close

Вход

Забыли?

вход по аккаунту

?

Development and evaluation of microwave-accelerated and metal-enhanced fluorescence assays for detection of bacterial pathogens

код для вставкиСкачать
APPROVAL SHEET
Title of Dissertation: Development and Evaluation of Microwave-Accelerated
and Metal-Enhanced Fluorescence Assays for Detection of
Bacterial Pathogens
Name of Candidate: Johan Humberto Melendez
Doctor of Philosophy, 2016
Dissertation and Abstract Approved: _________________________
Chris D. Geddes, Ph.D.
Professor
Chemistry and Biochemistry
Date Approved: ________________
Curriculum Vitae
Name:
Johan Humberto Melendez
Degree and date to be conferred:
Ph.D., 2016.
Secondary education:
Dickinson High School,
Jersey City, New Jersey,
Graduated June 1994.
Collegiate institutions attended:
University of Maryland Baltimore County,
Ph.D., Chemistry, 2016.
Rutgers University
M.S., Microbiology and Molecular Genetics, 2005.
Rutgers University
B.A., Biological Sciences, 1999.
Professional Publications:
Melendez,.; J. H.; Santaus, T. M.; Brinsley, G.; Kiang, D.; Mali, B.; Hardick,
J.; Gaydos, C. A.; Geddes, C. D. Microwave-accelerated method for ultra-rapid
extraction of Neisseria gonorrhoeae DNA for downstream detection. Anal Biochem.
2016, 510, 33-40.
Thurman, A.; Jacot, T.; Melendez, J.; Kimble, T.; Snead, M.; Jamshidi, R.;
Wheeless, A.; Archer, D. F.; Doncel, G. F.; Mauck, C. Assessment of the vaginal
residence time of biomarkers of semen exposure. Contraception. 2016. In press.
Boyd, M. A.; Tennant, S. M.; Melendez,, J. H.; Toema, D.; Galen, J. E.;
Geddes, C. D.; Levine, M. M. Adaptation of red blood cell lysis represents a
fundamental breakthrough that improves the sensitivity of Salmonella detection in
blood. J Appl Microbiol. 2015, 118, 1199-1209.
Snead, M. C.; Kourtis, A. P.; Melendez, J. H.; Black, C. M.; Mauck, C. K.;
Penman-Aguilar, A.; Chaney, D. M.; Gallo, M. F.; Jamieson, D. J.; Macaluso, M.;
Doncel, G. F. Does tenofovir gel or do other microbicide products affect detection of
biomarkers of semen exposure in vitro? Contraception. 2014, 90, 136-41.
Rosenbaum, J. E.; Zenilman, J.; Melendez, J.; Rose, E.; Wingood, G.;
Diclemente, R. Telling truth from Ys: an evaluation of whether the accuracy of selfreported semen exposure assessed by a semen Y-chromosome biomarker predicts
pregnancy in a longitudinal cohort study of pregnancy. Sex Transm Infect. 2014, 90,
479-84.
Snead, M. C.; Melendez, J. H.; Kourtis, A. P.; Chaney, D. M.; Brown, T.
M.; Black, C. M.; et al, Effect of lubricant and a vaginal spermicide gel on the
detection of prostate specific antigen, a biomarker of semen exposure, using a
quantitative (Abbott ARCHITECT) assay. Contraception. 2014, 89, 134-8.
Jamshidi, R.; Penman-Aguilar, A.; Wiener, J.; Gallo, M. F.; Zenilman, J. M.;
Melendez, J. H.; Snead, M.; Black, C. M.; Jamieson, D. J.; Macaluso, M. Detection
of two biological markers of intercourse: prostate-specific antigen and -chromosomal
DNA. Contraception. 2013, 88,749-57.
Melendez, J. H.; Huppert, J.; Jett-Goheen, M.; Hesse, E.; Quinn, N.; Gaydos
C. A.; Geddes, C. D. Blinded Evaluation of the Microwave-Accelerated MetalEnhanced Fluorescence (MAMEF) Ultra-Rapid and Sensitive Chlamydia trachomatis
Test Using Clinical Samples. J Clin Micro. 2013, 51, 2913-20.
Snead, M. C.; Kourtis, A. P.; Black, C. M.; Mauck, C. K.; Brown, T. M.;
Penman-Aguilar, A.; Melendez, J. H.; Gallo, M. F.; Jamieson, D. J.; Macaluso, M.
Effect of topical vaginal products on the detection of prostate-specific antigen.; a
biomarker of semen exposure, using ABA cards. Contraception. 2013, 88, 382-6.
McLaughlin, S. E.; Cheng, H.; Ghanem, K. G.; Yang, Z.; Melendez, J.;
Zenilman, J.; Griffiss, J. M. Urethral exudates of men with Neisseria gonorrhoeae
infections select a restricted lipooligosaccharide phenotype during transmission. J
Infect Dis. 2012, 206, 1227-32.
Johnson, K. E.; Kiyatkin, D. E.; An, A. T.; Riedel, S.; Melendez, J.;
Zenilman, J. M. PCR offers no advantage over culture for microbiologic diagnosis in
cellulitis. Infection. 2012, 40, 537-41.
Han, A.; Zenilman, J. M.; Melendez, J. H.; Shirtliff, M. E.; Agostinho, A.;
James, G.; Stewart, P. S.; Mongodin, E. F.; Rao, Dhana.; Rickard, A. H.; Lazarus
G. S. The importance of a multi-faceted approach to characterizing the microbial
flora of chronic wounds. Wound Repair Regen. 2011, 19, 532-41.
Mehta, S. D.; Maclean, I.; Ndinya-Achola, J. O.; Moses , S.; Martin, I.;
Ronald, A.; Agunda, L.; Murugu, R.; Bailey, R. C.; Melendez, J. H.; Zenilman, J. M.
Emergence of Quinolone-resistance and cephalosporin MIC Creep in Neisseria
gonorrhoeae in a cohort of young men in Kisumu, Kenya: 2002 - 2009. Antimicrob
Agents Chemother. 2011, 55, 3882-8.
Brotman, R. M.; Melendez, J. H.; Ghanem, K. G. A case control study of
anovaginal distance and bacterial vaginosis. I J STD & AIDS. 2011, 22, 231-3.
Reidel, S.; Melendez, J. H.; An, A. T.; Rosenbaum, J. E.; Zenilman, J. M.
Procalcitonin as a Marker for the Detection of Bacteremia and Sepsis in the
Emergency Department. Am J Clin Pathol. 2011,135, 182-9.
Price, L. B.; Liu, C. M.; Frankel, Y. M.; Melendez, J. H.; Aziz, M.;
Buchhagen, J.; Contente-Cuomo, T.; Engelthaler, D. M.; Keim, P. S.; Ravel, J.;
Lazarus, G. S.; Zenilman, J. M. Macroscale spatial variation in chronic wound
microbiota: A cross-sectional study. Wound Repair Regen. 2011, 19, 80-8.
Melendez, J. H.; Frankel, Y. M.; An, A. T.; Williams, L.; Price LB.; Wang,
N. Y.; Lazarus, G. S.; Zenilman, J. M. Real-Time PCR Assays Compared to
Culture-Based Approaches for Identification of Aerobic Bacteria in Chronic
Wounds. Clinical Microbiology and Infection. 2010, 16, 1762-9.
Brotman, R. M.; Melendez, J. H.; Smith ,T. D.; Galai, N.; Zenilman, J. M.
Effect of Menses on Clearance of Y-Chromosome in Vaginal Fluid: Implications for
a Biomarker of Recent Sexual Activity. Sex Transm Dis. 2010, 37, 1-4.
Frankel, Y. M.; Melendez, J. H.; Price, L. B.; Wang, N. Y.; Zenilman, J. M.;
Lazarus, G. S. Defining wound microbial flora: Molecular microbiology opening
new horizons. Arch Dermatol. 2009, 145, 1193-5.
Price, L. B.; Liu, C. M.; Melendez, J. H.; Frankel, Y. M.; Engelthaler, D.;
Aziz, M.; Bower, J.; Rattray, R.; Ravel, J.; Kingsley, C.; Keim, P. S.; Lazarus.; G. S.;
Zenilman, J. M. Community analysis of chronic wound bacteria using 16S rRNA
gene-based pyrosequencing: Impact of Diabetes and antibiotics on chronic wound
microbiota. PLoS ONE 2009; 4(7): e6462.doi:10.1371/journal.pone.0006462
Rose, E.; Diclemente, R. J.; Wingood, G. M.; McDermott, Sales, J.; Latham,
T. P.; Crosby, R. A.; Zenilman, J. M.; Melendez, J. H.; Hardin, J. The Validity of
$GROHVFHQWV¶6HOI-Reported Condom Use. Arch Podiatry Adoles Med. 2009, 163, 614.
Mark, H. D.; Nanda, J.; Roberts, J.; Rompalo, A.; Melendez, J. H.; Zenilman,
J. M. Serologic Screening for the Herpes Simplex Virus Among University Students:
A Pilot Study. Journal of American College Health. 2008, 57, 291-296.
Yang, S.; Ramachandran, P.; Hardick, A.; Hsieh, Y. H.; Quianzon, C.;
Kuroki, M.; Hardick, J.; Kecojevic, A.; Abeygunawardena, A.; Zenilman, J.;
Melendez, J. H.; Doshi, V.; Gaydos, C.; Rothman, R. Rapid PCR-based Diagnosis of
Septic Arthritis by Early Gram-Type Classification and Pathogen Identification. J
Clin Microbiol. 2008, 46, 1386-90.
Mark, H. D.; Nanda, J.; Roberts, J.; Rompalo, A.; Melendez, J. H.;
Zenilman, J. M. Performance of Focus ELISA Tests for HSV-1 and HSV-2
Antibodies Among University Students with No History of Genital Herpes. Sex
Transm Dis. 2007, 34, 681-685.
Ghanem, K. G.; Melendez, J. H.; McNeil-Solis, C.; Giles, J. A.; Yuenger, J.
D.; Smith, T. D.; Zenilman, J. M. Condom Use and Vaginal Y-chromosome
Detection: The Specificity of a Potential Biomarker. Sex Transm Dis. 2007, 34, 620623.
Melendez, J. H.; Giles, J. A.; Yuenger, J. D.; Smith, T. D.; Ghanem, K. G.;
Reich, K.; Zenilman, J. M. Detection and Quantification of Y Chromosomal
Sequences by Real-Time PCR using the LightCycler® System. Sex Transm Dis.
2007, 34, 617- 619.
Professional positions held:
Johns Hopkins University ± Department of Medicine
Postdoctoral Fellow
Rangos Building
Baltimore, MD 21205
Present
UMBC ± Department of Chemistry and Biochemistry
Graduate Assistant
2011- 2016
Johns Hopkins University ± Department of Medicine
Laboratory Manager
2005 ± 2011
Rutgers University ± Department of Genetics
Graduate Assistant
2002 ± 2004
Rutgers University ± Division of Life Sciences
Teaching Assistant
2002 ± 2003
Rutgers University ± Division of Life Sciences
Laboratory Operations Coordinator
2000 ± 2002
Rutgers University Cell & DNA Repository
Senior Laboratory Technician
1999 ± 2000
ABSTRACT
Title of Document:
Development and Evaluation of MicrowaveAccelerated and Metal-Enhanced Fluorescence
Assays for Detection of Bacterial Pathogens.
Johan Humberto Melendez, Ph.D., 2016
Directed By:
Chris D. Geddes, Ph.D.
Professor of Chemistry and Biochemistry
Director of Institute of Fluorescence
Infectious diseases with high mortality rate or serious complications require
rapid and accurate diagnosis.
In order to develop rapid and sensitive assays for
detection of bacterial pathogens, microwave-accelerated processes have been
investigated to extract and fragment the bacterial DNA, followed by MicrowaveAccelerated Metal-Enhanced Fluorescence (MAMEF)-based DNA detection.
MAMEF combines the benefits of low-power microwave-acceleration (MA) with
those of Metal-Enhanced Fluorescence (MEF) to aid in the development of ultra-fast
and sensitive bioassays.
The first part of this research explored the use of microwaves and highlyfocused microwaves to rapidly extract and fragment DNA.
Two different, but
complementary approaches were investigated ± the efficiency of microwaves for
microbial lysing in comparison to conventional heating, and the effect of microwavefocusing metal structures on microbial lysing and DNA isolation/fragmentation.
Using microwave irradiation, Neisseria gonorrhoeae was lysed and the DNA
fragmented in as little as 30 seconds. Furthermore, the incorporation of microwavefocusing bowtie structures during the irradiation process enhanced the rate of cellular
lysis and DNA fragmentation. The conditions used for the lysis of N. gonorrhoeae
cannot be used to lyse other bacteria with different cell wall structure, such as the
gram-positive Listeria monocytogenes.
The second part of the research was devoted to the development and testing of
MAMEF assays for the detection of the sexually transmitted infections chlamydia and
gonorrhea and Salmonella infections. The chlamydia MAMEF assay which targets
the cryptic plasmid proved to be more sensitive than the assay targeting the 16S
rRNA gene.
Additionally, both assays proved to have moderate sensitivity for
detection of chlamydia directly from vaginal swabs. The gonorrhea MAMEF assay
showed low sensitivity, and a new assay targeting a multi-copy gene has been
developed. MAMEF-based detection of Salmonella from white blood cells-spiked
samples and stool was also achieved. However, further work is necessary to develop
a robust and reproducible assay.
Lastly, proof-of-concept experiments were carried out to determine if a
surface plasmon resonance (SPR) approach can be used to detect genetic
modifications associated with antimicrobial resistance in gonorrhea. No reproducible
results were obtained using a portable SPR instrument.
In summary, the use of microwave-accelerated processes for detection of
bacterial pathogens was demonstrated including the clinical validation of the
chlamydia MAMEF assay.
DEVELOPMENT AND EVALUATION OF MICROWAVE-ACCELERATED
AND METAL-ENHANCED FLUORESCENCE ASSAYS FOR DETECTION OF
BACTERIAL PATHOGENS.
By
Johan Humberto Melendez
Dissertation submitted to the Faculty of the Graduate School of the
University of Maryland, Baltimore County, in partial fulfillment
of the requirements for the degree of
Doctor of Philosophy
2016
ProQuest Number: 10245857
All rights reserved
INFORMATION TO ALL USERS
The quality of this reproduction is dependent upon the quality of the copy submitted.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if material had to be removed,
a note will indicate the deletion.
ProQuest 10245857
Published by ProQuest LLC (2017 ). Copyright of the Dissertation is held by the Author.
All rights reserved.
This work is protected against unauthorized copying under Title 17, United States Code
Microform Edition © ProQuest LLC.
ProQuest LLC.
789 East Eisenhower Parkway
P.O. Box 1346
Ann Arbor, MI 48106 - 1346
© Copyright by
Johan Humberto Melendez
2016
Dedication
To my parents and Brian Wayne Smith,
without your love and support I would not be who I am today.
ii
Acknowledgements
First, I would like to thank my advisor and mentor, Dr. Chris D. Geddes, for
his support and guidance, and for giving me the tools to fulfill one of my career goals.
To the members of my committee, Drs. Kelly, Seley-Radtke, White and Quinn, I
would like to say thank you for your helpful suggestions, comments, and for giving so
much of yourself to ensure that I was properly prepared to embark on the next chapter
of my life.
I will forever be grateful to my labmates and friends, Rachel Schmitz and
Tonya Santaus ± your support, guidance, and friendship helped me to navigate
through some difficult times. I would also like to extend my gratitude to past and
present members of the Institute of Fluorescence, especially the undergraduate
students who worked with me on this project ± Daniel Kiang, Gregory Brinsley and
Daniel Pierce.
I would also like to acknowledge Dr. Francine Essien who inspired me to
become a scientist. Without the support and guidance of Dr. Jonathan Zenilman, I
would not have accomplished this goal.
My success is not only my success, but that of my family who have always
supported my career ambitions and goals. To my mother and father ± thanks for the
love and support.
Lastly, I would like to acknowledge Brian W. Smith, who
embarked on this journey with me almost six years ago and always encouraged me to
reach for the stars. We made it.
iii
Table of Contents
Dedication .................................................................................................................... ii
Acknowledgements ..................................................................................................... ii
Table of Contents ....................................................................................................... iv
List of Tables ............................................................................................................. vii
List of Figures ........................................................................................................... viii
List of Abbreviations .................................................................................................. x
Chapter 1: Introduction and Motivation .................................................................. 1
1.1 Impact of Bacterial Infections on Human Health and Detection Methods ......... 1
1.1.1 Chlamydia and Gonorrhea ........................................................................... 2
1.1.2 Salmonella.................................................................................................... 3
1.2 Current Detection Methods ................................................................................. 4
1.2.1 Chlamydia and Gonorrhea ........................................................................... 4
1.2.2 Salmonella in Blood and Stool .................................................................... 5
1.3 DNA Isolation and Fragmentation ...................................................................... 6
1.3.1 Current Methods .......................................................................................... 6
1.3.2 Microwaves and Microwave-Based DNA Isolation/Fragmentation............ 7
1.4 Fluorescence and Surface Plasmon-Enhanced Spectroscopy ........................... 11
1.4.1 Fluorescence .............................................................................................. 11
1.4.2 Surface Plasmons ....................................................................................... 12
1.4.2.1 Metal-Enhanced Fluorescence (MEF) .................................................... 13
1.4.2.2 Surface Plasmon Resonance (SPR) ........................................................ 17
1.5 Microwave-Accelerated Metal-Enhanced Fluorescence (MAMEF) ................ 18
1.5.1 Basic Principles .......................................................................................... 18
1.5.2 Applications of MAMEF ........................................................................... 19
Chapter 2: Microwave-Accelerated Isolation and Fragmentation of DNA ........ 20
2.1 Conventional Heating vs. Microwaves for Microbial Cell Lysing ................... 20
2.1.1 Motivation .................................................................................................. 20
2.1.2 Experimental Details .................................................................................. 21
2.1.3 Results and Discussion .............................................................................. 25
2.1.4 Conclusions ................................................................................................ 29
2.2 Conventional Heating vs. Microwaves for DNA Isolation and Fragmentation 31
2.2.1 Motivation .................................................................................................. 31
2.2.2 Experimental Details .................................................................................. 31
2.2.3 Results and Discussion .............................................................................. 33
2.2.4 Conclusions ................................................................................................ 44
2.3 Microfluidic-Assisted Microwave-Accelerated Cell Lysing ............................ 45
2.3.1 Motivation .................................................................................................. 45
2.3.2 Experimental Details .................................................................................. 46
2.3.3 Results and Discussion .............................................................................. 50
2.3.4 Conclusions ................................................................................................ 53
Chapter 3: MAMEF-Based Detection of Chlamydia ............................................ 54
3.1 Development and Testing of MAMEF Assays for Chlamydia Trachomatis ... 54
3.1.1 Motivation .................................................................................................. 54
iv
3.1.2 Experimental Details .................................................................................. 54
3.1.3 Results and Discussion .............................................................................. 59
3.1.4 Conclusions ................................................................................................ 61
3.2 Evaluation of Chlamydia MAMEF Assays with Clinical Samples .................. 62
3.2.1 Motivation .................................................................................................. 62
3.2.2 Experimental Details .................................................................................. 62
3.2.3 Results and discussion ............................................................................... 66
3.2.4 Conclusions ................................................................................................ 70
Chapter 4: MAMEF-Based Detection of Gonorrhea ............................................ 71
4.1.1 Motivation .................................................................................................. 71
4.1.2 Experimental Details .................................................................................. 71
4.1.3 Results and Discussion .............................................................................. 74
4.1.4 Conclusions ................................................................................................ 77
Chapter 5: MAMEF-Based Detection of Salmonella in Various Biological
Matrices ..................................................................................................................... 78
Overview and Motivation ................................................................................... 78
5.1 Isolation, DNA extraction and Fragmentation of Salmonella from Blood ....... 80
5.1.1 Experimental Details .................................................................................. 80
5.1.2 Results, Discussion and Conclusions ......................................................... 81
5.2 MAMEF-Based Detection of Salmonella in Blood .......................................... 82
5.2.1 Experimental Details .................................................................................. 82
5.2.2 Results and Discussion .............................................................................. 86
5.2.3 Conclusions ................................................................................................ 91
5.3 MAMEF-Based Detection of Salmonella in Stool ........................................... 91
5.3.1 Overview and Experimental Details .......................................................... 91
5.3.2 Results and Discussion .............................................................................. 95
5.3.3 Conclusions ................................................................................................ 98
Chapter 6: PCR- and Surface Plasmon Resonance (SPR)-Based Detection of
Genetic Markers Associated with Antimicrobial Resistance in N. gonorrhoeae 99
Overview and Motivation ................................................................................... 99
6.1 Real-Time PCR-Based Detection of Markers Associated with Antimicrobial
Resistance in N. gonorrhoeae ............................................................................... 101
