИПТГ)
до концентрации 1 мМ и продолжают культивирование в течение последующих 5 ч.
Изменение биомассы бактерий контролируют турбодиметрически (λ = 600 нм), используя соответствующую калибровочную кривую. По окончании культивирования клетки осаждают центрифугированием при 7000 g в течение 10 мин, дважды отмывают от
питательной среды с помощью 0,15 М NaCl и разрушают ультразвуком.
Активность ПНФ в ультразвуковом лизате клеток определяют по скорости фосфоролиза
инозина. Стандартная реакционная смесь (1 мл) содержит (мМ): инозин - 30, К-фосфатный буфер (pH 7,5) - 50 и 0,1 мл ультразвукового лизата клеток с концентрацией белка
0,02 мг/мл. Смесь инкубируют при 25 °С при перемешивании на магнитной мешалке. Ход
реакции контролируют с помощью тонкослойной хроматографии в системе хлороформизопропанол-25 %-ный аммиак (10 : 10 : 1). За единицу активности фермента принимают
такое его количество, которое обеспечивает фосфоролиз инозина в количестве 1 мкмоль
за 1 мин в указанных выше условиях реакции.
Активность штамма Escherichia coli БМ-Д6 в сравнении с другими штаммами микроорганизмов представлена в таблице.
Сравнение активности предлагаемого и лучших
из известных штаммов микроорганизмов
Штаммы
Escherichia coli БМ-Д6
Escherichia coli HS533/pSE380
Escherichia coli MG1655/pGM707
Escherichia coli
BL21(DE3)/pERPUPHO1
Escherichia coli БМ-11
Выход ферментного белка
от суммарного
белка клетки, %
Активность ПНФ
ед./л кульед./г
туральной
клеток
жидкости
Источник
информации
> 70
1800
36000
Предлагаемое
решение
-
1265
2400
14290
-
[14]
[13]
60-70
-
-
[12]
<5
75
750
[17]
Escherichia coli БМТ-4Д/1А
<5
90
1350
Получено авторами предлагаемого решения
Ervinia herbicola ЦМПМ B-3275
Enterobacter amnigenus БИМ B-245
Escherichia coli БМТ-38
Escherichia coli БМ-21
Escherichia coli БМТ-3Д/1А
- данные отсутствуют
<5
<5
<5
<5
<5
50
32
84
80
69
480
420
1100
700
680
-"-"-"-"-"-
4
BY 13127 C1 2010.04.30
Из данных таблицы следует, что активность штамма Escherichia coli БМ-Д6 в отношении ПНФ, выраженная в ед./мл культуральной жидкости (продуктивность штамма), значительно выше любого из известных штаммов-продуцентов этого фермента.
Предлагаемый штамм получен впервые и никогда ранее не использовался для получения ПНФ.
Изобретение иллюстрируется следующими примерами конкретного выполнения.
Пример 1.
Культивирование Escherichia coli БМ-Д6 в оптимальных условиях.
Культивирование Escherichia coli БМ-Д6 проводят в колбе Эрленмейера объемом
250 мл на термостатируемой биологической качалке с частотой колебания платформы
170-190 об./мин при температуре 37 °С. Питательная среда (50 мл) для выращивания
приготовляется на дистиллированной воде и имеет следующий состав ( %): триптон - 1,0;
дрожжевой экстракт - 0,5; NaCl - 1,0 (pH 7,0). Стерилизацию среды осуществляют горячим паром под давлением в режиме 0,5 атм, 15 мин. После стерилизации в среду вносят
канамицин до концентрации 100 мкг/мл.
В процессе культивирования проводят измерение оптической плотности культуры при
λ = 600 нм. При достижении оптической плотности 0,6-1 в среду вносится стерильный
ИПТГ до конечной концентрации 1 мМ и культивирование продолжается в течение последующих 5 ч.
По окончании выращивания клетки осаждают центрифугированием при 7000 g в течение 10 мин, дважды отмывают от питательной среды 0,15 М раствором NaCl и разрушают
ультразвуком. Для этого клетки (1 г) суспендируют в 50 мл 10 мМ К-фосфатного буфера
(pH 7,0) и обрабатывают ультразвуком на дезинтеграторе микроорганизмов Sonifier-450
фирмы "Branson" (США) при мощности 0,2 кВт в течение 3-5 мин. Остатки разрушенных
клеток осаждают центрифугированием в течение 10 мин при 15000 g. Полученный супернатант используют в качестве источника ПНФ. Активность ПНФ, определенная, как описано выше, составляет 1800 ед./г клеток, или 36 000 ед./л культуральной жидкости.
Пример 2.
Использование ПНФ, продуцируемой штаммом Escherichia coli БМ-Д6, для синтеза
противовирусного нуклеозида - рибавирина.
ПНФ в количестве 18,0 ед., полученную, как в примере 1, вносят в реакционную смесь
(конечный объем 10,0 мл), содержащую 0,45 г гуанозина, 0,336 г 1,2,4-триазол-3-карбоксамида, 60 мМ К-фосфатный буфер (pH 7,0), инкубируют при 60 °С в течение 42 ч. В этих
условиях выход реакции достигает 88-90 мол. % в расчете на исходный 1,2,4-триазол-3карбоксамид.