6.1.1 Experimental Details ................................................................................ 101
6.1.2 Results and Discussion ............................................................................ 104
6.1.3 Conclusions .............................................................................................. 107
6.2 SPR-Based Detection of Mutations Associated with Quinolone Resistance in N.
gonorrhoeae .......................................................................................................... 108
6.2.1 Motivation ................................................................................................ 108
6.2.2 Experimental Details ................................................................................ 109
6.2.3 Results and Discussion ............................................................................ 115
6.2.4 Conclusions .............................................................................................. 119
Chapter 7: Summary and Future Work .............................................................. 120
7.1 Summary of Dissertation ................................................................................ 120
7.2 Future Work .................................................................................................... 123
7.2.1 Microwave-based Cellular Lysing Future Work ..................................... 123
7.2.2 MAMEF-Based DNA Detection Future Work ........................................ 124
v
Appendices ............................................................................................................... 126
Bibliography ............................................................................................................ 129
vi
List of Tables
Table 1. Survival of Neisseria gonorrhoeae following mLFURZDYHLUUDGLDWLRQ«.......26
Table 2. Survival of Listeria monocytogenes following mLFURZDYHLUUDGLDWLRQ«.....28
Table 3. Survival of N. gonorrhoeae and L. monocytogenes as a function of
temperature following conventional heating««««««««««««««29
Table 4. Quantitative analysis of DNA IUDJPHQWDWLRQ«««««««««««43
Table 5. Survival rates of Neisseria gonorrhoeae following microwave irradiation
using a flow lysing chip«««««««««««««««««««««««51
Table 6. DNA probe sequences for MAMEF detecion of C. trachomatis««........56
Table 7. Specificity of the chlamydia MAMEF assays«««««««««««61
Table 8. Performance of the chlamydia MAMEF and buffers«««««««««7
Table 9. Comparison of chlamydia MAMEF assays vs. NAATs««««««««9
Table 10. DNA probe sequences for MAMEF detecion of gonorrhea««««««2
Table 11. Specificity of the porA-based gonorrhea MAMEF assay«««««««4
Table 12. Comparison of gonorrhea MAMEF assays vs. NAATs««««««5
Table 13. Specificity of MAMEF assays for detection of Salmonella species«««5
Table 14. Primer and probe sequences for real-time PCR analysis««««««4
Table 15. Detection of gonorrhea and resistance determinants by PCR«««««6
Table 16. Oligonucleotides for SPR-based mutation detection analysis....«..««11
vii
List of Figures
Figure 1. Interaction of microwaves with water mROHFXOHV««..««««««««9
Figure 2. Effect of microwave-focusing bowtie structures on simulated field intensity
distribution and water temperature change««««..««««««««««««
Figure 3. Schematic illustration of Metal-Enhanced Fluorescence (MEF)««««13
Figure 4. Plasmon resonance spectra of silver nanoparticles and florescence and
absorption spectra of a typical fluorophore«««««««...««««««««.16
Figure 5. Emission spectra of TAMRA enhanced by silver nanoparticles in
comparison to far-field emission««««««««««««««««««««16
Figure 6. Surface Plasmon Resonance (SPR)-based sensor««««««...«««17
Figure 7. Microwave-Accelerated Metal-Enhanced Fluorescence (MAMEF)-based
DNA detection««««««««««««««««««««««.«««««18
Figure 8. Experimental setup for the conventional heating «««««««««21
Figure 9. Microwaves-focusing bowtie structures and lysing chambers««««23
Figure 10. Household microwave fitted with a mounting device««.«««««24
Figure 11. DNA isolation and fragmentation of Neisseria gonorrhoeae and Listeria
monocytogenes by conventional KHDWLQJ«««««««««««««««««34
Figure 12. DNA fragmentation of N. gonorrhoeae by microwave irradiatioQ««35
Figure 13. Effect of bowtie structures on DNA fragmentation of N. gonorrhoeae«36
Figure 14. Distribution of bacterial suspensions in the lysing cKDPEHUV««......«37
Figure 15. Effect of bowtie structures on fragmentation of L. monocytogenes««39
Figure 16. Evaluation of the effect of osmosis on DNA isolation/fragmentation«40
Figure 17. Quantitative analysis of DNA fragmentation by microwaveV««««42
Figure 18. PCR-based detection of DNA following microwave irradiation«««44
Figure 19. Microfluidic-based lysing chip«««««...««««««««««47
Figure 20. Microfluidic-based microwave-assisted lysing setXS«««««««.49
Figure 21. Effect of microwave irradiation on bowtie structures«««...««««52
Figure 22. Microfluidic-based microwave-assisted DNA fragmentation«««««53
Figure 23 4XDQWD:HOOŒ SODWH IRU 0$0()-based chlamydia detection«««58
Figure 24. Optical reader for Metal-Enhanced Fluorescence (MEF) detection««9
Figure 25. Serial dilution plot of the CT cryptic plasmid-based MAMEF assay«60
Figure 26. Classification of chlamydia MAMEF assays results««««««««6
Figure 27. Serial dilution plot of the porA-based gonorrhea MAMEF assay«««6
Figure 28. Flow chart of procedures used for the MAMEF-based detection of
Salmonella in blood«««««««««««««««««««««««««3
Figure 29. Silver Island Films (SIFs) MAMEF detection surface«««««««6
Figure 30. Blinded MAMEF-based detection of Salmonella lysed in WBC«««7
Figure 31. MAMEF detection of Salmonella-spiked WBC on multiple SIFs«««7
Figure 32. MAMEF-based detection of target DNA tested on two wells of a 6,)«8
Figure 33. Effect of silver nanoparticle deposition methods on ME«««.. .««9
Figure 34. SIFs-coated slides generated using two deposition methodV«««««90
Figure 35. Flow chart of the procedures for detection of Salmonella LQVWRRO«««3
Figure 36. Detection of Salmonella from stool with the oriC-based assay««««6
Figure 37. Detection of S. enteriditis using the sdf-based MAMEF assay««««7
viii
Figure 38. Detection of S. typhimurium using the FliB-FliA-based assay««««7
Figure 39. Scheme for a SPR sensor using the Kretschmann configuration««10
Figure 40. Inner workings of the portable SPR unit««««««««««««2
Figure 41. SPR experimental instrumentation setup. «««««««««««4
Figure 42. SPR response following DNA attachment«««««««««««5
Figure 43. SPR response following the addition of complementary VHTXHQFH««6
Figure 44. SPR response following the addition of mutated sequences««««7
ix
List of Abbreviations
CT
DNA
DTT
GC
MAMEF
MEF
NAAT(s)
RT-PCR
POCT(s)
PPNG
QRDR
RBC
SIF(s)
TCEP
SP
SPR
STI(s)
WBC
Chlamydia trachomatis
Deoxyribonucleic acid
Dithiothreitol
Gonococcal (Neisseria gonorrhoeae)
Microwave-Accelerated Metal-Enhanced Fluorescence
Metal-Enhanced Fluorescence
Nucleic-acid amplification test(s)
Real-time polymerase chain reaction
Point-of-care test(s)
Penicillinase-producing
Quinolone-resistance determining region
Red blood cells
Silver island film(s)
Tris-2-carboxyethylphophine
Surface plasmon
Surface plasmon resonance
Sexually Transmitted Infection(s)
While blood cells
x
Chapter 1: Introduction and Motivation
1.1 Impact of Bacterial Infections on Human Health and Detection Methods
Overview
The human body is colonized with microbial ecosystems and alterations to
these microbial communities or to sterile sites can result in a variety of infections
with serious health complications.
Bacterial infections constitute a major cause of
morbidity and mortality, thus rapid and accurate diagnosis of the causative agent is a
critical step in the management of these illnesses. While molecular approaches based
on Polymerase Chain Reaction (PCR), such as Nucleic-Acid Amplification Tests
(NAATs), have revolutionized the field of diagnostics, the technology is still not
available for point-of-care (POC) applications due to inherent limitations of this
approach, such as speed.
Microwave-Accelerated Metal-Enhanced Fluorescence
(MAMEF) has shown promise as a POC technology by incorporating the benefits of
enhanced-fluorescence signatures with low-power microwaves for acceleration of
biological processes. The purpose of this research was to develop a microwaveaccelerated process for the isolation and fragmentation of DNA, followed by the
optimization of the MAMEF technology platform for use in clinical testing, with
specific targets of chlamydia, gonorrhea and Salmonella infections.
The first part of this study describes a systematic investigation of microwavebased DNA extraction and fragmentation and a comparison to conventional heating
(Chapter 2). The second part describes the development and testing of MAMEFbased assays for detection of chlamydia, gonorrhea and Salmonella (Chapters 3 ± 5).
Additionally, PCR analysis and surface plasmon resonance (SPR) proof-of-concept
1
experiments were carried out to determine the feasibility of using SPR for the
detection of antimicrobial resistance genetic markers in gonorrhea (Chapter 6).
1.1.1 Chlamydia and Gonorrhea
Chlamydia (CT) and gonorrhea (GC) caused by Chlamydia trachomatis and
Neisseria gonorrhoeae, respectively, are the two most prevalent bacterial sexually
transmitted infections (STIs) worldwide and co-infection with these two STIs is
common.1 In 2014, there were 1,441,789 cases of CT and 350,062 cases of GC
reported to the Centers for Disease Control and Prevention (CDC).2 Despite the high
rate of CT and GC infections in the United States, the majority of infections occur in
Africa and South-East Asia where access to testing and treatment is limited.3 Because
a large proportion of patients with chlamydia experience no symptoms, the disease
often goes undiagnosed and untreated, resulting in serious long-term complications,
including pelvic inflammatory disease (PID), cervicitis, ectopic pregnancy, and
infertility.4 While the complications associated with gonorrhea infection are similar
to those of chlamydia, the highest priority is the rapid and accurate diagnosis of GC to
prevent the development and spread of antimicrobial-resistant gonorrhea.5,
6
Recently, gonorrhea isolates with decreased susceptibility to all available
antimicrobials has been reported in the United States, raising the possibility of
antimicrobial-resistant gonorrhea.7 Additionally, infection with either CT or GC can
increase DQLQGLYLGXDO¶VFKDQFHVRIFRQWUDFWLQJRUWUDQVPLWWLQJ+,9 to others.8 One of
the biggest challenges associated with the effective treatment of STIs is that patients
do not return to the clinic for results, thus increasing the chances of transmitting the
infection to others. Due to public health concerns, rapid and accurate diagnosis of
2
STIs is integral in reducing transmission and preventing life-threatening
complications.
1.1.2 Salmonella
Salmonella infections can be classified into two broad categories ± enteric
fevers and non-typhoidal Salmonella (NTS) disease. Enteric (typhoid) fevers, which
are caused by Salmonella enterica serovars Typhi and Paratyphi A and B, are
characterized by severe gastrointestinal infection and bacteremia (blood infection).9, 10
It is estimated that every year there are over 21 million cases of typhoid fever
resulting in more than 200,000 deaths worldwide.11 The development of rapid,
sensitive, and affordable tests to diagnose these infections is one of the highest
priorities to achieve control at the individual and population level.12 Additionally,
rapid and sensitive tests can also help to influence decisions on the use of vaccines9,
10, 13
and to differentiate enteric fevers from other invasive bacterial diseases such as
NTS.14, 15, 16, 17 The leading cause of gastroenteritis, NTS disease, is less severe than
enteric fever, and is caused by Salmonella typhimurium and Salmonella enteriditis.18,
19
In developed countries, infection with NTS presents as mild gastroenteritis, but in
low-resource setting, NTS can cause serious invasive disease with symptoms similar
to those of enteric fevers.20 It is estimated that there are 1.3 billion cases of NTS
annually worldwide resulting in three million deaths ± the majority occurring in
under-developed countries.21, 22 Two major outbreaks of NTS disease in the USA are
worth noting. The first in 2008, which originated from the consumption of jalapeno
peppers, resulted in 1442 cases in 42 states and two deaths.23 In 2009, a second
outbreak attributed to the consumption of contaminated peanut butter crackers,
3
resulted in 642 cases in 44 states and nine deaths.24 The development of sensitive and
cost-effective molecular tests could help improve the diagnosis of Salmonella
infections, including typhoid fever, especially in resource-limited settings where rapid
diagnosis is critical to prevent mortality.
1.2 Current Detection Methods
1.2.1 Chlamydia and Gonorrhea
Nucleic Acid Amplification Tests (NAATs)
In the last two decades, NAATs have replaced culture and immunoassays as
the gold standard for diagnosis of chlamydia and gonorrhea infection due to their
increased sensitivity and ease of sample transport.25 NAATs include both
hybridization assays and nucleic acid amplification tests. Hybridization assays, in
which a probe binds to the nucleic acid of the target STI, are not commonly used
because their reported sensitivity and specificity values are below that of bacterial
cultures.26 On the other hand, NAATs, which are based on the amplification and
detection of the target nucleic acid, have revolutionized the field of STI detection.27
NAATs are currently regarded as the gold standard for detection of chlamydia and
gonorrhea due to their analytical performance. Masek, et al. evaluated three NAATs
using vaginal swabs, and reported that the Aptima Combo2 transcription-mediated
amplification (TMA) assay was the most sensitive and specific for the detection of
CT and GC, while the ProbeTecΠassay had low sensitivity (80%) for detection of
GC, and the Roche Amplicor PCR assay had low specificity for CT detection.28 An
analysis of the performance of the cobas® 4800 CT/GC assay reported sensitivities of
94% and 92% for CT detection in urine and swabs, respectively, and higher
4
sensitivity for GC detection in swabs (100%) than urine (93%).29 The clinical
sensitivity of the improved cobas® 4800 assay for detection of CT and GC has been
reported to be approximately 98%.30
The latest NAAT (Cepheid GeneXpert)
approved by the Food and Drug Administration (FDA) has shown to be faster (<2
hours) and more sensitive and specific than other NAATs.31,
32
Despite their high
level of sensitivity and specificity, NAATs are expensive and not readily available in
developing countries where STIs are predominant. Furthermore, a recent study found
that even the fastest NAATs (GeneXpert) does not improve on the number of infected
patients ± 56 patients with chlamydia and 46 patients with gonorrhea out of 100
patients ± who were not treated at the initial visit to a genitourinary clinic in
London.33 According to the World Health Organization (WHO), point-of-care (POC)
tests which are Affordable, Sensitive, Specific, User-friendly, Robust and rapid,
Equipment-free, Deliverable (ASSURED) are urgently needed to address the STI
epidemic.34
1.2.2 Salmonella in Blood and Stool
The current gold standard method for identifying typhoid fever or invasive
Salmonella infection is detection by blood or bone marrow culture. However, the
process of collecting bone marrow is invasive, unpractical and it can take several days
to identify the causative agent of the infection through blood or bone marrow
cultures.35,
36
Additionally, in developing countries where invasive Salmonella
infections are common, there is a lack of health care facilities and resources necessary
to perform blood or bone marrow cultures. Antibody-based detection methods like the
Widal test are cheap and easy to perform, but are hindered by inappropriate result
5
interpretation,37, 38 and lack of specificity in endemic settings.39, 40 There is a pressing
need to develop affordable, rapid methods to identify typhoid fever and invasive
Salmonella infections, which could also help during outbreak situations.41
In order to address the need for sensitive and rapid tests, PCR-based
approaches have been developed; some of which can detect as low as 10 colonyforming units (CFU)/mL of Salmonella in blood.42 Quantitative real-time PCR
(qPCR), which can be faster and more sensitive than conventional PCR, can detect
100 to 200 organisms per mL of blood.43 Nevertheless, these limits of detection are
deemed to be insufficiently sensitive, as the median Salmonella Typhi count in the
blood of Vietnamese children with suspected enteric fever was 1 CFU/mL and the
mean number of bacteria per infected white blood cells (WBC) was 1.3 CFU/cell.44
In terms of NTS infections, low concentration of bacteria in blood has also been
reported.45
1.3 DNA Isolation and Fragmentation
1.3.1 Current Methods
The extraction of nucleic acid is a critical aspect of most molecular detection
platforms. There are a variety of methods to extract DNA/RNA from cells, but
commercial kits are more frequently employed because of their efficiency, reliability
and extract yield. Although many of the commercial kits employ different reagents,
the extraction of DNA from biological samples typically requires four steps:
homogenization/elution of the sample, enzymatic digestion of the cell membrane,
lysis of the bacterial cells, and extraction and purification of the nucleic acid. While
the yields of extracted DNA are very high using these commercials kits, one of the
6
major drawbacks is the cost per reaction. Additionally, different kits or reagents are
necessary to extract DNA from cells with different cell morphology.
In addition to high quality DNA, some molecular approaches, such as next
generation sequencing and Microwave-Accelerated Metal-Enhanced Fluorescence
(MAMEF) require small DNA fragments. There are several approaches currently
available for the fragmentation of DNA ranging from physical fragmentation
(acoustic shearing, sonication, hydrodynamic shear) to enzymatic and chemical
methods.46 While DNA shearing using nebulization is cost-efficient and does not
require a specialized instrument, this technique is not recommended when a limited
amount of sample is available as up to 30% of the DNA can be lost during the
fragmentation process.47 Sonication utilizes ultrasonic waves to fragment high
molecular weight DNA into smaller fragments. This technique has increased in
popularity in the last decade as instruments like the Covaris system (Woburn, MA)
can be used to generate DNA fragments of tunable sizes (100 bp ± 3kb).48
1.3.2 Microwaves and Microwave-Based DNA Isolation/Fragmentation
Microwaves (MW) are a form of electromagnetic radiation, which lie in the
electromagnetic spectrum between infrared waves and radio waves with frequencies
between 0.3 and 3.00 GHz and wavelengths ranging from one meter to one
millimeter. In the biochemical field, microwaves have been primarily used for the
sterilization of food products,49 but the pioneering work of Gedye and Giguere with
household microwaves has led to a variety of applications in the field of microwaveassisted chemistry.50,
51
Most of the microwave-assisted chemistry experiments are
carried out using a frequency of 2.45 GHz. While this frequency is not the maximum
7
microwave absorption frequency for water, it does fall within the allowable
commercial use microwave spectrum as higher frequencies are being used for
communications.52 In this regard, interaction of the electric component of microwaves
with dielectric materials, such as water, causes the reorientation of molecules with a
dipole moment in response to the oscillating electric field (Figure 1). The continual
reorientation of these molecules causes friction, resulting in dielectric heating through
the conversion of microwave energy into thermal energy.53, 54
It has been widely reported that exposure of microorganisms to microwave
irradiation causes damage by thermal effects.55-57 Others have suggested that nonthermal effects may also play a role in the lethality of microwave irradiation on
microorganisms. Yaghmaee and Durance investigated the lethal effects of
microwaves and conventional heating on E. coli and concluded that the degree of cell
membrane destruction was different with microwaves as compared to conventional
heating.58 Another study showed that the degree of E. coli cell membrane destruction
was greater when exposed to microwaves than conventional heating even when the
cell suspensions were maintained at 37°C.59 While microwave irradiation has been
primarily used for sterilization purposes, the use of microwaves for other processes,
such as acceleration of chemical reactions and release of genomic DNA, has received
a considerable amount of attention.60-62 Microwaves have been shown to be effective
for the isolation of genomic DNA from a variety of microbes, including bacteria,58, 63
bacteriophage,64 and spores,65 but also for preparation of DNA for real-time PCR
analysis.65, 66 Furthermore, microwave-based DNA extraction has been shown to be
more effective than conventional DNA extraction methods67 and microwave-based
8
DNA extraction can aid in the development of faster and cheaper diagnostic
approaches.68
Figure 1. Interaction of microwaves with water molecules. Upon entering the
material, microwaves create rapidly changing electric fields, which causes
molecules with dipoles, such as water, to rotate to align with the electric field. The
fast rotation of water molecules causes friction, which generates thermal energy.
The use of microwave irradiation for the purpose of DNA fragmentation for
downstream analysis by molecular approaches, such as next generation sequencing
and MAMEF, has also been reported. Yang and Hang have recently reported on the
use of microwaves to generate DNA fragments for next-generation sequencing.69
Although successful, their microwave irradiation procedure requires pre-extraction of
DNA, is time-consuming, and requires a specialized microwave system. In order to
address these concerns, 2.45 GHz household microwave ovens have been used for the
simultaneous extraction and fragmentation of DNA directly from a variety of
biological samples. The GeddeV¶ group has successfully used microwave irradiation
for the extraction and fragmentation of DNA from Bacillus anthracis spores,70
9
1.4 Fluorescence and Surface Plasmon-Enhanced Spectroscopy
1.4.1 Fluorescence
Fluorescence is a spontaneous process characterized by the emission of energy
in the form of light from a molecule following excitation with incident radiation of a
shorter wavelength.77 Fluorophores are chemical compounds containing several
combined aromatic groups, which can emit light following the excitation from the
ground state (S0). In this regard, the absorption of light results in excitation of the
fluorophore from the ground state (S0) to a vibrational state of either the first, second
or higher singlet excited state, followed by a rapid (10-12 s) relaxation process
(internal conversion) to the lowest vibrational energy state of S1. From S1, emission
of energy in the form of light (fluorescence) can occur to any vibrational state of the
S0 level through a slower (10-9 s) process. From the absorption of light (shorter
wavelength) to the emission of light (longer wavelength), there is a net loss of energy
UHVXOWLQJ LQ D SURFHVV NQRZQ DV 6WRNHV¶ VKLIW or the difference in wavelength or
frequency units between the absorption and the emission maxima on the spectra.77
While there are a number of properties that can influence fluorescence, the
quantum yield and lifetime of the fluorophore are critical components of the
fluorescence mechanism.
The quantum yield is the measure of the emission
brightness of a fluorophore and is the ratio of photons emitted to photons absorbed.
The lifetime of a fluorophore is the average time that the molecule can remain in the
excited state, prior to its relaxation to the ground state. In general, fluorophores with
longer lifetime have more time to interact with the environment which can lead to
photobleaching or other excited state photo-deactivation processes without the
11
There are two critical aspects of the enhanced fluorescence signatures
resulting from MEF ± the overlap of the characteristics of the fluorophore with that of
the metal and the distance between the fluorophore and the metal. Previous studies
have shown that MEF follows a theoretical decay similar to that of the near-field of
the nanoparticles as demonstrated by difference in electric field intensities around the
nanoparticles. Therefore, the fluorophore must be in close proximity to the metal (<
20 nm) in order for maximum fluorescence enhancement to occur due to the
magnitude and distribution of the electric filed around the near-field nanoparticles.86
The second factor that can affect the magnitude of MEF involves the overlap of the
absorption of the fluorophore with that of the metal as well as the emission of the
fluorophore with the scattering mode of the nanoparticles (Figure 4).82 The
fluorescence enhancement property of MEF has been repeatedly reported,81-87 and a
classical example of the enhancement of fluorescent signals near metal nanoparticles
is shown in Figure 5. MEF has also been shown to significantly improve the
photostability of fluorophores as demonstrated by shorter fluorophore lifetimes in the
presence of metal nanoparticles.83 Karolin and Geddes have reported that reduction in
lifetime near metallic surfaces is a function of increased laser power.88 Additionally,
it has been postulated that increased laser power can have an effect on near-field
volumes through a process known as MEF Excitation Volumetric Effect (MEF
EVE).89 Based on the properties of MEF, it appears to be a suitable alternative to
classical fluorescence for detection of biological targets especially when the target
analyte is present at low concentrations.
15
1600
Plastic well
300
1400
SIF - 0.8 OD
200
1200
SIF - 1.2 OD
1000
QuantaWell
100
0
536
548
560
572
585
597
609
Fluorescence intensity (A.U.)
Figure 4. Plasmon resonance spectra of silver nanoparticles and florescence and
absorption spectra of a typical fluorophore. The spectra depict the overlap of the
absorption of the fluorophore and the nanoparticles and the coupled emission radiating
through the nanoparticles scattering mode. Adapted from Zhang et al, 2009.82
800
600
400
200
500
509
518
527
536
545
554
563
572
581
590
599
608
616
625
634
643
651
660
669
677
686
694
0
Wavelength (nm)
Figure 5. Emission spectra of TAMRA enhanced by silver nanoparticles in
comparison to far-field emission. Inset ± Spectral shift in Metal-Enhanced
Fluorescence (MEF).90 OD ± Optical density; SIF ± Silver Island Film; QuantaWell ±
QuantaWell - 4XDQWD:HOOΠfor enhancement of fluorescent signals.
16
The accelerated rate of biological recognition between the target and probes is
provided by a microwave-induced thermal gradient. Upon exposure to microwave
irradiation, the temperature of the solution increases, while that of the assay surface
(metallic nanoparticles) remains unchanged creating a temperature gradient, which
drives the mass transfer of the fluorescent probe and target from the solution to the
assay surface.97 Previous studies have shown that microwaves can reduce assay
incubation times by lowering the activation energy of reactants,98 including the
energy required for the hybridization process in MAMEF.99, 100
1.5.2 Applications of MAMEF
Using a MAMEF-based immunoassay, it has been shown that the MAMEF
assay can be > 10 times more sensitive and > 90-fold faster than a traditional
immunoassay for detection of myoglobin.101 Based on this technology, the rapid and
sensitive detection of DNA from pathogenic bacteria,70,
proteins.97,
101, 103, 104, 105
71, 72, 73,
RNA,102 and
has been reported. Despite the success of MAMEF as a
sensing platform, the technology has not been evaluated and subsequently validated
with clinical samples, which was one of the primary goals of this dissertation.
19
Chapter 2: Microwave-Accelerated Isolation and Fragmentation
of DNA
2.1 Conventional Heating vs. Microwaves for Microbial Cell Lysing
2.1.1 Motivation
Over the last two decades, molecular approaches, including polymerase chain
reaction (PCR) and NAATs, have revolutionized the field of diagnostics. However,
the development of rapid and inexpensive methods for the lysing of microbial cells
and DNA extraction, especially those with complex cell wall structures remains a
challenge. Traditionally, microwaves have been used for the inactivation of bacteria
in the food industry. Recently, the use of microwaves as a tool for actual cell lysing
and DNA extraction and subsequent fragmentation has increased.
While a few
studies56, 106 have evaluated the effects of microwaves on bacteria with different cell
wall structures (gram-positive vs gram-negative organisms), none have systematically
compared the effects of microwaves on DNA isolation and fragmentation on
organisms with different cell wall structures. More importantly, the use of highlyfocused microwaves has not been investigated as a tool to increase cellular lysing and
DNA extraction/fragmentation efficiency. Given that the focus of this dissertation
was to develop rapid and sensitive Microwave-Accelerated Metal-Enhanced
Fluorescence (MAMEF)-based assays for detection of microbial pathogens, the use of
microwaves for lysing gram-positive and gram-negative organisms was studied and
the effect of highly-focused microwaves on DNA extraction and fragmentation
evaluated. Effective cell lysing approaches play a critical role in the process of DNA
extraction for downstream molecular detection approaches.107
20
was plated on either chocolate agar plate (N. gonorrhoeae) or blood agar plate (L.
monocytogenes) and incubated overnight at 37ͼC to determine cell survival. An
aliquot of the untreated bacterial suspension was also plated as a control. Due to the
effect of heat on DNA denaturation, following the heating step, bacterial suspension
lysates were incubated at room temperature for at least two hours to allow for DNA
hybridization prior to DNA analysis by gel electrophoresis.
Microwave-Based Lysing Using Bowtie Structures
Gold bowtie structures deposited on microscope slides (Figure 9A), which
help to focus microwaves at 2.45 GHz onto samples, have been previously developed
and the rationale for their use previously reported70, 74 The sample lysing chambers
(Figure 9B and 9C) have been theoretically designed and modeled using numerical
simulations (finite-difference time-domain - FDTD)70, 74 to determine the spatial and
temporal profile of the focused microwaves to optimize the heating/volume effects.
The optimization of heating effects by microwave-focusing bowtie structures allows
for the use of low-cost (~ $40), commercial, low-power microwave ovens for lysing,
with only a few slight modifications inside the microwave, including removal of the
rotating plate, and insertion of a mounting device for sample holding (Figure 10).
The lysing chambers are mounted along the long-axis of the microwave oven, inline
with the field within the microwave cavity.
The rapid heating of water by
microwaves (both around and within the organism) rapidly disrupts cellular
membranes resulting in the release and fragmentation of genomic material.70-73, 108, 109
22
Figure 9. Microwave-focusing bowtie structures and lysing chambers. A) Gold
disjointed bowtie structures deposited on glass slides. B) Small lysing chamber (0.5 mL to
1 mL). C) Large lysing chamber (up 2 mL volume). Adapted from Melendez et al,
2016.109
Deposition of Gold Bowtie Structures on Glass Surface for Cellular Lysing
A vapor deposition approach was used to deposit gold triangles on glass
surfaces.70-73, 108, 109 Briefly, glass microscope slides were covered with a mask (an
aluminum foil with an opening for a template of two 12.3-mm equilateral triangles) to
create a bow-tie structure. Equilateral gold (99.999%) triangles (thickness 100 ± 5
nm) were deposited onto glass microscope slides (StarFrost, Sigma Aldrich) using a
BOC Edwards 306 vacuum deposition unit (West Sussex, UK) at a rate of 0.1 nm/s
(Figure 9A). Following the deposition of gold bowtie structures, self-adhesive silicon
isolators with a diameter of 20 mm or 32 mm were placed over the bowtie region to
create a chamber for lysing sample volume ranging from 0.5 mL (Figure 9B) to 2 mL
(Figure 9C).
23
Figure 10. Household microwave fitted with a mounting device. The mounting device
109
was designed to hold the lysing chamber (inset). Adapted from Melendez et al, 2016.
Fresh dilutions (108 CFU/mL) of N. gonorrhoeae and L. monocytogenes were
lysed in the aforementioned lysing chambers with and without microwave-focusing
bowtie structures. The small lysing chambers (Figure 9B) were used to lyse sample
volumes of 0.5 mL. Sample volumes of 1 and 2 mL were lysed in the large lysing
chambers (Figure 9C). All bacterial suspensions were exposed to 2.45 GHz
microwave irradiation in a 900-watt microwave (Frigidaire, model FFCM0934LB)
using three different powers; 10%, 30%, and 50% corresponding to 90, 270, and 450W, over the entire microwave cavity for either 30, 60 or 90 seconds. The temperature
of the bacterial suspensions was recorded prior to treatment and immediately
following microwave irradiation with a traceable infrared dual laser thermometer
(Fisher Scientific).
All experiments were carried out in triplicate. Immediately
following microwave irradiation and temperature reading, a 20-µl aliquot of each
treated sample was plated on growth media (chocolate agar plate for N. gonorrhoeae
or blood agar plate for L. monocytogenes), and incubated overnight at 37ͼC to
24
determine cell survival. An aliquot of the untreated bacterial suspension was also
plated as a control. Additional processing of the untreated and treated samples for
further analysis was carried out as described in the conventional heating section
above.
2.1.3 Results and Discussion
In order to evaluate the effects of microwave irradiation on organisms with
different cell wall structures, the gram-negative organism N. gonorrhoeae and the
gram-positive bacteria L. monocytogenes, were systematically exposed to microwave
irradiation of different durations and powers and the cell survival rates compared.
Additionally, results regarding the use of highly-focused microwaves and their effect
on cellular death, DNA extraction and fragmentation are presented and discussed.
A summary of N. gonorrhoeae survival rates vs. temperature following
microwave irradiation is presented in Table 1A.
Exposure of N. gonorrhoeae
bacterial suspensions to microwaves at 10% power (30, 60, 90 seconds) and 30%
power for 30 seconds resulted in low temperatures and had no effect on N.
gonorrhoeae survival (Table 1A). However, exposing the bacterial suspensions to a
higher microwave power and a longer irradiation interval resulted in decreased
survival rates (Table 1A). A comparison of N. gonorrhoeae survival rates following
exposure to microwaves in the two different lysing chambers (Figure 9B and 9C)
suggested that N. gonorrhoeae is more susceptible to cellular death when exposed to
microwave irradiation in the large lysing chamber (Table 1). The increase rate of N.
gonorrhoeae cellular death in the large lysing chambers could be attributed to the
25
overall higher temperatures reached by the bacterial suspensions in these chambers in
comparison to the temperatures reached in the small lysing chambers.
Total
Energy
(KJ)
N/A
2.7 ʹ 8.1
8.1
13.5
16.2
24.3
27.0
40.5
Small lysing chamber
(0.5 mL volume)
Culture
Temperature
survival
(°C)
(%)
100
22.2 ʹ 22.8
22.3 ʹ 26.1
100
31.5 ʹ 33.9
100
40.9 ʹ 42.9
100
47.2 ʹ 51.0
0
42.4 ʹ 45.8
66
56.2 ʹ 59.6
0
61.9 ʹ 64.3
0
Large lysing chamber
(2 mL volume)
Culture
Temperature
survival
(°C)
(%)
22.4 ʹ 24.0
100
23.5 ʹ 37.7
100
36.6 ʹ 46.6
100
47.8 ʹ 51.8
33
52.0 ʹ 57.2
0
44.9 ʹ 54.3
0
55.6 ʹ 57.2
0
69.0 ʹ 73.6
0
Total
Energy
(KJ)
N/A
2.7 ʹ 8.1
8.1
13.5
16.2
24.3
27.0
40.5
Small lysing chamber
(0.5 mL volume)
Culture
Temperature
survival
(°C)
(%)
100
22.9 ʹ 24.5
23.6 ʹ 31.4
100
30.4 ʹ 34.4
100
40.4 ʹ 46.0
100
44.1 ʹ 53.1
0
45.2 ʹ 48.6
0
55.2 ʹ 59.0
0
61.1 ʹ 63.9
0
Large lysing chamber
(2 mL volume)
Culture
Temperature
survival
(°C)
(%)
21.7 ʹ 22.6
100
23.5 ʹ 38.6
100
38.5 ʹ 41.1
100
49.2 ʹ 53.4
0
56.6 ʹ 61.8
0
60.2 ʹ 63.2
0
72.6 ʹ 72.8
0
68.7 ʹ 77.3
0
A
Microwave
Power
(%)
N/A
10
30
50
Irradiation
time
(seconds)
N/A
30, 60, 90
30
60
90
30
60
90
B
Microwave
Power
(%)
N/A
10
30
50
Irradiation
time
(seconds)
N/A
30, 60, 90
30
60
90
30
60
90
Table 1. Survival of Neisseria gonorrhoeae following microwave irradiation. A) Lysing
chambers with no bowtie structures. B) Lysing chambers with bowtie structures. Each
experimental condition (microwave power and exposure time) were tested in triplicate and
the average growth per experimental condition along with standard deviation calculated.
For simplicity, the bacterial suspension temperatures and associated culture survival rates
from exposure to 10% microwave power for 30, 60, 90 seconds is presented together since
exposing the bacterial suspensions to low-power microwaves, regardless of microwave
exposure time, did not affect survival rates.
Next, the use of gold bowtie structures as microwave±focusing antennas75, 76
was investigated as an approach to increase bacterial cell death. In this regard, the
use of microwaves-focusing structures does not increase bacterial cell death when the
26
bacterial suspensions are exposed to microwaves at 10% power (Table 1A and 1B)
However, there was a trend towards higher temperatures and increased cell death
when the N. gonorrhoeae bacterial suspensions were exposed to microwaves (power
> 30%) in the presence of bowtie structures (Table 1A and 1B).
In order to determine if microwaves can have the same lethal effect on all
organisms, suspensions of L. monocytogenes ± a gram-positive organism with a
thicker cell wall - were exposed to the same experimental conditions as described for
N. gonorrhoeae. In comparison to N. gonorrhoeae (Table 1A and B), inactivation of
L. monocytogenes cells required higher temperatures (Table 2A and B).
Additionally, the irradiation of L. monocytogenes in small lysing chambers with
microwave-focusing bowtie structures resulted in higher solution temperatures as
compared to when the bacterial suspensions were irradiated in the absence of the
bowtie structures. The observation of higher temperatures in the presence of bowtie
structures can be attributed to the focused direct heating of the bacterial suspensions
by the microwaves.70,
74
It is worth noting, however, that in the case of N.
gonorrhoeae, a similar trend was only consistently observed when large lysing
chambers were used (Table 1A and B). The reason for the difference in solution
temperatures between the bacterial species is unknown.
Finally, N. gonorrhoeae and L. monocytogenes cell suspensions were exposed
to conventional heating to determine if heat provided by thermal conduction can have
the same lethal effect on bacterial cells as microwave-assisted heating. The
temperatures (40° - 70°C) used for the conventional heating experiments were
selected because they were similar to those reached by bacterial suspensions during
27
Total
Energy
(KJ)
N/A
2.7 ʹ 8.1
8.1
13.5
16.2
24.3
27.0
40.5
Small lysing chamber
(0.5 mL volume)
Culture
Temperature
survival
(°C)
(%)
100
22.3 ʹ 22.8
22.6 ʹ 31.4
100
28.5 ʹ 31.1
100
35.2 ʹ 38.4
100
41.7 ʹ 45.3
100
40.7 ʹ 43.3
100
53.4 ʹ 54.8
0
60.4 ʹ 62.8
0
Large lysing chamber
(2 mL volume)
Culture
Temperature
survival
(°C)
(%)
23.0 ʹ 23.6
100
23.5 ʹ 36.7
100
38.5 ʹ 45.1
100
54.4 ʹ 54.6
50
59.5 ʹ 60.5
0
51.9 ʹ 58.1
33
68.5 ʹ 71.1
0
66.2 ʹ 74.0
0
Total
Energy
(KJ)
N/A
2.7 ʹ 8.1
8.1
13.5
16.2
24.3
27.0
40.5
Small lysing chamber
(0.5 mL volume)
Culture
Temperature
survival
(°C)
(%)
100
22.4 ʹ 23.3
23.6 ʹ 31.4
100
42.3 ʹ 44.7
100
50.3 ʹ 53.3
100
58.7 ʹ 62.1
0
36.2 ʹ 40.4
100
54.5 ʹ 58.1
0
58.4 ʹ 66.2
0
Large lysing chamber
(2 mL volume)
Culture
Temperature
survival
(°C)
(%)
22.5 ʹ 23.5
100
23.7 ʹ 38.5
100
39.4 ʹ 46.0
100
48.2 ʹ 54.7
20
56.7 ʹ 60.9
0
54.8 ʹ 61.0
0
65.6 ʹ 69.2
0
71.4 ʹ 71.6
0
A
Microwave
Power
(%)
N/A
10
30
50
Irradiation
time
(seconds)
N/A
30, 60, 90
30
60
90
30
60
90
B
Microwave
Power
(%)
N/A
10
30
50
Irradiation
time
(seconds)
N/A
30, 60, 90
30
60
90
30
60
90
Table 2. Survival of Listeria monocytogenes following microwave irradiation. A) Lysing
chambers with no bowtie structures. B) Lysing chambers with bowtie structures. Each
experimental condition (microwave power and exposure time) were tested in triplicate and
the average growth per experimental condition along with standard deviation calculated.
For simplicity, the bacterial suspension temperatures and associated culture survival rates
from exposure to 10% microwave power for 30, 60, 90 seconds is presented together since
exposing the bacterial suspensions to low-power microwaves, regardless of microwave
exposure time, did not affect survival rates.
microwave irradiation.
At 40°C, survival rates for either bacterial species (N.
gonorrhoeae or L. monocytogenes) were not affected (Table 3). Increasing the
temperature of the bacterial suspensions to 50°C resulted in decreased survival rates
for N. gonorrhoeae, but interestingly not for L. monocytogenes.
28
Raising the
temperature of L. monocytogenes suspensions to 55°C resulted in decreased survival
rates, and both bacterial species were completely inactivated when the temperature of
the suspensions reached 60°C. The difference in culture survival rate for these two
organisms at the same solution temperature (50°C) was likely due to the difference in
cell wall structure as gram-positive oganisms, such as L. monocytogenes, are more
difficult to lyse.110
Overall, the results suggested that L. monocytogenes cellular death by
conventional heating required higher temperatures than inactivation of N.
gonorrhoeae. This finding is similar to those obtained by microwave-assisted heating
and consistent with previous reports regarding the difference in cellular death for
organisms with different cell wall structures.56, 106
Temperature (°C)
40
50
55
60
70
Culture Survival Rate (%)
N. gonorrhoeae
L. monocytogenes
100.0
66.3
N/A
0
0
100.0
100.0
27.0
0
0
Table 3. Survival rates of Neisseria gonorrhoeae and Listeria monocytogenes as a
function of temperature following conventional heating.
2.1.4 Conclusions
Microwaves have primarily been used in the food processing industry for
sterilization and pasteurization processes.49 More recently, however, microwaves
have been used to lyse bacterial cells, including those with complex cell wall, for the
purpose of DNA extraction. Although, several reports have investigated the use of
microwaves to lyse cells with different cell wall structures,56,
29
106
the use of metal
bowtie structures as antennas to focus microwaves has not been previously described
to lyse gram-positive and gram-negative organisms. Additionally, the possibility of
using a single set of conditions for the microwave-based lysing of bacterial species
with different cell walls has not been investigated.
Here, microwaves were used to lyse two bacterial species, N. gonorrhoeae
and L. monocytogenes, in the presence and absence of gold bowtie structures
functioning as microwaves-focusing antennas.75, 76 N. gonorrhoeae was more easily
inactivated using microwaves, than L. monocytogenes, which can be explained by the
presence of a more complex cell wall in L. monocytogenes. Additionally, the use of
microwaves-focusing bowtie structures enhanced cell lysing efficiency especially
when the bacterial cells were exposed to microwaves in the small lysing chamber. In
these chambers, the entire sample volume is located in close proximity to the area of
maximum energy enhancement (between the apexes of the triangles), thus resulting in
enhanced lysing efficiency. In most cases, the enhanced lysing efficiency can be
attributed to higher bacterial suspension temperatures in the presence of the bowtie
structures, but in some cases, the enhancement may be the result of a combination and
thermal and non-thermal effects. A discussion on how bowtie structures enhance the
rate of biochemical reactions, such as cellular lysing, and the non-thermal effects of
microwaves on biological systems is presented in section 2.2. Despite the
enhancement to cell lysing efficiency afforded by the microwaves-focusing bowtie
structures, a single set of conditions (microwave power and exposure) cannot be used
for the lysing of N. gonorrhoeae and L. monocytogenes based on the data presented
here.
30
2.2 Conventional Heating vs. Microwaves for DNA Isolation and Fragmentation
2.2.1 Motivation
While most molecular approaches require intact DNA for analysis, the
Microwave-Accelerated Metal-Enhanced Fluorescence (MAMEF) platform requires
small DNA Fragments (< 100 bp) for DNA-based sensing. Previous work in our
laboratory and others70-73 has shown that microwaves can, in the same reaction,
extract and fragment DNA. However, a systematic study of conditions (microwave
power and exposure time) necessary for DNA fragmentation has never been carried
out or the effects of microwaves on DNA fragmentation compared to those of
conventional heating. Additionally, it is not known whether the same experimental
conditions can be used to fragment DNA from gram-positive and ±negative
organisms. Given the critical role of suitable DNA fragments for MAMEF-based
DNA sensing, a systematic evaluation of DNA fragmentation by microwaves and
conventional heating was carried out and the results are discussed in the setting of
MAMEF and PCR.
2.2.2 Experimental Details
Samples for DNA fragmentation analysis were obtained by lysing N.
gonorrhoeae and L. monocytogenes cells using either microwaves or conventional
heating as described in section 2.1.2. Following the cell lysing step, samples were
incubated at room temperature for two to three hours to allow for DNA hybridization
into double-stranded DNA (dsDNA) fragments and analyzed for DNA fragmentation
as described below.
31
Analysis of DNA Fragmentation by Gel Electrophoresis
Prior to gel electrophoresis, the pre- and post-lysed samples were ethanol
precipitated with 2X the volume of pre-chilled molecular grade ethanol (Fisher
Scientific), followed by centrifugation at 14000 RPM for 20 minutes, and the
supernatant discarded. DNA pellets were air-dried for 20 minutes and re-hydrated in
70 µl of DNA rehydration solution (Promega, Madison, WI). Following the pellet rehydration step and prior to gel electrophoresis analysis, all samples were centrifuged
at 6000 RPM for 5 minutes in order to separate DNA from cell debris. To assess the
degree of DNA fragmentation, 40 µl of each sample was electrophoresed on 1.5%
agarose gel in the presence of ethidium bromide.