Целевой продукт выделяют из реакционной смеси путем ионообменной хроматографии на колонке со смолой Dowex 1X8 в Сl--форме. Целевой продукт элюируют водой.
Элюат выпаривают досуха на роторном испарителе при 50 °С. Осадок промывают охлажденным ацетоном и высушивают под вакуумом. Получают 0,497 г хроматографически
чистого 1-β-D-рибофуранозил-1,2,4-триазол-3-карбоксамида (рибавирина). Таким образом, выход изолированного целевого продукта в расчете на исходный 1,2,4-триазол-3карбоксамид составляет 68 мол. %.
Структура целевого продукта подтверждена сравнением его хроматографической подвижности, а также УФ-спектра с соответствующими характеристиками заведомо известного образца. В частности, при хроматографировании на тонкослойных пластинках "Silufol
UV-254" фирмы Serva (Германия) в системе растворителей изопропанол-хлороформ-25 %
аммиак (10 : 5 : 2) и н-бутанол-25 % аммиак (7 : 2) подвижность целевого продукта совпадала с Rf заведомо известного образца рибавирина.
Т.пл. целевого продукта 176-178 °С; лит. данные [18] - 174 °С.
УФ-спектр (p 7), λ нм (ε) : 207 макс (11600).
5
BY 13127 C1 2010.04.30
Таким образом, получен штамм, обладающий по сравнению с известным штаммомпродуцентом ПНФ значительно более высокой продуктивностью (36000 ед.акт./л культуральной жидкости против 14290 ед.акт./л культуральной жидкости).
Получение нового доступного штамма обеспечивает расширение ассортимента штаммов-продуцентов ПНФ.
Источники информации:
1. Krenitsky T.A., Koszalka G.W., Tuttle J.V. Purine nucleoside synthesis, an efficient
method employing nucleoside phosphorylase // Biochemistry. - 1981. - Vol. 20. - No. 12. P. 3615-3621.
2. RU 2230118 C2, 2004.
3. Lewkowicz E.S., Iribarren A.M. Nucleoside phosphorylases // Curr. Organic Chem. 2006. - Vol. 10. - No. 11. - P. 197-1215.
4. Mikhailopulo LA. Biotechnology of nucleic acid constituents - state of the art and perspectives // Curr. Organic Chem. - 2007. - Vol. 11. - No. 4. - P. 317-335.
5. BY 9975 Cl, 08.08.2007.
6. А.с. СССР 1500675 Al, МПК С 12 P 19/40, 1989.
7. А.с. СССР 1661209 А1, МПК С 12 N 1/20, 1991.
8. А.с. СССР 1705347 А1, МПК С 12 Р 19/40, 1992.
9. BY 5602 С1, 2003.
10. US 5384251, 1995.
11. Esipov R.S., Gurevich A.I., Chuvikovsky D.V., Chupova L.A., Muravyova T.I., Miroshnikov A.I. Overexpression of Escherichia coli genes encoding nucleoside phosphorylases in the
pET/Bl21(DE3) system yields active recombinant enzymes // Protein Expr. Purif. - 2002. Vol. 24. - No. 1. - P. 56-60.
12. RU 2179188 C2, 2002.
13. US 6911341, 2005.
14. Lee J., Filosa S., Bonvin J., Guyon S., Aponte R.A., Turnbull J.L. Expression, purification,
and characterization of recombinant purine nucleoside phosphorylase from Escherichia coli //
Protein Expr. Purif. - 2001. - Vol. 22. - P. 180-188.
15. Barai V.N., Zinchenko A.I., Eroshevskaya L.A., Kalinichenko E.N., Kulak T.I., Mikhailopulo I.A. An universal biocatalyst for the preparation of base- and sugarmodified nucleosides via an enzymatic transglycosylation // Helvetica Chim. Acta. 2002. - Vol. 85. - No. 7. P. 1901-1908.
16. Sambrook J., Frittsch E., Maniatis L. Molecular cloning: a laboratory manual / 2-nd ed.New York: Cold Spring Harbor Laboratory Press, 1989. - 2222 p.
17. Зинченко А.И., Ерошевская Л.А., Барай В.Н., Михайлопуло И.А. Субстратная специфичность уридин- и пуриннуклеозидфосфорилаз в составе целых клеток Escherichia coli //
Биополимеры и клетка. - 1988. - Т. 4. - № 6. - С. 298-302.
18. Witkowski J.T., Robins R.K., Sidwell R.W., Simon L.N. Desing, synthesis and broad
spectrum antiviral activity of l-β-D-ribofuranosyl-l,2,4-triazole-3-carboxamide and related nucleosides // J. Med. Chem. - 1972. - Vol. 15. - No. 11. - P. 1150-1154.
Национальный центр интеллектуальной собственности.
220034, г. Минск, ул. Козлова, 20.
6
Документ
Категория
Без категории
Просмотров
0
Размер файла
114 Кб
Теги
13127, патент
1/--страниц
Пожаловаться на содержимое документа