Analysis of DNA Fragmentation Using the Agilent Bioanalyzer
In order to more quantitatively measure the effects of lysing chamber size and
geometry on DNA fragmentation, some samples (based on the results from the gel
electrophoresis analysis) were also analyzed for DNA fragmentation on the Agilent
2100 Bioanalyzer (Agilent Technologies, Palo Alto, California). The Bioanalyzer is
an easy-to-use instrument, which combines the principles of electrophoresis and flow
cytometry to provide sizing, quantitation, and quality control of DNA, RNA and cells
on a single platform.111 Pre-lysed and lysed samples were prepared for analysis as
described in the gel electrophoresis section and a one-µl aliquot of each sample
analyzed on the Agilent 2100 Bioanalyzer. The results of the analysis, reported as the
FRQFHQWUDWLRQSJȝl) of each individual dsDNA fragment present in the sample, were
used to access the efficiency of the lysing procedures (microwave or conventional
heating) to generate dsDNA fragments (<100 bp) required for MAMEF analysis.
32
Real-Time PCR analysis
PCR analysis was carried out to determine how microwave-based DNA
isolation affects PCR-based detection of N. gonorrhoeae DNA.
Prior to PCR
analysis, samples (pre-lysed and lysed) were centrifuged at 8000 RPM for 10 minutes
to separate DNA from intact bacterial cells and cellular debris. The supernatant was
used for Real-Time PCR analysis using a previously described 16S rRNA-based realtime PCR assay.112-116 Briefly, each PCR reaction was performed in a total volume of
ȝlXWLOL]LQJȝl RI3&5PDVWHUPL[DQGȝl of sample. The PCR master mix
FRQWDLQHGȝl of 2X TaqMan universal PCR mix (PE Applied Biosystems, Foster
&LW\ &$ ȝl
of
each
ȝ0 IRUZDUG SULPHU
TGGAGCATGTGGTTTAATTCGA-¶
DQG
UHYHUVH
SULPHU
S
¶-
S
¶-
TGCGGGACTTAACCCAACA-¶, ȝl of 2.5 units of Amplitaq Gold (PE Applied
%LRV\VWHPV )RVWHU &LW\ &$ DQG ȝl RI ȝ0 SUREH. TaqMan probes were as
IROORZV ¶9,&-ACAGGTGCTGCATGGCTGTCGTCAGCT-MGBNFQ-¶ DQG ¶6FAM-TCTCCGGAGGATTCCGCACATGTCAAAA-MGBNFQ-¶
PCRs were
performed on the ABI 7900 HT sequence detection system (PE Applied Biosystems,
Foster City, CA) with the following cycling conditions: pre-incubation at 50°C for 2
minutes, denaturation at 95°C for 10 minutes, and 50 repeats at 95°C for 15 seconds,
annealing/extension temperature at 60°C for 60 seconds.
2.2.3 Results and Discussion
In regards to the effects of conventional heating on DNA extraction and
fragmentation, a direct relationship between heating temperature and DNA extraction
was noted, as higher temperatures resulted in increased DNA extraction and partial
33
cellular disruption and release of DNA.70 The fragmentation of DNA, however, may
not be totally due to thermal effects as will be discussed later in this chapter. In the
small lysing chamber, the entire lysing volume is directly above the microwavesfocusing bowtie structures and closer to the apexes of the triangles (Figure 14A), thus
allowing for a greater number of cells to be near the highest levels of focused energy.
Conversely, when the large lysing chambers were used, the entire sample volume is
not directly above the bowtie structures and the bulk of the lysing volume is farther
away from the apexes of the triangles (Figure 14B). The subsequent difference in
DNA fragmentation efficiency, observed when comparing both the small and large
lysing chambers, was not likely related to temperature increase, as higher
temperatures were in fact reached by the bacterial suspensions in the large lysing
chamber during microwave irradiation (Figure 13A-D). Additionally, the enhanced
lysing and DNA fragmentation efficiency of the small lysing chambers in comparison
to the large lysing chambers may not be completely attributed to the difference in
lysing volumes, as there was no difference in DNA fragmentation when the large
lysing chambers were used to lyse 1 or 2 mL of sample (data not shown).
In terms of DNA extraction and fragmentation of L. monocytogenes, exposure
of this bacterial species to microwaves of 10% and 30% power, regardless of the type
of lysing chamber used, did not result in extraction or fragmentation of DNA (data
not shown). Increasing the power to 50% resulted in partial DNA extraction and
fragmentation, but only when the small lysing chambers with bowtie structures were
used and the exposure time was greater than 60 seconds (Figure 15C). Exposure of L.
monocytogenes to microwaves in the large lysing chambers, regardless of the use of
38
Despite decades of research, there is still a lack of information on the
mechanism involved in the interaction of microwaves with biological systems. While
it is well established that microwaves can induce a rapid temperature increase and
affect a variety of cellular functions, controversies remain regarding how microwaves
can cause DNA damage. This is due to the fact that the energy level of a microwave
photon (10-5 eV) is not sufficient to break the covalent bond of DNA, which requires
energy levels of 10 eV. Additionally, based on the results presented here, thermal
effects do not appear to play a major role in DNA fragmentation. Based on the
difference in energy levels, some studies have concluded that microwaves cannot
break the covalent bonds of DNA,117, 118 while others,64, 69, 70-73, and this study,109 have
shown that exposing microorganisms to microwave irradiation results in rapid DNA
fragmentation. There is evidence to suggest that microwaves do not directly interact
with DNA.119,
120
An alternative mechanism for the degree of DNA fragmentation
reported in the present study might be that microwave irradiation generates reactive
oxygen species (ROS), and that these species attack the deoxyribose moiety, causing
the release of free bases from DNA.121-125
While the results from gel electrophoresis analysis supported the hypothesis
that microwave-focusing bowtie structures enhanced the rate of DNA fragmentation
in N. gonorrhoeae, a more quantitative approach, utilizing the Bioanalyzer, was
investigated to analyze DNA fragmentation. A direct comparison of the degree of
DNA fragmentation of samples exposed to microwaves in the presence and absence
of bowtie structures did not show a trend regarding the use of bowtie structures and
41
trial separately analyzed on the Bioanalyzer. As shown in Table 4, there is a large
degree of variability in terms of the concentration of fragmented DNA following
microwave irradiation. These results are consistent with those obtained when the
testing was carried out over multiple days (Figure 17), which suggested problems
with the analytical performance of the Bioanalyzer or lack of reproducibility of the
microwave-assisted lysing process. Contrary to the gel electrophoresis analysis, in
which the entire lysed sample was analyzed, the Bioanalyzer can only analyze 1 ʅl of
sample, thus only allowing for a small proportion (aliquot) of the sample to be
analyzed. It is also possible that microwave-based lysing using the same conditions
(microwave power and exposure time) might not always produce the same degree of
fragmentation resulting in the variability observed during this analysis.
Concentration dsDNA (pg/ʅl)
Pre-lyse
No Bowtie
Bowtie
6255.67
6355.49
6197.75
30 seconds - MW
220635.03
169985.00 46914.51
11452.18
9192.06
10790.21
1320.30
56551.54 8231.49
60 seconds - MW
2958.72
1540.30
3085.23
1269.76
778.63
9953.66
Table 4. Quantitative analysis of DNA fragmentation. Concentration of Neisseria
gonorrhoeae DNA following microwave irradiation using the small lysing chambers. A
Neisseria gonorrhoeae suspension was microwave-lysed (n = 3) and individually analyzed
on the same Bioanalyzer chip. MW ± Microwave irradiation.
Although the primary purpose of microwave-based lysing and DNA
fragmentation is for MAMEF-based DNA sensing, the effects of microwaves on
DNA for PCR amplification was also investigated in order to understand the
microwave lysing approach in a broader context. In order to further show that
microwave irradiation results in DNA fragmentation, pre- and post-microwave
irradiation lysates of N. gonorrhoeae were tested by real-time PCR. As shown in
Figure 18, exposure of N. gonorrhoeae to microwaves for 30 seconds resulted in a
43
similar amplification profile as pre-lysed cells (osmotically lysed), suggesting that
low-power, short duration microwave irradiation did not affect the concentration of
DNA template available for PCR. However, increasing the exposure time to 90 or
120 seconds increased the PCR threshold cycle (Ct), indicative of a lower
concentration of template DNA available for PCR. A lower concentration of DNA
suitable for PCR analysis following microwave irradiation is consistent with the
hypothesis that exposing N. gonorrhoeae cells to microwaves results in DNA
fragmentation as suggested by this and previous studies.70-73, 109
40
Threshold cycle (Ct)
39
38
37
36
35
34
33
32
31
30
Pre lyse
30
90
120
Microwave time (seconds)
Figure 18. PCR-based detection of Neisseria gonorrhoeae DNA following microwave
irradiation. Bacterial suspensions (108 CFU/mL) were microwave-lysed and samples
analyzed for N. gonorrhoeae DNA by PCR. Adapted from Melendez et al, 2016.109
2.2.4 Conclusions
The use of microwaves as an inexpensive and rapid tool for DNA extraction
and fragmentation plays a critical role in the development of rapid molecular
detection platforms and MAMEF, respectively.
44
Here, a variety of experimental
conditions (lysing volume, microwave power and exposure time) were investigated to
identify ideal experimental conditions for the rapid isolation and fragmentation of
DNA from N. gonorrhoeae and L. monocytogenes.
The results reported here showed that low-power microwaves, regardless of
the exposure times investigated, did not result in DNA extraction, which are
consistent with the cell lysing results previously discussed in section 2.1. The use of
microwave-focusing bowtie structures, however, increased the rate of N. gonorrhoeae
DNA fragmentation, especially when the small lysing chambers were employed. In
regards to DNA fragmentation, temperature did not appear to be the only factor
associated with DNA fragmentation efficiency suggestive of possible non-thermal
effects. Experimental conditions for the extraction and fragmentation of L.
monocytogenes DNA suitable for MAMEF analysis (<100 bp) were not identified in
the current study and work is ongoing to identify ideal experimental conditions. This
work also showed that microwaves can be used for the extraction of DNA for PCR
analysis, but that longer exposure times can generate small DNA fragments, which
are not suitable for PCR analysis.
2.3 Microfluidic-Assisted Microwave-Accelerated Cell Lysing
2.3.1 Motivation
The present study, as well as previous studies,70, 74, 109 have suggested that the
presence of microwave-focusing bowtie structures can enhance cell lysing and DNA
fragmentation. Through theoretical and experimental observations, it has been shown
that metal bowtie structures can function as an antenna, thus enhancing the
microwave field, with the maximum field enhancement localized at the apexes
45
between the two triangles of the bowtie structure.70, 74 In order to further expand the
functionality of the microwave-assisted cell lysing and DNA fragmentation
technology, a microfluidic-based lysing chip was designed and tested with N.
gonorrhoeae. The microfluidic lysing chip was designed to allow for the entire lysing
volume to flow and subsequently pass in between the apexes of the triangles, during
microwave exposure.
2.3.2 Experimental Details
Design and Development of Microfluidic-Based Lysing Chip
A prototype microfluidic-based lysing chip was designed and developed as a
collaborative effort between the Institute of Fluorescence and the laboratory of Dr.
Tza-Huei Wang from the Department of Mechanical Engineering at Johns Hopkins
University. The flow lysing chip combines the previously described gold bowtie
structures, for microwave focusing, with a polydimethylsiloxane (PDMS)-based flow
chip (Figure 19). The PDMS-based flow lysing chip contains a small opening at one
end to allow for sample input and a fluidic reservoir at the other end for collection of
the post-lysed sample. The two openings in the PDMS matrix are connected by an
eight mm flow channel, which allows for the entire lysing volume to flow in between
the apexes of the triangles as it travels from the input to the output collection chamber
(fluidic reservoir) during the microwave-based lysing process. The flow lysing chips
were fabricated LQ 'U :DQJ¶V ODE using standard soft lithography techniques.126
Briefly, SU-8 (MicroChem Corp) photoresist was spin-coated on silicon wafer to
~100 micron thickness. The microfluidic mold was generated by crosslinking SU-8
photoresist by exposure to 436 nm light through a photomask containing the channel
46
feature, followed by removal of unexposed resist in organic solvent, SU-8. PDMS
was subsequently prepared in 1:10 ratio of crosslinker to base material, degassed,
then applied to the surface of the SU-8 mold and cured at 75°C for one hour, followed
by de-molding. Punch tools were used to generate a fluidic reservoir (200 ʅl) and a
connection for the sample input. The PDMS chambers were subsequently activated
using an oxygen plasma etcher and bonded to the gold bowtie structure, which were
previously deposited on glass slides, followed by heating at 75°C overnight.
Figure 19. Microfluidic-based lysing chip. The flow chip combines the principles of
microwaves focusing with microfluidics to allow for the localized lysing of microbial
pathogens.
Microfluidic-Based Microwave-Assisted Instrumentation
In order to test the microfluidic-based lysing chip, a new experimental set up
was designed involving the delivery of sample (bacterial suspensions) directly to the
flow lysing chip mediated by a peristaltic pump located outside the microwave
(Figure 19). In this regard, the peristaltic pump (Control Company, Friendswood,
47
Texas) delivered the sample to the microfluidic lysing chamber in the microwave via
a 3-feet long 0.44 mm (inner diameter) Masterflex Tygon tubing (Cole Palmer,
Vernon Hill, IL). The Tygon tubing was inserted into the microwave through a predrilled hole located at the bottom of the microwave and connected to the PDMSbased flow lysing chip via a 0.32 mm fused silica untreated column (Sigma-Aldrich).
Lastly, the flow chip attached to the peristaltic pump via the Tygon tubing and fused
silica connection was placed at the center of the microwave in a silicon holder for
microwave irradiation (Figure 20). The peristaltic pump is equipped with two speeds
(fast and slow) and 10 settings, thus allowing for delivery of sample to the flow lysing
chip in a timely and control manner.
Microfluidic-Based Microwave-Assisted Microbial Lysing
Neisseria gonorrhoeae was selected as the model organism for this part of
the project because the cellular lysing results could be easily compared to those from
the previously described microwave-assisted lysing approach using the static (no
flow) lysing chambers (sections 2.1 and 2.2). Suspensions of N. gonorrhoeae were
prepared in autoclaved, deionized water as previously described and tested at
different concentrations as described. The suspensions were exposed to microwave
irradiation at different powers (10% - 70%) in a 900-Watt microwave (Frigidaire,
model FFCM0934LB).
48
In addition to different microwave powers, a variety of flow speeds were
investigated to determine the ideal flow conditions for maximum cell lysing and DNA
fragmentation. Bacterial suspensions were delivered to the flow lysing chip, at the
specified flow rate, as previously described through a peristaltic pump. The flow of
bacterial suspensions was stopped two seconds before the end of the microwave
pulses to allow for the entire sample in the flow channel to be exposed to the
microwaves. Following microwave irradiation, the lysed sample (approximately 200
ʅl per trial) was removed from the fluidic reservoir, 20 µl plated on chocolate agar
plates to assess cell survival, and the rest of the sample ethanol precipitated, and
analyzed for DNA fragmentation by gel electrophoresis. Flow rates were calculated
by dividing the amount of sample lysed by the total time of sample delivery and
expressed as ʅl/seconds.
2.3.3 Results and Discussion
Initial testing of the microfluidic lysing chamber using low-power
microwaves (10, 20, 30%) similar to those used with the static lysing chamber
experiments (sections 2.1 and 2.2), had little effect on the survival rate of N.
gonorrhoeae, regardless of the flow rate (Table 5). However, increasing to higher
microwave powers decreased the concentration of viable N. gonorrhoeae cells in
power-dependent manner (Table 5).
Given that the fluidic reservoir of the flow lysing chip (Figure 19) could only
hold 200 ʅl of lysed sample, the lysing of larger sample volume would require the use
of multiple flow lysing chips or the use of a single chip multiple times. In order to
determine if a flow chip could be used multiple times, the stability of the gold bowtie
50
structures was investigated by using the same chip five times and comparing its
appearance to that of a new flow chip. As shown in Figure 21A, the multi-use of the
flow chip did not affect the integrity of the bowtie structure, contrary to the bowtie
structures in the static lysing chambers, which are destroyed after a single use (Figure
21B).
Concentration
(CFU/mL)
Microwave power
(%)
Flow rate
(ʅl/second)
8.7
6.1
8.7
6.1
8.7
10
108
20
30
6
10
108
106
108
106
108
108
40
6.1
50
60
70
Culture survival
rate (%)
100
100
100
100
90
75 ʹ 90
50
40
25
5 ʹ 10
5
0
0
Table 5. Survival rates of Neisseria gonorrhoeae following microwave irradiation
using the flow lysing chip.
In order to determine the ideal microwave conditions for DNA extraction and
fragmentation using the microfluidic-based lysing approach, N. gonorrhoeae bacterial
suspensions (108 CFU/mL) were exposed to microwave irradiation using conditions
similar to those used for lysing using the static (no flow) lysing chambers (sections
2.1 and 2.2). Preliminary results suggested that exposing N. gonorrhoeae cells to
low-power microwaves (10 and 30%) power did not result in DNA fragmentation or
even DNA extraction (Figure 22A). However, increasing the microwave power to 50
and 70% resulted in increased DNA extraction and fragmentation (Figure 22B and
51
Chapter 3: MAMEF-Based Detection of Chlamydia
3.1 Development and Testing of MAMEF Assays for Chlamydia Trachomatis
3.1.1 Motivation
Current diagnostic tests for the detection of chlamydia (CT) involve
amplification of the target DNA which is time-consuming, expensive, and require
specialized instrumentation. To address the need for inexpensive and faster diagnostic
tests, amplification-less assays based on the Microwave-Accelerated Metal-Enhanced
Fluorescence (MAMEF) technology have been developed.70-73 However, the only
chlamydia MAMEF assay developed so far showed reduced sensitivity and had not
been evaluated with clinical samples.71 In order to overcome the limitations of the
previously-developed chlamydia MAMEF-based assay, experiments were carried out
to increase sensitivity, including changing the sample source from samples in NAATs
buffer to vaginal swabs eluted in water to facilitate the previously described
microwave-based lysing approach. More importantly, a new MAMEF assay targeting
the chlamydial cryptic plasmid was designed, which we speculated would be more
sensitive than the previously-developed assay due to the higher copy number of the
target gene.
3.1.2 Experimental Details
Design of MAMEF-Based DNA Assays
The principles of MAMEF-based assays are based on the complementary
binding of a target DNA sequence to a fluorophore-labeled probe and to an anchor
probe, which is covalently bound to metallic nanoparticles on the assay surface. Only
54
when the target DNA sequence is present will the three-piece assay (target DNA,
fluorophore-labeled, and anchor probe) construct form, thus allowing for the
fluorophore label to come in close proximity to metallic nanoparticles, for MEFbased optical enhancement (Figure 7).
Two MAMEF assays targeting different genes were used during this study.
The first assay targets the C. trachomatis 16S rRNA gene and the details of this assay
have been previously reported.71 A second assay targeting the chlamydial cryptic
plasmid was developed for this study to further increase the sensitivity of the
MAMEF platform and to be used as a confirmatory assay. Similar to the 16S rRNA
MAMEF assay, the cryptic plasmid assay is composed of two probes: the anchor
probe is comprised of 25 nucleotides with a terminal thiol group to bind to silver
nanoparticles. Using this approach, thiolated oligonucleotides can be attached to
plasmonic nanostructured materials via a metal-thiol covalent bond.127-129 The
fluorescent probe is comprised of 26 nucleotides and labeled wLWKD7$05$Œ'\H
at the first nucleotide, which corresponds to the closest position to the metal
nanoparticles when the three-piece DNA construct is formed (Figure 7). The probe
sequences for both the 16S rRNA and the cryptic plasmid-based MAMEF assays are
shown in Table 6. The cryptic plasmid assay was designed to detect the Swedish
chlamydia variant as the probes target a sequence located outside of the 377 bp
deletion region, which has been shown to affect PCR-based detection of
chlamydia.130,
131
The T$05$ΠG\H was selected to match specific wavelength
requirements of MEF79 as well as to enhance transmission through clinical samples
55
which may contain blood for optical sensing, (i.e., it emits in the therapeutic optical
window).132, 133
Assay
16S rRNA
gene
Cryptic
plasmid
Probe VHTXHQFH¶± ¶
Anchor probe
Fluorescent probe
Anchor probe
Fluorescent probe
SH-CTTTTTTGGCGATATTTGGGCATCCGAGTAACG
TMR-GAAGGGGATCTTAGGACCTTTCGGTT
SH-TCCGGAGCGAGTTACGAAGACAAAC
TMR-CGTTGACCGATGTACTCTTGTAGAAG
Table 6. Anchor and fluorescent DNA probe sequences for the 16S rRNA- and cryptic
plasmid-based MAMEF assays for the detection of Chlamydia trachomatis. SH ±
Sulfhydryl group for the attachment of DNA to silver nanoparticles. TMR ± TAMRA dye.
MAMEF-Based CT DNA Assay
The MAMEF assay for detection of CT DNA involved four steps: 1)
preparation of the chlamydia suspension; 2) microwave-based cell lysing and DNA
fragmentation; 3) separation of DNA and cellular debris by centrifugation; and 4)
MAMEF-based DNA detection.
Microwave-based lysing was carried out by
exposing the CT bacterial suspensions, in 2 mL lysing chambers (Figure 9B), to 35
seconds of microwave irradiation at a power corresponding to 270 W over the entire
microwave cavity. The 2 mL lysing chambers were fabricated by deposition of two
equilateral gold triangles (12.3 mm in length and 100 ± 5 nm thick) on glass slides
and a self-adhesive silicon isolator (31 mm x 9 mm) placed over the bowtie region,
creating a lysing chamber. Following the sample processing and lysing steps (steps 1
± 3 as described above), sample testing was carried out in QuantaWellŒ Plates
(Plasmonix Inc., Baltimore, MD) (Figure 23).
Prior to MAMEF-based DNA
detection, each QuantaWellŒ was treated with 250 µl of 20 nM anchor probe to
promote the attachment of the anchor probe to the silver nanoparticles on the wells
via a metal-thiol covalent bond.
127-129
Thiol deprotection of the anchor probe was
56
performed with dithiothreitol (DTT) (Fisher Scientific) using 100 µmol/L DTT in 10
mmol/L TRIS, 1 mmol/L EDTA, pH 7.6, for 3 hours. Following the anchor probe
incubation step, the excess probe was discarded and the wells rinsed with deionized
water to remove unbound probe. DNA detection was carried out by combining 50 µl
of 250 nM fluorescent probe with 200 µl of lysed sample in the anchor probecontaining wells, and exposing the QuantaWellsŒ to 270-W microwave irradiation
for 90 seconds. Prior to fluorescence detection, the silver-coated wells were subjected
to a washing step with deionized water to remove excess unbound fluorescent probe
and sample, and the fluorescence readings collected as described below.
Metal-Enhanced Fluorescence (MEF) Detection
The detection reader consisted of a 532 nm CW laser (Lasermate, Walnut,
CA), where the excitation power is adjusted using an absorbing neutral density filter
wheel (Edmund Optics, Barrington, NJ), with focusing optics (Thor labs) into a 600
µm bi-truncated fiber (Ocean Optics, Dunedin, FL). The bitruncated fiber was used
both to deliver the excitation light to the fluorophore and to collect the fluorescence
emission. A 532 nm notch filter was used to block the excitation light through the
emission channel of the bitruncated fiber, which falls incident onto an Ocean Optics
HD2000 spectrometer (Figure 24). The emission spectrum was recorded from 535 to
700 nm with the maximum fluorescence signal collected at lambda max (580 nm).
57
Figure 23. QuantaWellŒplate for MAMEF-based chlamydia detection. Each well
can hold a volume of 250 µl. Adapted from Melendez et al, 2013.108
Sensitivity and Specificity Testing
The analytical sensitivity of the cryptic plasmid assay was tested through the
use of 10-fold dilutions of C. trachomatis yielding final concentrations of 106 to 0
inclusion-forming units/mL (IFU/mL).
These dilutions were selected because
according to the CDC they are representative of most clinical infections.134 The CT
elementary bodies (EBs) suspensions were prepared in the laboratory of Dr. Charlotte
Gaydos at Johns Hopkins University using a previously described protocol.135 Briefly,
C. trachomatis Serovar E (ATCC, Manassas, VA) cells were used to infect McCoy
cells and the number of CT EBs, determined by fluorescence microscopy, were used
to calculate IFU/mL.
Each dilution was microwave-lysed as previously described
and tested in quadruplet by MAMEF as described above. The limit of detection
(LOD) of the cryptic plasmid assay was calculated based on three times the standard
deviation of the control samples. DNA from a blinded panel of 18 microorganisms
closely genetically related to C. trachomatis, causative agents of other STIs, or likely
58
to be present in human urogenital samples was also tested to determine the analytical
specificity of both the 16S rRNA- and the cryptic plasmid-based assays.
Figure 24. Optical reader for Metal-Enhanced Fluorescence (MEF) detection. Top
± Optical reader with bi-truncated fiber, which both excites and collects MEF emission
from the silvered wells. Bottom ± Inner workings of the optical reader. Adapted from
Melendez et al, 2013.108
3.1.3 Results and Discussion
The LOD of the cryptic plasmid-based MAMEF assay was determined by
testing serial dilutions of C. trachomatis. The assay showed a high analytical
59
sensitivity estimated to be in the order of 10 IFU/mL (Figure 25).108 The LOD of the
cryptic plasmid-based MAMEF assay was lower than that of the 16S rRNA assay,
which was estimated to be around 100 IFU/mL.71
Fluorescence intensity (AU)
1400
1200
1000
800
600
400
LOD
-----------------------------------------------------------------------
200
0
0
1
2
3
4
5
6
7
8
Log (IFU/mL)
Figure 25. Serial dilution plot of the chlamydia cryptic plasmid-based MAMEF
assay. The Log (IFU/mL) of Chlamydia trachomatis was plotted against average
fluorescence intensity. LOD ± Limit of detection. Adapted from Melendez et al, 2013.108
The 16S rRNA-based assay correctly identified all of the CT strains tested,
but also showed cross-reactivity with two different strains of Chlamydia pneumoniae
(Table 7). However, the 16S rRNA-based assay can still be used for detection of
urogenital CT as C. pneumoniae species are not likely to be present in the urogenital
tract.136 The cryptic plasmid MAMEF assay also correctly identified its target, but did
not show cross-reactivity with any other microbial species (Table 7). Overall, these
results suggest that both assays are specific and can be used for urogenital testing of
CT, but that the cryptic plasmid-based assay may be more suitable for non-urogenital
testing since C. pneumoniae can be present in the throat.108
60
Microbial organism
Chlamydia trachomatis IU
Chlamydia trachomatis serovar E
Chlamydia trachomatis serovar L
Chlamydia pneumoniae AR39
Chlamydia pneumoniae T4
Chlamydia psittaci
Neisseria gonorrhoeae
Neisseria meningitidis
Trichomonas vaginalis
Mycoplasma genitalium
Herpes Simplex Virus 1
Herpes Simplex Virus 2
Trichomonas vaginalis
Mycoplasma genitalium
Haemophilus ducreyi
Streptococcus epidermidis
Acinetobacter spp.
Pseudomonas aeruginosa
MAMEF assays
16S rRNA-based
Cryptic plasmidassay
based assay
+
+
+
+
+
+
+
+
-
Table 7. Specificity of the 16S rRNA- and cryptic plasmid-based MAMEF assays.
The assays were tested against a panel of closely-related species, other sexuallytransmitted infections (STIs) or bacterial species commonly present in the urogenital tract.
3.1.4 Conclusions
The development of an additional MAMEF assay (cryptic plasmid) targeting a
gene with a higher copy resulted in an assay with increased sensitivity compared to
the previously developed 16S rRNA assay. Both assays showed high specificity for
detection of urogenital CT, but caution is warranted when using the 16S rRNA assay
for non-urogenital testing due to the cross reactivity of the probes with C.
pneumoniae. MAMEF-based detection of CT can be carried out in less than 10
minutes. The rapid response of the MAMEF technology with the low LOD of the
cryptic plasmid assay could lead to the development of a rapid and sensitive assay for
detection of CT.
61
3.2 Evaluation of Chlamydia MAMEF Assays with Clinical Samples
3.2.1 Motivation
While the initial testing of the CT MAMEF assays with titered C. trachomatis
had suggested that both assays have good analytical performance, it was still
necessary to determine the analytical sensitivity and specificity of the assays with
clinical samples. A preliminary analysis of the 16S rRNA assay with vaginal samples
collected in NAAT Gen-probe® media showed a sensitivity of 60% for detection of
CT (Table 8). During the analysis of samples in Gen-probe® media, it was noted that
samples were often lost to evaporation during the microwave lysing process. In order
to address this problem, vaginal swabs in different buffers were microwave-lysed and
the degree of DNA fragmentation in these samples used to identify the ideal buffer
for microwave-based lysing and MAMEF analysis.
Based on the results of the
evaluation, vaginal swabs eluted in deionized water were chosen as the source of
samples for the clinical validation of the chlamydia MAMEF assay. A blinded study,
using vaginal swabs eluted in water, was then carried out with 257 vaginal swabs to
evaluate the analytical sensitivity and specificity of the MAMEF assays in
comparison to NAAT results.
3.2.2 Experimental Details
Evaluation of Buffers for Microwave-Based Lysing
A total of four buffers were selected for this analysis; deionized water, 1X
phosphate-buffered solution (PBS), sodium chloride solutions (0.25 to 1 % (w/v)) and
Gen-probe® media.
For this analysis, 106 IFU/mL of C. trachomatis were re-
suspended in the different buffers, exposed to microwave irradiation and analyzed for
62
DNA fragmentation. The bacterial suspensions (2 mL) were exposed to microwave
irradiation in the lysing chambers (Figure 9B) for 30, 45, and 60 seconds at a power
corresponding to 270 W over the entire microwave cavity. Following microwave
irradiation, the condition of the samples was noted, and, if available, the resulting
samples were concentrated by ethanol precipitation, and used for DNA fragmentation
analysis by gel electrophoresis.
Clinical Samples
9DJLQDO VZDEV FROOHFWHG DW WKH &LQFLQQDWL &KLOGUHQ¶V 0HGLFDO &HQWHU¶V 7HHQ
Health Center (Cincinnati, Ohio) from December 2010 through March 2012 were
included in the study. Duplicate swabs were tested locally for CT by the NAAT
ProbeTecΠassay (Becton Dickinson, Sparks, MD). The specimens (vaginal swabs)
for MAMEF analysis were collected and stored frozen at -80ºC. The frozen vaginal
swabs were shipped to the Johns Hopkins School of Medicine, given a coded
identification number, and then given to the Institute of Fluorescence as blinded
samples for testing by the CT MAMEF assays.
DNA Extraction and Fragmentation (Clinical Samples)
Vaginal swabs were transferred frozen to 15 ml conical tubes, and 2 mL of
autoclaved, deionized water added to each swab. Following a 20-minute incubation
step, the swabs were vortexed for 10 seconds and excess liquid removed by pressing
the swab against the side of the tube.
A 200-µl aliquot of each sample was
transferred to NAAT Gen-Probe® media and stored frozen for future testing by the
Aptima Combo2 NAAT (GenProbe Hologic, San Diego, CA) in the event of
discordant results between the ProbeTecΠDVVD\ DQG 0$0() '1$ IURP WKH
63
remainder sample (approximately 1.5 mL) was extracted using the previously
described gold bowtie focused microwave lysing approach with minor modifications.
70-73
Briefly, the lysing chambers were prepared as described in section 2.1.2. The
swab elute was placed in the lysing chamber, and exposed to 35 seconds of
microwave irradiation at a power corresponding to 270 W over the entire microwave
cavity. The lysed sample was collected, centrifuged at 6000 RPM for 3 minutes, and
the supernatant tested for CT DNA by the MAMEF assays as described below.
MAMEF-Based CT DNA Detection
Following the sample processing and lysing steps as described above, sample
testing was carried out in QuantaPlatesΠ(Plasmonix Inc., Baltimore, MD) (Figure
23). Prior to MAMEF-based DNA detection, each QuantaPlateΠwell was treated
with 250 µl of 20 nM anchor probe to promote the attachment of the anchor probe to
the silver nanoparticles on the wells via a metal-thiol covalent bond.
Thiol
deprotection of the anchor probe was performed with dithiothreitol (DTT) (Fisher
Scientific) using 100 µmol/L DTT in 10 mmol/L TRIS, 1 mmol/L EDTA, pH 7.6, for
3 hours. Following the anchor probe incubation step, the excess probe was discarded
and the wells rinsed with deionized water to remove unbound probe. DNA detection
was carried out by combining 50 µl of 250 nM fluorescent probe with 200 µl of lysed
sample in the anchor probe-containing wells, and exposing the QuantaWellsΠto
270-W microwave irradiation for 90 seconds. All samples were tested in duplicates
using both the 16S rRNA- and cryptic plasmid-based CT MAMEF assays.
A
negative control consisting of pooled CT-negative samples, and a CT-positive sample
were tested in parallel to unknown samples. Prior to fluorescence detection, the
64
silver-coated wells were subjected to a primary washing step with deionized water to
remove excess unbound fluorescent probe and sample. Fluorescence readings were
collected using a 532 nm CW laser and a 600 µm bi-truncated fiber as described in
section 3.1.2 (Figure 24). Following the collection of fluorescence data, all samples
were subjected to a secondary rinsing step as outlined below.
Post-MAMEF Analysis
Initial testing of the MAMEF assays with clinical samples resulted in two
groups of NAAT chlamydia-negative samples with different fluorescence intensity
levels, which was hypothesized to be due to unbound fluorescent probe. The first
group of NAAT chlamydia-negative samples ± represented by Sample 1 in Figure 26
- showed low fluorescence intensity levels below the threshold of positivity
characteristic of a chlamydia-negative sample. The second group of NAAT
chlamydia-negative samples ± represented by Sample 2 in Figure 26 ± initially
showed elevated fluorescence intensity levels, which decreased to levels below the
threshold of positivity following a secondary washing step. The secondary washing
step appeared to have removed unbound fluorescent probe. The secondary washing
step, however, did not significantly decrease the fluorescence intensity levels of
chlamydia-positive samples (Sample 3 ± Figure 26). Following the initial testing with
known samples, all unknown clinical samples were tested in a blinded manner and the
MAMEF results reported as follows. Any unknown sample with a fluorescence
intensity level equal or below the threshold of positivity was reported as chlamydianegative. A sample was reported as chlamydia-positive if the fluorescence intensity
level was above the threshold of positivity following the secondary washing step.
65
in a sample can result in DNA fragments not suitable for MAMEF analysis.137 A tenfold dilution of samples in Gen-probe® prevented evaporation, but the fragmented
DNA could not be visualized by gel electrophoresis possibly due to the low
concentration of CT DNA in the diluted sample (data not shown). On the contrary, C
trachomatis resuspended in deionized water did not evaporate during the microwave
process and resulted in DNA fragments less than 100 bps, which are suitable for
DNA analysis.108
Next, the effect of buffer on MAMEF performance was investigated by testing
vaginal swabs eluted in water and comparing the results to those obtained from
samples in Gen-probe® media.
Overall, the 16S rRNA-based MAMEF assay
performed better with vaginal swabs eluted in water than with samples collected in
Gen-probe® media in terms of sensitivity (86.4 vs 59.4%) and overall concordance
(87.5 vs 60.0 %), when compared to NAAT results (Table 8). The increased
sensitivity of the MAMEF assay with vaginal samples eluted in water may be the
result of higher concentration of fragmented DNA in these samples as compared to
those in Gen-probe® media, which was suggested by the buffer experiments described
above.
Overall
Sensitivity
concordance
(%)
(%)
Buffer
NAAT+ /
MAMEF +
NAAT+ /
MAMEF -
NAAT- /
MAMEF +
NAAT- /
MAMEF -
Genprobe®
media
19
13
7
11
59.4
60.0
Water
19
3
1
9
86.4
87.5
Table 8. Performance of the chlamydia MAMEF assay with samples in two different
buffers. Vaginal samples in Gen-probe® media and dry swabs eluted in water were tested
using the 16S rRNA MAMEF assay.
67
In regards to the blinded analysis using clinical samples, MAMEF results
were available for 257 of the 260 vaginal swabs analyzed (98.8%). Three samples
(one CT-positive) were excluded from the analysis due to loss of sample during the
cell lysing procedure. As shown in Table 9, of the 45 NAAT CT-positive samples
and 212 negative samples, 33/45 and 197/212 were correctly identified by both the
16S rRNA-based and the cryptic plasmid- MAMEF assays. Additional testing of
MAMEF-positive samples by the second NAAT (Aptima) identified four additional
CT-positive samples that were negative by the first NAAT. The calculated clinical
sensitivity and specificity of both MAMEF assays being required to be positive in
comparison to NAAT were 73.3% (33/45) (95% CI, 60.4 to 86.2%) and 92.9%
(197/212) (95% Cl, 89.8 to 96.0%), respectively. The 16S rRNA-based MAMEF
assay (Table 9) had a sensitivity of 75.5% (34/45) (95% Cl, 62.9 to 88.1%), and
specificity of 92.9% (197/212) (95% Cl, 89.8 to 96.0%), when compared to NAAT
results. The cryptic plasmid-based MAMEF assay had a sensitivity and specificity of
82.2% (37/45) (95% Cl, 71.0 to 93.4%), and 92.9% (197/212) (95% Cl, 89.8 to
96.0%), respectively (Table 9). The overall agreement of MAMEF with NAAT was
89.5% (95% Cl, 85.4 to 92.8%) for the 16S rRNA assay and 91.0% (95% Cl, 87.3 to
94.5%) for the cryptic plasmid-based assay.108 The two CT MAMEF assays have
substantial agreement (kappa = 64.6%, and 70.8% for the 16S rRNA and plasmid
assay, respectively) with NAAT results for the 257 vaginal swab samples analyzed.
The total time to detection was less than 10 minutes, which included a 35-second
DNA extraction and fragmentation microwave lysing step, a 3-minute centrifugation
68
step, and the microwave-accelerated and fluorescence-based detection of target CT
DNA in less than 5 minutes.
MAMEF
Assays
NAAT+ /
MAMEF +
NAAT+ /
MAMEF -
NAAT- /
MAMEF +
NAAT- /
MAMEF -
Clinical
Sensitivity
(%)
Overall
concordance
(%)
Cryptic
plasmid
37
8
15
197
82.2
91.1
16S
rRNA
34
11
15
197
75.5
89.9
Both
assays
33
12
15
197
77.3
89.5
45 NAAT-positive
212 NAAT-negative
Table 9. Comparison of MAMEF assays vs nucleic acid amplification tests (NAATs). 257
vaginal swabs were analyzed by the MAMEF assays for the detection of CT.
One of the limitations of this study was the number of samples with
discordant MAMEF and NAAT results.
Of the 257 samples analyzed, 27 had
discordant MAMEF and NAAT results (Table 9). Twelve samples identified as CTpositive by the 3UREH7HFΠNAAT were MAMEF-negative by both the 16S rRNA
and the cryptic plasmid assay. All 12 samples were confirmed as CT-positive by the
Gen-Probe® NAAT. This equates to a total 12 missed positives (false-negatives) by
combined results of both MAMEF assays, which included 11 false-negatives by the
16S rRNA assay and 8 samples that were missed by the cryptic plasmid assay (Table
9).
Fifteen samples identified by the 3UREH7HFΠNAAT as CT-negative were
MAMEF-positive by both the 16S rRNA and the cryptic plasmid assay. All 15
samples also tested negative by the Gen-Probe® NAAT. The reason for these falsepositive results is unknown. However, cross-reactivity of the probes with other STIs
69
is unlikely to be the primary reason for the false-positive results as only 20% (3/15)
of the NAAT-negative/MAMEF-positive samples were positive for another STI and
specificity testing (see section 2.1) showed no cross-reactivity of the MAMEF probes
with other STIs. Additionally, no cross-reactivity with other STIs was noted in CTnegative samples, as 18% (35/197) of the NAAT/MAMEF CT-negative samples were
positive for another STI.
Unfortunately, further testing of the samples with
NAAT/MAMEF discordant results was not possible due to sample availability.
3.2.4 Conclusions
The limitation of DNA extraction and fragmentation from clinical samples for
MAMEF-based detection of CT was overcome by selecting a buffer (deionized
water) which could be used for microwave-based lysing without substantial loss of
analyte due to sample evaporation.
More importantly, it was shown that both
MAMEF assays (the 16S rRNA and the cryptic plasmid assay) can be used for the
rapid and sensitive detection of CT directly from vaginal swabs in less than 10
minutes. The cryptic plasmid MAMEF assay was found to be more sensitive than the
16S rRNA71 assay for the detection of CT from vaginal swabs, which is consistent
with the results using cultured CT.108 The validation of the CT MAMEF assays with
clinical samples is a step forward towards the development of a low-cost, rapidturnaround, sensitive and specific test for Chlamydia trachomatis detection.
70
Chapter 4: MAMEF-Based Detection of Gonorrhea
4.1.1 Motivation
Similar to chlamydia, there is an urgent need for rapid tests which can
correctly identify all gonorrhea-infected individuals at the first doctor/health provider
visit. This need is heightened by the threat of antimicrobial-resistant gonorrhea,
which has recently become a major public health concern worldwide.5, 6, 138 While
NAATs offer several advantages over traditional detection methods (cultures) for
detection of gonorrhea, there are several limitations including cost, speed, and in
some cases, lack of specificity. Non-NAAT point-of-care (POC) tests can provide
expedited test results (less than one hour), but the sensitivity of these assays is highly
variable (12 ± 87%).139 The motivation for this work was to develop a MAMEF-based
assay for the sensitive and rapid detection of gonorrhea. The MAMEF platform has
the potential to help alleviate some of the fundamental limitations of NAATs
including cost, speed, and the need for sophisticated instrumentations, which are not
readily available in developing countries.
4.1.2 Experimental Details
Design of Gonorrhea MAMEF Assay
The porA pseudogene was selected as the target for the MAMEF assay
because it is highly conserved across Neisseria gonorrhoeae subtypes and assays
targeting this gene have been found to be highly specific for N. gonorrhoeae DNA.26,
140, 141
The sequences of the probes for the porA-based MAMEF assay are shown in
71
Table 10.
The anchor probe is modified with a sulfhydryl group for silver
attachment, while the fluorescent probe contains a TAMRA dye.
Assay/target
PorA
pseudogene
OPA
gene
Anchor probe
Fluorescent probe
Anchor probe
Fluorescent probe
3UREHVHTXHQFH¶± ¶
SH ± GCCGTCGTAAGTTAAACAAGG
TMR ± GTCGTTCAGGCGGATATGCGGAC
SH ± GAAACACCGCCCGGAACCCG
TMR ± ATCCGTCCTTCAACATCAGTGAAA
Table 10. Anchor and fluorescent DNA probe sequences for the porA- and opabased MAMEF assays for the detection of Neisseria gonorrhoeae.
SH ±
Sulfhydryl group for the attachment of DNA to silver nanoparticles on the assay
platform surface. TMR ± TAMRA dye.
The detection of gonorrhea DNA by MAMEF involved four steps: 1)
preparation of bacterial suspensions/clinical samples; 2) microwave-based cell lysing
and DNA fragmentation; 3) separation of DNA and cellular debris by centrifugation;
and 4) MAMEF-based DNA detection.
DNA Extraction and Fragmentation
Microwave-based lysing was carried out by exposing bacterial suspensions, in
2 mL lysing chambers (Figure 9B), to 35 seconds of 270-W microwave exposure.
The lysing chambers were prepared as described in section 3.1.2. Extraction and
fragmentation of DNA from bacterial suspensions and vaginal swabs was carried out
using the previously described microwave lysing protocol (sections 2.1.2 and 3.2.2).
Briefly, vaginal swabs were transferred frozen to 15 mL conical tubes and 2 mL of
autoclaved, deionized water added to each swab. Following a 20-minute incubation
step, the swabs were vortexed for 10 seconds and excess liquid removed by pressing
the swab against the side of the tube. The eluted sample was then extracted using the
previously described focused microwave lysing approach (35 seconds of 270-W
72
microwave exposure). The lysed sample was collected, centrifuged at 6000 RPM for
3 minutes, and the supernatant tested for gonorrhea DNA by the MAMEF assay as
described below.
MAMEF-Based DNA Detection
Following the sample processing and lysing steps as described above, sample
testing was carried out in QuantaPlateΠ96-well plates (Plasmonix Inc., Baltimore,
MD) (Figure 23). DNA detection was carried out by combining 50 µl of 250 nM
fluorescent probe with 200 µl of lysed sample in the anchor probe-containing wells,
and exposing the wells to 90 seconds of 270-W microwave irradiation. Prior to
fluorescence detection, the silver-coated wells were subjected to a washing step with
deionized water to remove excess unbound probe and sample, and the fluorescence
readings collected using a 532 nm CW laser and a 600 µm bitruncated fiber as
described in section 3.1.2.
Sensitivity and Specificity Testing
The analytical sensitivity of the porA-based MAMEF assay was tested
through the use of 10-fold dilutions of Neisseria gonorrhoeae yielding final
concentrations of 108 to 0 CFU/mL. The bacterial suspensions were prepared by
measuring the absorbance at 600 nm and diluting the cells in autoclaved, deionized
water to a final concentration of 108 CFU/mL by comparing the turbidity to a 0.5
McFarland standard (Fisher Scientific). Each dilution was microwave-lysed as
previously described and tested in quadruplet by MAMEF as described above. The
limit of detection (LOD) of the assay was calculated based on three times the standard
deviation of the control samples. DNA from a blinded panel of 18 microorganisms
73
closely genetically related to Neisseria gonorrhoeae, causative agents of other STIs,
or likely to be present in human urogenital samples was also tested to determine the
analytical specificity of the porA-based MAMEF assay.
4.1.3 Results and Discussion
The porA-based MAMEF assay showed high specificity when isolates of
other Neisseria species (n = 4), pathogens causing other STIs (n = 8) and other
bacterial species commonly present in the urogenital tract were tested (Table 11).
porA-based
MAMEF assay
+
-
Microbial organism
Neisseria gonorrhoeae
Neisseria sicca
Neisseria meningitidis
Neisseria subflava
Neisseria lactamica
Chlamydia trachomatis E
Chlamydia trachomatis L
Chlamydia trachomatis G
Chlamydia pneumoniae
Herpes Simplex Virus 1
Herpes Simplex Virus 2
Trichomonas vaginalis
Mycoplasma genitalium
Haemophilus ducreyi
Escherichia coli
Pseudomonas aeruginosa
Staphylococcus aureus
Staphylococcus epidermidis
Table 11. Specificity of the porA-based MAMEF assay. Reactivity of the porA-based
MAMEF assay against a panel of closely-related Neisseria species, other sexuallytransmitted infections (STIs) or bacterial species commonly present in the urogenital tract.
In order to determine if the MAMEF probes could detect gonorrhea DNA
directly from clinical samples, a small cohort of vaginal swabs was analyzed with the
porA MAMEF assay.
In comparison to NAAT results, the MAMEF assay showed
74
good sensitivity and specificity for detection of N. gonorrhoeae DNA directly from
vaginal swabs (Table 12).
The concordance of the gonorrhea MAMEF assay with
NAAT results (90%), using a small cohort of swabs, is similar to that obtained with
the chlamydia assay (Chapter 3). This preliminary analysis further supports the ability
of MAMEF to detect target DNA directly from clinical samples.
NAAT+ /
MAMEF +
NAAT+ /
MAMEF -
NAAT- /
MAMEF +
NAAT- /
MAMEF -
Sensitivity
(%)
5
1
1
13
83.3
6 NAAT-positive
Overall
concordance
(%)
90.0
14 NAAT-negative
Table 12. Comparison of the porA-based MAMEF assay vs NAATs results for the
detection of Neisseria gonorrhoeae from vaginal swabs.
Next the analytical sensitivity of the porA-based MAMEF assay was
investigated by testing serial dilutions of microwave-lysed N. gonorrhoeae.
As
shown in Figure 27, a dose-dependent response was observed when the assay was
tested with bacterial dilutions with concentrations higher than 106 CFU/mL, but not
with lower concentrations of N. gonorrhoeae.
Despite multiple changes to assay
conditions (increasing probe concentration, increasing/decreasing microwave
irradiation time, and changes to the microwave lysis conditions), the sensitivity of the
assay did not improve (data not shown).
The exact reason for the poor analytical
performance of this assay is not known, but it is likely related to the concentration of
porA target DNA in N. gonorrhoeae cells. As reported in literature,142 the porA
pseudogene is a single copy gene in N. gonorrhoeae, therefore detection of this gene
through amplification-less molecular approaches, such as MAMEF might be difficult.
75
Additionally, previous studies have shown that the sensitivity of NAATs targeting the
porA pseudogene is lower than NAATs targeting multi-copy genes.27, 143 Due to the
poor sensitivity of the porA-based MAMEF assay, a blinded study comparing
MAMEF vs NAATs for the detection of N. gonorrhoeae was not carried out during
this study.
Average fluorescence intensity (AU)
350
300
250
200
150
100
50
0
-1
0
1
2
3
4
5
6
7
8
9
Log (CFU/mL)
Figure 27. Serial dilution plot of the porA-based MAMEF assay for detection of
Neisseria gonorrhoeae. The Log (CFU/mL) of Neisseria gonorrhoeae was plotted
against average fluorescence intensity.
To increase the sensitivity of the gonorrhea MAMEF assay, a new assay
targeting the opa gene was designed (Table 10) and work in the laboratory is ongoing
to define assay parameters. This gene was selected because it is a common target of
NAATs,26, 139 it is a multi-copy gene (11 copies in the N. gonorrhoeae genome),144
and opa-based NAATs are more sensitive than those targeting the multi-copy 16S
rRNA gene.145 Further support for the selection of a multi-copy gene as a target is
provided by the research presented in this study on the MAMEF-based detection of
76
chlamydia (Chapter 3).
The results revealed a 10-fold difference in sensitivity
between the multi-copy chlamydial cryptic plasmid MAMEF assay and the singlecopy chlamydial 16S rRNA MAMEF assay.108
4.1.4 Conclusions
The MAMEF platform was used to develop an assay for the sensitive and
rapid detection of gonorrhea from clinical samples. The target (the porA pseudogene)
for the assay was selected because this gene is highly conserved across N.
gonorrhoeae subtypes and is the most specific target for the molecular detection of N.
gonorrhoeae. The results presented here suggested that the porA pseudogene is not a
suitable target for the MAMEF-based detection of gonorrheal DNA when the analyte
is present at low concentrations. This was a disappointing and unexpected result
given that high levels of sensitivity were achieved with the chlamydia MAMEF assay
even when a single-copy gene (16S rRNA) was targeted.108 The specificity of the
porA-based MAMEF assay was high, which is consistent with previous reports.26, 140,
141
The development of a new assay targeting the multi-copy opa gene should prove
useful in increasing the sensitivity of the MAMEF platform for detection of Neisseria
gonorrhoeae.
77
Chapter 5: MAMEF-Based Detection of Salmonella in Various
Biological Matrices
Overview and Motivation
Unlike STIs, invasive Salmonella infections are associated with a high risk of
mortality. The current gold standard diagnostic tests for typhoid fever and nontyphoidal Salmonella (NTS) infections can be invasive, expensive, time-consuming,
and the instrumentation required for diagnosis are not readily available in developing
countries. The use of PCR-based approaches for the detection of Salmonella directly
from blood and feces has received much attention over the last decade. However,
PCR is not an established method for detection of typhoid fever, often lacking the
required level of sensitivity to detect low bacterial load in blood, and isolation of
Salmonella cells can be hindered by the complexity of the blood matrix. In terms of
NTS in feces, the complexity of the fecal matrix often hinders detection by molecular
approaches. There are several commercial kits available for the extraction of DNA
from blood, but they are expensive, time-consuming, and the resulting sample
contains both bacterial and human DNA, which can affect detection when the target is
present in low concentrations. Considering all of the limitations associated with
isolation and detection of Salmonella directly from blood and feces, fast, inexpensive
and sensitive methods are required. In order to address this need, a MAMEF-based
assay for the detection of Salmonella has been developed.72 However, similar to other
molecular assays, attempts to detect Salmonella directly from blood have not been
reproducible, and detection of Salmonella from feces, using MAMEF, has not been
evaluated.
78
In the present study, the successful detection of Salmonella from white blood
cells (WBC) is presented following a two-step approach involving the separation of
WBC from erythrocytes and clotting factors, followed by microwave-based lysing
and MAMEF detection of Salmonella. Results on the MAMEF-based detection of
typhoidal and NTS in stool are also presented. This study was a collaborative effort
with researchers from the Center for Vaccine Development (CVD) at the University
of Maryland School of Medicine.
Bacterial Strains and Blood (Sections 5.1 and 5.2)
The attenuated Salmonella typhi OLYH RUDO YDFFLQH VWUDLQ &9' ǻaroC
ǻaroD ǻhtrA Ptac-tviA)146-148 was used to safely spike WBC isolated from whole
blood. Non-Salmonella strains used to determine specificity of the MAMEF assays
included Escherichia coli Bort, Pseudomonas aeruginosa PA01 and Klebsiella
pneumoniae B5055 from collections at the CVD.
Salmonella typhi, E. coli, P.
aeruginosa and K. pneumoniae were grown in Hydrosulphite of Sodium (HS)
bacteriological medium (5 g sodium chloride, 10 g soytone (Teknova, Hollister, CA),
5 g Hy Yest 412 (Sigma Aldrich) in 1 L distilled water at 37oC. Culture medium for
CVD 909 was supplemented with 2,3-dihydroxybenzoate (DHB) (0.0001% w/v).
Human blood with sodium heparin anticoagulant was purchased from Innovative
Research (Novi, MI). For the buffy coat experiments, fresh blood was obtained from
volunteers under the approval of the University of Maryland, Baltimore Institutional
Review Board and used within 8 hours of collection.
79
5.1 Isolation, DNA extraction and Fragmentation of Salmonella from Blood
5.1.1 Experimental Details
Blood Separation Experiments
Molecular detection of Salmonella from blood is often hindered by the
presence of clotting factors and red blood cells (RBC). Recognizing that about 60%
of Salmonella in the blood of an infected individual are found in the WBC, and that
evaluation of isolated WBC has the same sensitivity as blood cultures,44 an evaluation
of different techniques was carried out to develop a method to isolate WBC for
testing by MAMEF. Six approaches to separate WBC from RBC were evaluated,
including RBC lysis buffer, ammonium chloride lysis buffer, distilled water, BD
Vacutainer® &37Œ tubes, dextran, and lymphocyte separation medium. Following
the removal of RBC, WBC pellets were suspended in various diluents (1X TE buffer,
1X PBS, 0.05x PBS, animal product-free (APF)-LB Lennox medium (Athena
Environmental Sciences, Baltimore, MD) and 1X TE buffer plus 5 g/L of NaCl. The
blood treatment experiments to separate RBC from WBC were carried out at the CVD
and the details of the separation techniques are presented in Appendix A.
Following the lysis of RBC, WBCs were re-suspended in 1 mL of various
diluents. Overnight cultures of bacteria (109 CFU/mL) were diluted to the desired
concentration in PBS and 10 µl of bacteria was added to the WBC suspension. The
bacteria spiked-WBC suspensions were exposed to microwave irradiation in a large
lysing chamber (Figure 9B) for 25 seconds at a power corresponding to 270-watt over
the entire microwave cavity. In order to determine the optimal media for microwavebased lysis, Salmonella was lysed in 1 mL of water, 1X PBS, 0.05x PBS, APF-LB
80
and 1X TE buffer plus 5 g/L of NaCl. Lysing efficiency was determined by plating
pre- and post-lysed samples on agar plates and performing viable colony counts to
determine the percentage of bacteria that were lysed. For visualization of DNA
fragments on a gel, 1 mL of overnight bacterial culture containing 109 CFU
Salmonella was pelleted, resuspended in 1 mL TE plus 5 g/L NaCl, and added to the
WBC separated from 2 ml of whole blood with red blood cell lysis buffer. The
suspension was then microwave-lysed and DNA was ethanol precipitated with 0.1X
volume of 3 M sodium acetate pH 5.2 and 2X volume of pre-chilled molecular grade
ethanol. DNA was pelleted, washed with 70% ethanol, air-dried and resuspended in
30 µl of TE and the entire volume was electrophoresed on a 2% agarose gel. DNA
fragments were visualized by staining with ethidium bromide to identify double
stranded DNA or SYBR® Gold (Invitrogen, Eugene, OR) to identify single stranded
DNA. DNA fragment sizes were verified with the Agilent 2100 Bioanalyzer (Agilent
Technologies, Santa Clara, CA). For samples that were subsequently analyzed by
MAMEF, microwave-lysed samples were centrifuged at 7,000 x g to pellet the cell
debris, the supernatant was ethanol precipitated, and the DNA resuspended in 250 µl
of nuclease free water.
5.1.2 Results, Discussion and Conclusions
The results of the evaluation of various blood treatment methods indicated
that RBC lysis buffer was the cheapest and best isolation method for the separation of
RBC from WBC.137 In terms of the lysis of Salmonella in WBC, 100% lysis of
Salmonella was observed when the Salmonella-spiked WBC were resuspended in 1
mL TE plus 5 g/L of NaCl, and exposed to microwave irradiation. Resuspension of
81
the Salmonella-spiked WBC in the other buffers (water, TE, 1X and 0.05 PBS and
AF-LB medium) resulted in lower lysing efficiency ranging from 50 ± 90%, while
samples resuspended in 1X PBS boiled over during microwave irradiation. The
finding that 1X PBS is not a suitable buffer for microwave-based lysing is consistent
with those obtained during the lysing of Neisseria gonorrhoeae (Section 2.1). The
degree of DNA fragmentation of Salmonella-spiked WBC in the different buffers
followed the same trend as those observed for lysing efficiency. The exposure of
Salmonella-spiked WBC (re-suspended in media containing 80 mml/L NaCl) to
microwave irradiation for 25 seconds at a power corresponding to 270-W, resulted in
DNA fragments suitable for MAMEF-based DNA sensing.137
Based on these
experiments, it was concluded that the most suitable buffers for the isolation and
fragmentation of DNA from Salmonella-spiked WBC were 1X TE with 80 mmol/L of
NaCl or APF-LB medium, which was the buffer used during the initial development
of the Salmonella MAMEF assay.72 The experiments described in this section
identified a cheap and reliable method to remove RBC from blood samples, resulting
in a suitable sample for microwave-based lysing and MAMEF-based DNA detection
as discussed in section 5.2 below.
5.2 MAMEF-Based Detection of Salmonella in Blood
5.2.1 Experimental Details
Lysis of Salmonella-Spiked WBC by Microwave Irradiation
In order to determine the sensitivity of the MAMEF assay for detection of
Salmonella in blood, Salmonella-spiked WBC samples were microwave-lysed and
tested on the MAMEF platform using the procedure outlined in Figure 28. Briefly,
82
WBC were separated from 2 mL of whole blood with blood cell lysis buffer and
resuspended in 1 mL of 1X TE buffer containing 5 g/L of NaCl, and spiked with 10
ʅl of Salmonella suspension of different concentrations resulting in WBC-spiked
samples with 0 to 400 CFU of Salmonella typhi. The protocol for the separation of
WBC from whole blood is described in Appendix A. The Salmonella-spiked WBC
samples (1 mL) were placed in the lysing chamber (Figure 9B) and exposed to
microwave irradiation for 25 seconds at 270-watt over the entire microwave cavity,
followed by ethanol precipitation, and resuspension of the DNA pellet in 250 µl of
nuclease free water. Lysing chambers with gold bowtie structures were prepared as
previously described (see section 2.1.2).
Sample
preparation
Isolation and
spiking of WBC
Microwave
lysis
Sample
purification
Lysing of WBCspiked samples in TE
Ethanol
precipitation
MAMEF
oriC-based
MAMEF assay
Figure 28. Flow chart of procedures used for the MAMEF-based detection of
Salmonella in blood.
Probes for MAMEF-Based Detection of Salmonella
The probes for the MAMEF assay have been previously described and are
specific for the oriC locus, which is common to all Salmonella species.72 The anchor
SUREH¶-SH-GTTTTTCAACCTGTTTTGCGCC-¶FRQWDLQVDterminal thiol group
DW WKH ¶ HQG to bind to the silver surface, while the IOXRUHVFHQW SUREH ¶ 705-
83
CTTTCAGTTCCGCTTCTAT-¶ contains a TAMRA dye.
All probes were
purchased from Sigma-Aldrich.
Deposition of Silver Island Films (SIFs) on Glass Substrates
Old Deposition Method (ODM)
For detection of Salmonella DNA using the MAMEF platform, Silver Island
Films (SIFs), which provide the metallic nanoparticles for metal-enhanced
fluorescence, were prepared using the Tollens reaction as previously described.95
Briefly, AgNO3 (0.5 g in 60 mL of deionized water) was combined and stirred with
200 ʅl of 10% NaOH in a 100 mL beaker to form a precipitate of silver particles.
The precipitates of silver particles were re-dissolved through the addition of 2 mL of
30% NH4OH, followed by cooling in an ice bath. Microscope slides, pre-treated with
(3-aminopropyl)triethoxysilane (APS), were then placed in the beaker containing the
silver particles, 13 mL of 4.8% glucose added to the solution, and the temperature of
the resulting solution increased to 30ͼC. After the solution turned from yellow-green
to yellow-brown, the slides were removed, rinsed with deionized water, and stored in
DI water for future use.
New Deposition Method (NDM)
In order to increase the uniformity of silver nanoparticles deposition on APScoated slides, a new protocol was developed, which utilized the same substrates and
reagents as the protocol described above with slight modifications. Briefly, AgNO3,
NaOH, and NH4OH were combined in a beaker and placed on ice for 10 minutes.
Following the incubation step, glucose was added to the solution, the APS-coated
slides placed in the solution, kept on ice for 10 minutes, followed by a 4-minute
84
heating step at 200ͼ C, and incubated for three minutes without heat. The primary
difference between the two SIFs deposition protocols was that in the second method
(NDM) the silver nanoparticles are deposited without stirring.
Detection of Salmonella DNA by MAMEF
In order to construct the assay platform, self-adhesive silicon isolators,
containing eight circular wells (2.5 mm by 9 mm), were placed over the SIFdeposited glass slides (Figure 29). A 100 nM solution of anchor probe (100 ʅl) in 1X
TE, treated with dithiothreitol (DTT), was placed in each well and incubated for 20
minutes at room temperature to allow for binding of the anchor probe to the metallic
nanoparticles of the SIFs.
MAMEF-based DNA detection was performed by
combining 75 µl of 250 nM fluorescent probe (TAMRA) with 75 µl of the lysed
WBC samples in the anchor probe-containing wells, and heating the samples in a
microwave cavity (900-watt) for 60 seconds at 20 % power. All samples (controls
and Salmonella-spiked WBC lysed samples) were tested in triplicate. Prior to
fluorescence detection, the sample wells were subjected to a washing step with deionized water to remove excess unbound fluorescent probe and sample, and the
fluorescence emission collected as previously described in section 3.1.2. Briefly, the
fluorescence signals were measured using a 532 nm diode laser and a Fiber Optic
Spectrometer (HD2000) from Ocean Optics, Inc. by collecting the emission intensity
through a 532 nm notch filter.
85
Figure 29. Silver Island Films (SIFs) MAMEF detection surface. SIFs
deposited on APS-treated microscope slides are covered with a multi-well silicone
isolator to allow for the simultaneous testing of eight samples.
5.2.2 Results and Discussion
The specificity of the oriC MAMEF probes for Salmonella species has been
previously demonstrated using DNA from a blinded panel of microorganisms
commonly associated with bloodstream infections (BSIs).72 However, in order to
ensure the same level of specificity in the setting of blood samples, the MAMEF
assay was tested against WBC spiked with three of the most common BSI-causing
pathogens - Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae and showed the same degree of specificity for Salmonella species as previously
reported.72 Using the MAMEF platform, Salmonella was detected in microwavelysed, WBC-spiked samples containing as low as 4 CFU of Salmonella typhi (Figure
30).
However, there was considerable variability in the levels of fluorescence
intensity from samples with the same concentration of Salmonella (Figure 31). The
variability in fluorescence intensity can be the result of a variety of reasons. First, the
concentration of DNA in WBC spiked with the same concentration of Salmonella
could have been different due to the contribution of DNA from non-viable cells.
Second, variations in cell lysing efficiency could have affected the total concentration
of DNA in the sample even if two samples were spiked with the same concentration
86
deposition method can lead to the development of SIFs with increased uniformity,
which could potentially decrease the variability of results observed during the
MAMEF-based detection of Salmonella from WBC-spiked samples. Unfortunately,
further testing of Salmonella-spiked WBC samples with the NDM-generated SIFs
was not performed due to time and funding constraints.
5.2.3 Conclusions
The oriC-based MAMEF assay was shown to detect as low as 4 CFU of
Salmonella typhi spiked into WBC isolated from 2 mL of blood.
However,
variations in fluorescence signal intensity from replicate control and experimental
samples prevented reliable detection of samples with lower concentrations of
Salmonella. Preliminary results suggested that the uneven deposition of silver
nanoparticles on SIFs can result in intra-SIF variation, thus affecting the reproducible
enhancement of the signal. The deposition of silver nanoparticles using an alternative
method has shown promise in the generation of more uniformed SIFs. The adaptation
of a rapid cellular lysis method, combined with the sensitivity of the MAMEF
platform represents a fundamental breakthrough towards the development of a rapid
and sensitive assay for the detection of Salmonella directly from blood.
5.3 MAMEF-Based Detection of Salmonella in Stool
5.3.1 Overview and Experimental Details
Similar to the detection of typhoidal Salmonella in blood, molecular detection
of Salmonella in stool is often hindered by the complexity of the sample medium and
by the high background signal associated with the presence of other non-target
91
bacterial species. In order to address the issue of sample complexity, the microwave
lysing approach was investigated in conjunction with several commercial lysing and
DNA purification kits to develop a DNA extraction method suitable for downstream
MAMEF analysis. Additionally, two new assays were developed for the specific
detection of the two most common causes of non-typhoidal Salmonella (NTS) ± S.
enteriditis and S. typhimurium. The results described here are a collaborative effort
between researchers at the Center for Vaccine Development (CVD) at the University
of Maryland School of Medicine and the University of Maryland Baltimore County.
DNA Extraction and Fragmentation
Based on experiments conducted at the CVD, it was reported that microwavebased lysis was most efficient at lysing Salmonella in spiked stool samples than other
beads-based approaches (data not shown). Furthermore, stool samples suspended in
TE were more efficiently lysed than those in water and that the addition of NaCl (5
g/L) to TE buffer decreased the time required for complete microwave-based lysis
(based on viable cell counts) from 60 to 30 seconds. However, the large amount of
debris in the lysed sample prevented the MAMEF-based detection of Salmonella
from these samples. In order to purify the lysed samples, two commercial DNA
purification kits (QIAmp DNA Stool Mini Kit, and the QIAEX II, Qiagen, Valencia,
CA) were evaluated and it was found that the QIAEX II was more suitable for the
purification of small DNA fragments, which are required for MAMEF-based DNA
sensing.
Additionally, purification of the lysed samples was also achieved by
diluting the sample 1:250 in deionized water. Based on these results, the following
92
the anchor probe incubation step, the excess probe was discarded and the SIFs wells
rinsed with deionized water to remove unbound probe. The microwaved-lysed stool
samples were then centrifuged for 3 minutes at 4580 X g and if the sample was not
freshly lysed, it was boiled for five minutes to denature the DNA to single strands
prior to MAMEF analysis.
MAMEF-based DNA detection was carried out by
FRPELQLQJȝl of the microwave-O\VHGVDPSOHZLWKȝl of 250 nM fluorescent
probe in the anchor probe-containing SIFs wells. The samples were then exposed to a
180-W microwave exposure for 30 seconds. Excess unbound probe and sample was
removed from the wells by rinsing with deionized water and the wells rehydrated
ZLWKȝl of TE prior to fluorescence reading, which was carried out as described in
section 5.2.1.
Specificity Testing
Two new assays were developed by targeting the sdf and FliA-FliB genes for
the specific detection of Salmonella enteriditis and Salmonella typhimurium,
respectively. The specificity of each assay was evaluated by spiking 1 mL of TE
buffer with Salmonella typhi (36 CFU), Salmonella paratyphi A (25 CFU),
Salmonella typhimurium (25 CFU), Salmonella enteriditis (22 CFU), Escherichia coli
(4.2 CFU), Klebsiella pneumoniae (5.2 CFU) or Pseudomonas aeruginosa (33 CFU).
Each sample was microwave-lysed as previously described (section 5.2) and tested
against the newly-developed assays as well as the oriC-based MAMEF assay, which
targets all Salmonella species. MAMEF was carried out as described in the MAMEF
detection section.
94
5.3.2 Results and Discussion
Specificity testing of the MAMEF assays (oriC, sdf, FliB-FliA) revealed that
they exclusively detected their respective target(s) (Table 13). The oriC-based assay
correctly identified all Salmonella species, but not the non-Salmonella bacteria ± E.
coli, K. pneumoniae, or P. aeruginosa. The sdf assay exclusively detected S.
enteriditis, but none of the other Salmonella species or non-Salmonella bacteria.
Similarly, the FliB-FliA-based assay only detected S. typhimurium, but none of the
other bacterial species.
MAMEF Assays
Target/gene
Bacterial species
Salmonella typhi
Salmonella paratyphi A
Salmonella enteriditis
Salmonella typhimurium
Escherichia coli
Klebsiella pneumoniae
Pseudomonas aeruginosa
Salmonella Spp.
oriC
S. enteriditis
sdf
S. typhimurium
FliB-FliA
+
+
+
+
-
+
-
+
-
Table 13. Specificity of MAMEF-based DNA assays for detection of Salmonella
species.
Analysis of Salmonella typhi-spiked stool samples with the oriC MAMEF
revealed that microwave lysing can be used for the extraction and fragmentation of
DNA and that the resulting sample can be used for the MAMEF-based detection of
Salmonella from stool samples. This approach allows for detection of less than 103
CFU of Salmonella typhi with the oriC MAMEF assay (Figure 36). Although the
level of sensitivity of the current assay is not very high, the MAMEF platform is
95
faster (results available in minutes) than other available approaches, such as cultures,
Average fluorescence intensity (AU)
which can take up to 72 hours to result.149
400
350
300
250
200
150
100
50
0
00
2
3
10
102
4
10
103
10
104
Salmonella typhi concentration (CFU)
Figure 36. Detection of Salmonella typhi from microwave-lysed spiked stools
samples using the oriC-based MAMEF assay. 0 CFU = stool sample (no Salmonella)
Analysis of spiked stool samples with the other two MAMEF assays designed
to specifically detect Salmonella enteriditis and Salmonella typhimurium provided
mixed results. The use of the sdf-based MAMEF assay for detection of S. enteriditis
provided results similar to those obtained with oriC assay.
In this regard, a
concentration-dependent signal was obtained when S. enteriditis-spiked stool samples
were tested with the sdf-based MAMEF assay (Figure 37).
However, no dose-
response was observed when S. typhimurium-spiked stool samples were tested with
the FliB-FliA assay, which was designed to specifically target S. typhimurium (Figure
38). The reason for the lack of response from the S. typhimurium assay is unknown
especially since a response was observed with S. typhimurium lysed in TE buffer in a
dose-dependent manner (data not shown).
96
Average fluorescence intensity (AU)
700
600
500
400
300
200
100
0
2
0
10
10^2
3
10
10^3
4
10
10^4
Salmonella enteriditis concentration (CFU)
Figure 37. Detection of Salmonella enteriditis from microwave-lysed spiked stools
samples using the sdf-based MAMEF assay. 0 CFU = stool sample (no Salmonella)
Average fluorescence intensity (AU)
500
400
300
200
100
0
Stool
Stool + SeEn
Stool + SeTm
Figure 38. Detection of Salmonella typhimurium from microwave-lysed spikedstool samples using the FliB-FliA-based MAMEF assay. SeEn = Salmonella
enteriditis; SeTm = Salmonella typhimurium.
97
5.3.3 Conclusions
In the present study, the rapid extraction and detection of Salmonella from
stool samples was demonstrated through the use of microwave-based lysing and
MAMEF-based detection.
All of the assays evaluated showed great specificity
despite the high background signal from non-target bacteria commonly present in
feces. The sensitivity of the oriC and the sdf assay, which target all Salmonella
species and S. enteriditis, respectively, was estimated to be around 103 CFU.
Detection of S. typhimurium with the FliB-FliA MAMEF assay from spiked stool
samples was not achieved. Further work is necessary to increase the sensitivity of the
oriC and sdf assays and improve detection of S. typhimurium with the FliB-FliAbased MAMEF assay.
98
Chapter 6: PCR- and Surface Plasmon Resonance (SPR)-Based
Detection of Genetic Markers Associated with Antimicrobial
Resistance in N. gonorrhoeae
Overview and Motivation
The emergence of gonorrhea isolates with resistance to extended-spectrum
cephalosporins, the recommended and last remaining option for the treatment of
gonorrhea, has prompted worldwide concern regarding the possible spread of
antimicrobial-resistant gonorrhea.5,
6, 138
While accurate detection of gonorrhea is
critical for disease management, the rapid identification and treatment of individuals
infected with antimicrobial-resistant gonorrhea is critical for outbreak prevention.
Despite the emergence of cephalosporins-resistant gonorrhea worldwide, reports by
the CDC suggest that resistance levels to previously-recommended antimicrobials,
such as fluoroquinolones, has decreased in cities, such as Baltimore.7 Therefore, it is
possible that these previously-recommended antimicrobials can be used for the
treatment of gonorrhea, instead of the last remaining therapeutic option
(cephalosporins) and that this approach may delay the emergence and/or spread of
antimicrobial-resistant gonorrhea worldwide. However, the use of previouslyrecommended antimicrobials cannot be implemented without first knowing whether
or not the strain causing the infection is sensitive or resistant to that particular
therapeutic option. In this regard, a molecular test which could rapidly identify
genetic modifications associated with antimicrobial resistance is highly desirable.
The motivation for this component of the research was to determine if a Surface
Plasmon Resonance (SPR)-based approach could be used to rapidly identify
99
gonorrhea strains with wildtype gyrA and parC sequences in the quinolone resistancedetermining region (QRDR) as a method to assess fluoroquinolone susceptibility.
The research presented in this chapter on antimicrobial resistant-gonorrhea is
divided into two sections. The first section provides a detailed analysis of the direct
detection, from clinical samples, of markers associated with N. gonorrhoeae
resistance to fluoroquinolones, penicillin, and extended-spectrum cephalosporins
using real-time PCR-based approaches.
This part of the research was primarily
carried out to identify strains with mutations in the QRDR region of N. gonorrhoeae,
which could then be used for the development and testing of the SPR platform
(section 6.2). Additional goals of this project were to determine if discarded samples
(urethral swabs) could be used for the characterization of antimicrobial-resistant
gonorrhea and to better define the epidemiology of antibiotic-resistant gonorrhea in
Baltimore City. Characterization of these samples was carried out, by the author of
this dissertation in the Laboratory of Dr. Charlotte Gaydos at Johns Hopkins
University as part of a cross-disciplinary training opportunity sponsored by the NIHfunded Chemistry-Biology Interface (CBI)
GM0066706) at UMBC.
graduate training program (T32
The second section of this chapter describes the
development and preliminary testing of an SPR-based assay for the detection of point
mutation(s) in the QRDR of N. gonorrhoeae as markers of resistance to
fluoroquinolones.
100
6.1 Real-Time PCR-Based Detection of Markers Associated with Antimicrobial
Resistance in N. gonorrhoeae
6.1.1 Experimental Details
Clinical Samples
A total of 522 urethral swabs were collected at the Baltimore City Health
Department from May to September 2015. The urethral swabs were collected from
individuals seeking testing for STIs especially gonorrhea. The swabs were initially
used for clinical testing (gram stain and cultures) at the clinic, and following the
completion of clinical testing, each swab was placed in a 15 mL conical tube, stored
at 4°C, and then WUDQVIHUUHGWR'U*D\GRV¶ODERUDWRU\ZKHUHWKH\ZHUHgiven a study
number. The swabs were stored frozen at -80°C until they were analyzed by RealTime PCR as described below.
PCR-Based Detection of Gonorrhea and Resistance Determinants
DNA Extraction
Each swab was rehydrated in 500 µl of autoclaved, deionized water, vortexed
for 10 seconds, and 200 µl of the eluted sample extracted for DNA using the
automated MagNA Pure LC instrument (Roche Diagnostics, Indianapolis, IN). DNA
extraction was carried out with the DNA I Blood Cells High Performance Serum Kit
according to instructions supplied by the manufacturer. Positive controls (serial
dilutions of N. gonorrhoeae) and negative controls (gonorrhea-negative urethral
swabs) were processed using the same DNA extraction protocol.
101
Real-Time PCR-Based Detection
Assays Description
Six real-time PCR assays ± 4 of them carried out as two multiplex assays ±
were used in this study for the detection of gonorrheal DNA and genetic
modifications associated with antimicrobial resistance directly from urethral swabs
(Table 14). The multiplex porA/opa real-time PCR assay150, 151 was used to detect the
presence of gonorrheal DNA in urethral swabs. The multiplex gyrA/parC assay was
used to detect mutations in the Quinolone Resistance-Determining Region (QRDR)
region of Neisseria gonorrhoeae, which are associated with decreased susceptibility
to fluoroquinolones. The PCR assay was designed to exclusively detect the wildtype
QRDR of the gyrA and parC genes. When mutation(s) are present in the QRDR, the
TaqMan probe does not recognize the target sequence, resulting in lack of detection
of the amplified product, and negative PCR results.152 The Penicillinase-Producing
Neisseria gonorrhoeae (PPNG) assay was designed to detect a conserved sequence of
the plasmids harboring the beta-lactamase gene, which is responsible for the
production of penicillinase activity.153 Lastly, the Penicillin-Binding Protein 2 (PBP2) assay targeted the mosaic structure of the N. gonorrhoeae penA gene, which
encodes PBP-2 and has been shown to be associated with decreased susceptibility to
cephalosporins.154
Real-Time PCR
Following the extraction of DNA, samples were tested for the presence of
gonorrheal DNA, and if identified as gonorrhea-positive by PCR, tested for
antimicrobial resistance determinants using the primers and probes described in Table
102
14. Briefly, PCRs were performed in 96-ZHOO SODWHV LQ D WRWDO YROXPH RI ȝl,
utilizing 40 ȝl of PCR master mix and 10 ȝl of sample. PCR master mix contained
ȝl of 2X TaqMan universal PCR mix (PE Applied Biosystems, Foster City, CA), 1
ȝO of 10 ȝ0 of the forward primer, the reverse primer, and the TaqMan probe, 2 µl of
MgCl2 and water to a final volume of 40 µl. The PCR conditions and cycling
parameters for each assay are described in Appendix B.
Control samples were
included in each run, which included water as a negative control, DNA from a
wildtype N. gonorrhoeae strain for the porA/opa and gyrA/parC assays, a plasmid
containing the PBP-2 mosaic sequence (for the PBP-2 assay) or the Asian plasmid
(for the PPNG assay). All samples were tested in duplicates and initially tested for
gonorrheal DNA using the porA/opa multiplex assay.
Samples were considered to
be positive for gonorrhea if either assay (porA or opa) had a PCR threshold cycle
(Ct) of less than 37 cycles. Gonorrhea-positive samples were further analyzed by
real-time
PCR
fluoroquinolones
for
genetic
(gyrA/parC),
modifications
penicillin
associated
(PPNG),
and
with
resistance
to
extended-spectrum
cephalosporins (PBP-2). In order to evaluate the analytical performance of these
assays with clinical samples, the first 150 swabs were analyzed in a blinded manner.
Additionally, 47 gonorrhea-negative swabs (identified by culture and real-time PCR)
were also analyzed with the other three assays (gyrA/parC, PPNG, PBP-2). The
testing of the gonorrhea-negative samples was carried out to determine the analytical
specificity of the assays for detection of genetic resistance markers.
103
Assay/
target
1, *
*PorA
*Opa2, *
pap-F
pap-R
pap-TM
GCopa-F
GCopa-R
GyrA
ParC&
PPNG3
PBP-24
CAGCATTCAATTTGTTCCGAGTC
GAACTGGTTTCATCTGATTACTTTCCA
FAM-CGCCTATACGCCTGCTACTTTCACGC-BHQ1
TTGAAACACCGCCCGGAA
GyrA-F
GyrA-R
GyrA91-95
ParC-F
TTTCGGCTCCTTATTCGGTTTAA
TET-CCGATATAATCCGTCCTTCAACATCAG-BHQ1
TTGCGCCATACGGACGAT
GCGACGTCATCGGTAAATACCA
FAM-TGTCGTAAACTGCGGAA-BHQ-1
TGAGCCATGCGCACCAT
ParC-R
ParC86-88
PPNG-F
PPNG-R
PPNG-TM
NG89-F
GGCGAGATTTTGGGTAAATACCA
TET-CGGAACTGTCGCCGT-BHQ-1
AGCTGTTCGTTTTTTACTACCAATCA
TGATTTAGTCGTTGAGGTTGAACAA
TET-AATTTAAAGAGTGAATAGTACGCCCACGCTTGA-BHQ1
GTTGGATGCCCGTACTGGG
NG89-R
NG89-TM
ACCGATTTTGTAAGGCAGGG
FAM-CGGCAAAGTGGATGCAACCGA-BHQ-1
GCopa
&
3UREHVHTXHQFH¶± ¶
Primers
and probes
Table 14. Primer and probe sequences for the real-time PCR-based detection of
Neisseria gonorrhoeae and antimicrobial resistance determinants. TM = TaqMan; FAM =
Carboxyfluorescein; TET =Tetrachlorofluorescein, IBHQ-1 = Iowa Black Hole Quencher-1;
PBP-2 = penicillin-binding protein 2. 1Assay adapted from Whiley and Sloots 2005.150 2Assay
adapted from Tabrizi et al, 2005.151 3Assay adapted from Goire et al, 2011.153 4Assay adapted
from Ochiai et al, 2008.154 *The porA and opa assays were carried out as a multiplex assay.
&
The gyrA and parC assays were carried out as a multiplex assay.
6.1.2 Results and Discussion
The present study was carried out to identify gonorrhea strains with
antimicrobial resistance markers, which could be used for the development and
testing of an SPR-based assay (Section 6.2) for the rapid detection of antimicrobialresistant gonorrhea. The collection of samples for this analysis was complicated by
the fact that most healthcare facilities primarily collect samples in NAAT media,
which may not be suitable for analysis on the SPR platform. Due to this limitation,
urethral swabs, which had been previously used for the culture-based detection of
104
gonorrhea at the Baltimore City Health Department, were selected for this analysis.
While these are not ideal samples, the decision was based on the fact that residual N.
gonorrhoeae cells were likely present in these samples as the bacterial load in
samples collected from symptomatic individuals is very high.155 The analysis of these
swabs was carried out using a two-step approach involving the PCR-based detection
of gonorrhea, followed by the detection of genetic markers associated with
antimicrobial resistance in gonorrhea-positive samples. The two-step approach was
implemented to decrease the likelihood of false-negative results due to the absence or
low concentration of N. gonorrhoeae cell/DNA. In this regard, only swabs with a
suitable concentration of gonorrheal DNA (as determined by the porA/opa assays)
were further analyzed by the resistance assays.
As shown in Table 15, the rate of detection of gonorrheal DNA from urethral
swabs, which had been previously used for cultures, using PCR was moderate, as
only 67.3% of culture-positive swabs were also positive by PCR. The high number of
samples (33 out of 101) with false-negative PCR results was likely due to the low
concentration of N. gonorrhoeae cells/DNA in some of these samples resulting from
their previous use, for routine clinical analysis, at the Baltimore City Health
Department.
None of the 47 N. gonorrhoeae-negative swabs gave false-positive results for
any of the resistance determinants (gyrA/parC, PPNG, and PBP-2) assays, which
suggested that all three assays are highly specific for their target (Table 15). Despite
the high number of culture-positive, PCR-negative samples, 90.7% (62/68) of the
samples that were identified by PCR as gonorrhea positive had usable DNA and were
105
tested for antimicrobial resistance markers. Six samples were excluded from further
analysis because they had porA/opa PCR threshold cycle (Ct) > 37, which suggested
low gonorrheal DNA load.
Culture (+)
PCR PCR
(+)
(-)
A
Number of swabs tested
for gonorrhea (n = 210)
Culture (-)
PCR PCR
(+)
(-)
68
33
5
104
62
0
5
47
15
8
0
7
1
0
NT
0
0
Sensitivity
(%)
Concordance
(%)
67.3
91.9
B
Total number of
analyzed swabs
GyrA or ParC mutants
GyrA mutants
ParC mutants only
GyrA and ParC mutants
PPNG
PBP-2
Table 15. (A) Real-time PCR-based detection of gonorrhea in comparison to culture.
(B) Detection of genetic markers associated with antimicrobial resistance in N.
gonorrhoeae by real-time PCR. Urethral swabs were first tested for the presence of
gonorrheal DNA with the porA/opa multiplex assay. Gonorrhea-positive swabs were
further analyzed for genetic markers associated with antimicrobial resistance. NT = not
tested.
In regards to the detection of genetic markers associated with antimicrobial
resistance, 24.2% (15/62) of the gonorrhea-positive swabs had either gyrA or parC
mutated sequences in the QRDR, 53.3% (8/15) had only mutated gyrA sequences, and
46.7% (7/15) of the samples had mutated sequences in both genes (Table 15). It is
worth noting that DNA sequencing was not performed on any of the samples with
non-wildtype QRDR sequences to confirm the presence of mutation(s) in the gyrA or
parC gene. However, the lack of detection of wildtype sequences was likely due to
the
presence
of
mutation(s)
associated
with
decreased
susceptibility
to
fluoroquinolones, and not to false-negative results (presence of QRDR wildtype
sequences, but lack of detection) resulting from low concentration of gonorrheal
106
DNA. In this regard, 8/15 samples had mutated gyrA sequences, but wildtype parC
sequences indicative of adequate DNA concentration given that the gyrA and parC
genes were simultaneously analyzed by a single multiplex PCR assay. The other
seven samples with mutated gyrA and parC sequences had porA/opa PCR Ct values <
30 cycles suggestive of high concentration of gonorrheal DNA. If confirmed, the
presence of these mutation(s) in the QRDR, which confer resistance to
fluoroquinolones,156 would suggest that fluoroquinolones might not be a suitable
antimicrobial for the treatment of gonorrhea in Baltimore. This finding is consistent
with the 2006 CDC treatment guidelines,157 but contrary to recent reports regarding
the prevalence of quinolone-resistant gonorrhea in Baltimore.7 Unexpectedly, the
prevalence of markers of penicillinase-producing Neisseria gonorrhoeae (PPNG) was
very low as only one sample tested positive for the plasmid harboring the betalactamase gene (Table 15).
Lastly, the penA structure mosaic associated with
decreased susceptibility to cephalosporins was not detected in any of the samples
analyzed in this study. This finding is consistent with previous reports that the rate of
cephalosporins resistance in Baltimore is very low.158
6.1.3 Conclusions
Development of any detection platform requires the testing of appropriate
controls. In the present study, PCR was used to detect genetic markers associated
with antimicrobial resistance in gonorrhea. While the PCR-based detection of
gonorrhea from urethral swabs was affected by the concentration of cells/DNA in
these residual samples, the analysis revealed a high number of samples with mutated
QRDR sequences, which are commonly associated with fluoroquinolone resistance.
107
Further work is necessary to confirm and identify the mutation(s) and determine if
they confer resistance to fluoroquinolones. These samples can then be used for the
development of the SPR-based antimicrobial resistance detection platform.
Additionally, in the present study, genetic markers associated with resistance to
cephalosporins were not identified, which supports the use of cephalosporins for the
treatment of gonorrhea in Baltimore.
6.2 SPR-Based Detection of Mutations Associated with Quinolone Resistance in N.
gonorrhoeae
6.2.1 Motivation
The increase in rates of antimicrobial-resistant gonorrhea has intensified the
need for susceptibility testing to guide treatment options and to prevent outbreaks.
However, the use of NAATs for detection of gonorrhea hinders the collection of
viable organisms necessary for susceptibility testing. In this regard, the development
of molecular methods for detection of susceptible and resistant organisms is highly
desirable. The use of SPR-based biosensors for the real-time monitoring of
biomolecular interactions in clinical applications has gained popularity over the last
two decades due to its sensitivity and label-free approach.159 The motivation for this
portion of the research was to determine if an SPR-based approach could be used to
detect wildtype sequences in the gyrA and parC genes as a method to differentiate
between quinolone-sensitive and -resistant gonorrhea. The secondary goal of this
work was to expand on this proof-of-concept SPR-based analysis by testing the
clinical samples (urethral swabs) that were characterized in section 6.1.
108
6.2.2 Experimental Details
Assay Description
The clinically relevant mutations associated with quinolone resistance in N.
gonorrhoeae are located in regions of the gyrA and parC genes collectively known as
the Quinolone-Resistance Determining Region (QRDR).152 Two SPR-based assays
were designed to target the most common mutations in these genes (gyrA S91, gyrA
D95, and parC D86/S87/S88). SPR-based sensing is based on the real-time
monitoring of refractive index changes occurring near the surface of a metal film. In
the present work, refractive index changes were monitored following the
complementary binding of the target DNA molecule to an anchor probe that was
immobilized on the metal surface via a metal-thiol covalent bond. The interaction of
the target DNA molecule with the anchor probe resulted in refractive index changes,
which were monitored, and recorded as the pixel number on the SPR minimum
(Figure 39). It is important to note that the refractive index of buffered water is about
1.33 at 20 C,160 whereas, DNA on metal films have been shown to have much higher
UHIUDFWLYH LQGH[¶V ± 1.54, depending on the density of the DNA and film
architecture.161 Therefore, we hypothesized that the hybridization of appropriate DNA
targets would increase the surface refractive index and thus move the SPR reflectivity
minimum value to a greater pixel number on the Ximea 5 mega-pixel detector.
In order to determine if SPR signal changes could be used to detect the
presence of mutation(s) on a DNA sequence, oligonucleotides with wildtype
sequences (gyrA or parC) and a terminal thiol (for binding to the gold film) were used
as capture probes, and tested against complementary wildtype oligonucleotides and
109
Target
$QFKRUSUREH¶± ¶
Wildtype and mutated
WDUJHWVHTXHQFHV¶± ¶
GGTGTCGTAAACTGCGGAATC
gyrA 90 - 96
S-GATTCCGCAGTTTACGACACC
GGTGTCGTAAACTGCGAAATC
GGTGCCGTAAACTGCGAAATC
GTCGTAAACTGCGGA
gyrA 91 - 95
S-TCCGCAGTTTACGAC
GTCGTAAACTGCGAA
GCCGTAAACTGCGAA
CGCCTCATAGGCGGAACTGTC
parC 86 - 92
S-GACAGTTCCGCCTATGAGGCG
CGCCTCATAGGCGGAACCGTC
CGCCGCATAGGCGGAACCGTC
CTCATAGGCGGAACT
parC 87 - 91
S-AGTTCCGCCTATGAG
CTCATAGGCGGAACC
CGCATAGGCGGAACC
Table 16. Oligonucleotide sequences for the proof-of-concept SPR-based mutation
detection analysis. S - sulfhydryl group for attachment of the anchor (capture) probe to the
gold film. The DNA sequences of the anchor probes are identical to the wildtype gyrA and
parC sequences of N. gonorrhoeae strains susceptible to quinolones. Fully complementary
and mutated sequences (mutations are shown in underlined bold and in red) were used to
determine how the complementary binding of target sequences to the anchor probe on the
biosensor surface affected SPR signal. The numbers on the name of the oligonucleotide
sequences indicate the amino acid number.
Portable SPR Instrument
To test the SPR-based assays, a portable SPR unit (Figure 40), developed by
LacriScience LLC for a different application, was used. The portable unit uses dual
wavelengths, namely 855 and 950 nm, which provide the incident light to monitor the
SPR signals at 2 wavelengths simultaneously. At 950 nm, classical SPR curves are
narrower and sharper, allowing the position of the SPR minimum to be more easily
determined. In contrast, SPR curves at 850 nm are broader, but the effect of changes
in refractive index is more noticeable by a greater shift in the position of the
111
SPR-Based Mutation Detection Assay
Gold films (50 ± 0.1nm) were vapor deposited on microscope slides using the
BOC Edwards 306 vacuum deposition unit (West Sussex, UK). Prior to SPR-based
DNA sensing, thiol deprotection of the anchor probe was performed with 10 µl of 4
mM tris-2-carboxyethylphosphine (TCEP) (Sigma Aldrich) and the reduced probe
was diluted in TE to working concentrations. In order to determine the ideal anchor
probe concentration for SPR-based sensing, SPR measurements were performed with
various concentrations of anchor probe (0 ± 1000 nM). Experiments to determine if
SPR-based sensing can be used to differentiate between the complementary binding
of wildtype and mutated oligonucleotide sequences to the anchor probe were carried
out as follows. Ten µl of TE was deposited on the gold-film and baseline SPR signals
were measured after 10 seconds. Following the collection of baseline measurements
using TE, the position of the gold-coated film slide was shifted to allow for
experimental measurements to be carried out on an unused portion of the gold film, as
the removal of TE from the gold film surface was not feasible. Next, the anchor
probe (10 µl) was loaded onto the unused gold film surface and SPR measurements
collected at 30 seconds, 1, 2, 5 and 10 minutes following the addition of the anchor
probe. These time intervals were selected to determine the ideal time for binding of
the anchor probe to the metal film via the thiol group. Following the 10-minute SPR
measurement with anchor probe, 10 µl of the target (wildtype or mutated
oligonucleotide) was added to the same location as the anchor probe and SPR
measurements collected at the time intervals described above. All experiments were
113
6.2.3 Results and Discussion
In order to investigate SPR changes in response to increasing concentration of
DNA, SPR measurements were initially performed following the addition of varied
concentrations of the gyrA anchor probe (no target DNA). A significant change in the
SPR response was not observed when 25 or 50 nM of gyrA anchor probe was loaded
onto the sensor surface. Increasing the concentration of anchor probe resulted in SPR
signal changes, but when the 1000 nM solution was used, the SPR signal was similar
to that of samples with lower concentrations of oligonucleotide (Figure 42). One
possible explanation for this observation is that the Au-surface sensor was saturated at
the 1000 nM concentration, as the sensor does not allow for the removal of excess or
unbound probe.
Pixel number on the SPR minimum
900
880
860
840
820
800
780
760
740
720
0
25
50
100
200
500
1000
gyrA anchor probe concentration (nM)
Figure 42. SPR response following the attachment of gyrA anchor
probe on the sensor surface. Measurements were performed 30
seconds after loading the anchor probe onto the gold film. Each data
point represents the average of three trials.
115
Based on the results with the immobilized DNA anchor (capture) probe, two
concentrations (100 and 500 nM) were selected for the detection of nucleotide
mismatches using SPR. For these experiments, the gyrA 90 ± 96 anchor probe was
selected as the capture probe and hybridization experiments carried out with the
fully complementary wildtype oligonucleotide and the mismatch oligonucleotide. As
shown in Figures 43 and 44, the SPR signal changed following the addition of anchor
probe to the assay surface, but did not change as a function of time. Furthermore, the
addition of the fully complementary target sequence did not change the SPR signal
regardless of the concentration of wildtype target oligonucleotide added (Figure 43).
The addition of a mismatch target oligonucleotide also did not result in an SPR signal
change, which could be used to differentiate the hybridization of wildtype sequences
vs mismatch sequences (Figure 44). It should be noted, however, that an SPR signal
change was observed when the sensor was challenged with 100 nM of the mismatch
oligonucleotide (Figure 44A).
116
The lack of SPR signal change in the preliminary work reported here could be
due to a variety of reasons. First, the deposition of anchor probe and target without
using a continuous flow approach raises the possibility that the system was saturated,
due the concentration of analyte at the sensor surface. In order to address this
problem, the metal film could be treated with 1-mercapto-6-hexanol, which has been
successfully used to prevent non-specific absorption and provide suitable spacing
between the immobilized oligonucleotides.163-165 Another possible reason is that the
concentration of anchor probe was not optimal for SPR-sensing on this platform.
Further optimization with a different range of oligonucleotides could be used to
explore this possibility.
Based on the results obtained with the gyrA 90 ± 96 oligonucleotides
(wildtype and mismatch) and due to time constraints, analysis with the other
oligonucleotides were not carried out during the present study. Further work with the
other oligonucleotides (Table 16) should be carried out to determine if the lack of
SPR signal change is platform- or assay-specific.
6.2.4 Conclusions
Development of a rapid and sensitive platform for detection of genetic
markers associated with antimicrobial resistance is highly desirable. Unfortunately,
the preliminary analysis with a portable SPR instrument presented here did not
provide consistent results regarding differentiation of wildtype from mismatch DNA
sequences. Further testing is required to determine if optimization could improve
assay performance or if a new platform should be investigated for the detection of
mutations associated with quinolone resistance in Neisseria gonorrhoeae.
119
Chapter 7: Summary and Future Work
7.1 Summary of Dissertation
Despite dramatic advances in diagnostic technologies, Point-of-Care
Tests (POCTs) for the detection of infections, such as chlamydia, gonorrhea, and
typhoid fever are currently not available. To improve diagnosis, rapid and sensitive
molecular approaches have been developed ± NAATs for detection of STIs and
various molecular approaches for Salmonella ± but these are not suitable POCTs in
developing countries due to cost and availability of instrumentation.
Microwave-
Accelerated Metal-Enhanced Fluorescence (MAMEF) has shown promise as a
diagnostic platform due to its speed, sensitivity and cost. In the present research, two
important aspect of the MAMEF technology were investigated. First, the process of
cellular lysis and DNA isolation/fragmentation using microwave irradiation was
systematically evaluated using the gram-negative N. gonorrhoeae as a model
organism and the results compared to those of the gram-positive Listeria
monocytogenes.109 Second, MAMEF-based assays for the detection of chlamydia,108
gonorrhea,109 and Salmonella were developed and evaluated with both spiked and
clinical samples. Lastly, real-time PCR assays were used to identify genetic markers
associated with antimicrobial resistance in N. gonorrhoeae and surface plasmon
resonance (SPR)-based proof-of-concept experiments were carried out to assess the
feasibility of using SPR to detect point mutations associated with antimicrobial
resistance.
Although the use of microwaves for sterilization purposes has been widely
studied over the decades, the use of microwaves for DNA isolation and fragmentation
120
has not been extensively studied. A large portion of this research was devoted to
understanding how microwave irradiation parameters (duration and power) affect
bacterial cellular lysing and DNA isolation and fragmentation. More importantly, the
present work systematically investigated the benefits of using metal bowtie structures
to focus microwaves as an approach to improve cellular lysing and DNA isolation
and fragmentation efficiency. First, it was demonstrated that the microwave effect on
cellular lysing is distinguishable from that of conventional heating as culture survival
rates were more affected by microwave exposure than by conventional heating at the
same temperature. Furthermore, the use of microwave-focusing bowtie structures
enhanced cellular lysing efficiency.109 The ability to increase cellular lysing
efficiency through the use of highly-focused microwaves could lead to the
development of protocols to extract DNA from difficult-to-lyse bacterial cells, such
as Mycobacterium tuberculosis, a bacterium difficult to detect in clinical samples.
The microwave-based isolation and fragmentation of DNA from bacterial
cells was also investigated. Consistent with the cellular lysing results, microwave
irradiation was more efficient than conventional heating for the isolation and
fragmentation of DNA, and fragmentation efficiency was enhanced when the
microwave-focusing bowtie structures were used.109 Furthermore, it was shown that
the enhancement afforded by the microwave-focusing bowtie structures is limited to
those bacterial cells in close proximity to the apexes of the disjointed bowtie
structures (i.e. between the triangles). This is likely due to the fact that during
microwave irradiation, the intensity of the electric field is greatest in between the
triangles as previously reported.70, 74
121
MAMEF-based detection assays were developed and tested to evaluate the
clinical utility of the MAMEF platform. The development of the cryptic plasmidbased MAMEF assay resulted in a 10-fold improvement in analytical sensitivity over
the previously-developed 16S rRNA-based assay for detection of chlamydia.
In a
blinded analysis, both MAMEF assays (16S rRNA and cryptic plasmid) showed good
analytical sensitivity and specificity for detection of chlamydial DNA directly from
clinical samples, but the cryptic plasmid assay was found to be more sensitive.108
Although the sensitivity of MAMEF for detection of chlamydia was found to be 20%
lower than that of NAATs, MAMEF is faster (10 minutes) and less expensive than
NAATs, which are important characteristics for an ideal POCT for STIs.
Detection of gonorrhea using the MAMEF technology was also investigated.
The assay was found to lack sensitivity, which is likely due to the fact that the
selected target, the porA pseudogene, is present as a single-copy gene in N.
gonorrhoeae.142 Another assay targeting the multi-copy opa gene was designed
during this work and results will be reported in due course.
The collaborative effort with researchers from the University of Maryland
School of Medicine resulted in the development of a protocol for the separation of
blood components, microwave-based lysing, and the sensitive MAMEF-based
detection of Salmonella from White Blood Cells (WBC).137 Using the MAMEF
technology, 4 CFU of Salmonella typhi was detected in WBC-spiked samples.
Furthermore, the isolation and DNA extraction protocol reported here has been used
during the evaluation of a real-time PCR assay for detection of Salmonella directly
from blood.166 The work described here is not only important because of the sensitive
122
MAMEF-based detection of Salmonella, but also because the DNA extraction
protocol represents a fundamental breakthrough towards the development of other
molecular assays for detection of Salmonella directly from blood.
Real-time PCR-based detection of antimicrobial resistance markers in N.
gonorrhoeae was carried out to identify antimicrobial-resistant gonorrhea strains to
be used in the development of an SPR-based mutation detection platform. A large
number of gonorrhea strains with non-wildtype QRDR, which are associated with
quinolone resistance, were identified. These strains, however, were not used in the
development of the SPR platform because the proof-of-concept SPR experiments
with oligonucleotide sequences did not provide consistent results.
The lack of
reproducible SPR results was likely due to how samples were introduced to the gold
sensing surfaces, which could be solved in the future by the continuous flow of
analyte to the assay gold surface.
7.2 Future Work
7.2.1 Microwave-based Cellular Lysing Future Work
Despite mounting evidence that microwave-generated Reactive Oxygen
Species (ROS) result in cellular death and DNA damage,167-169 the generation of ROS
in bacterial cells during microwave irradiation has not been studied based on a review
of the literature. Detection of ROS can be difficult due to their short lifetime (<10-3 s)
when generated in aqueous solutions under microwave exposure.170, 171 In order to
determine if hydroxyl radicals (‡OH) are generated during microwave irradiation of
bacterial cells, the Oxidation-Extraction Photometry (OEP) method172,
173
could be
exploited as described by Zhang et al.171 Briefly, the presence of ‡OH could be
123
determined through the use of a trapping agent such as 1,5-diphenyl carbazide
(DPCI), which can be changed into 1,5-diphenyl-carbazone (DPCO) by ‡OH with a
strong oxidation power, followed by extraction using mixed benzene and carbon
tetrachloride solvents. DPCO exhibits strong absorbance at 563 nm and can be easily
detected using UV±vis spectra. The yield of generated ‡OH can then be estimated by
the decrease of the absorption peak at 563 nm following the addition of radical
scavengers such, as 2,6-di-tert-butyl-4-methylphenol (BHT), mannitol, and Vitamin
C to the system.
ROS can also interact with nucleic acids, especially DNA, and cause
modifications including single and double strand breaks.169, 175 In order to investigate
if ROS plays a role in the microwave-based fragmentation of DNA as described in
this dissertation, the levels of ROS could be determined using the OEP method
(described above) and compared to the degree of DNA fragmentation, either
qualitatively or quantitatively. Additionally, determination of the fragmentation site
along the DNA strand or backbone should provide valuable information regarding the
effects of microwave irradiation on DNA fragmentation. In this regard, electrospray
tandem mass spectrometry (ET-MS) and/or liquid chromatography MS (LC-MS)
could be used to identify DNA fragmentation site(s).176, 177
7.2.2 MAMEF-Based DNA Detection Future Work
The clinical validation of the chlamydia MAMEF assay was an important step
in the development of rapid and sensitive MAMEF-based molecular approaches for
the detection of infectious diseases. The next steps of this work should include
further optimization of the MAMEF platform to increase the sensitivity of the assays
124
and eliminate or decrease the number of false-positive results. In regards to the
sensitivity of the MAMEF platform, the microwave-based lysing approach could be
further optimized (exposure time and irradiation power) to ensure maximum lysing
efficiency without completely degrading the target DNA. Eliminating the likelihood
of false-positive results could be more challenging due to the fluorescence-enhancing
properties of the MAMEF platform, which could result in the enhancement of
background signals from residual, unbound fluorescent probe. In order to decrease
the number of false-positives, more stringent washing steps could be implemented,
the metallic surfaces could be protected to prevent the non-specific absorption of
fluorescent probe,97,
100
and different probe chemistries could be investigated. For
example, molecular beacons probes could be used instead of linear fluorophorelabeled oligonucleotides, as this type of probes undergo a fluorogenic conformational
change when they hybridize to their targets, thus limiting the likelihood of
background fluorescence in the absence of target. Additionally, background
fluorescence levels could be decreased through the use of low quantum yield
fluorophores, which are significantly enhanced near MEF-substrates as compared to
high quantum yield fluorophores.178
125
Appendices
Appendix A ± Separation Methods for the Isolation of White Blood Cells (WBC)
from Whole Blood.
a) Red blood cell and ammonium chloride lysis buffer. Two milliliters of whole
human blood were mixed with 18 ml of 1x red blood cell lysis buffer diluted from a
10x stock (82.6 g ammonium chloride, 0.37 g EDTA and 10 g potassium phosphate
in 1 L distilled water) or ammonium chloride buffer alone (8.26 g ammonium
chloride in 1 L distilled water). Each sample was inverted 10 times, incubated at room
temperature for 2 minutes and centrifuged for 5 minutes at 400 x g using a swing
bucket rotor followed by removal of the supernatant, thus removing the red blood cell
debris and leaving behind a pellet consisting of white blood cells and a small amount
of red blood cells. The pellet was re-suspended in 20 ml of fresh 1x red blood cell
lysis buffer (ammonium chloride alone or 1x red blood cell lysis buffer), inverted 5
times and centrifuged again to ensure complete lysis of red blood cells. The
supernatant was removed leaving behind a white blood cell pellet.
b) Water. Two milliliters of whole blood were mixed with 18 ml of distilled water.
The sample was inverted 10 times, incubated at room temperature for 2 minutes and
centrifuged for 5 minutes at 400 x g, thus removing the red blood cell debris and
leaving behind a white blood cell pellet. The pellet was re-suspended in 20 ml water,
inverted 5 times and centrifuged again to ensure complete red cell lysis. The
supernatant was removed leaving behind a white blood cell pellet.
c) BD Vacutainer® &37Œ %HFWRQ 'LFNLQVRQ Franklin Lakes, NJ). Buffy coat
was obtained by drawing 8 ml of whole blood into a BD Vacutainer® &37Œ cell
126
preparation tube containing sodium heparin and centrifuged in a clinical swing bucket
centrifuge at 1500 x g for 15 minutes. The buffy coat layer was transferred to a fresh
tube, re-suspended in washed in 1x PBS and centrifuged at 16,000 x g for 3 minutes
to remove the PBS.
d) Dextran. Buffy coat was obtained by mixing 2 ml of fresh whole blood with 2 ml
of 2% dextran (Sigma Aldrich) in 0.9% normal saline containing 25 mM sodium
citrate and incubated for 30 minutes at room temperature. The buffy coat which was
the upper layer was washed twice with 1x PBS in a fresh tube and centrifuged at
16,000 x g for 3 minutes to remove the red blood cells and pellet the white blood
cells.
e) Lymphocyte separation medium. Buffy coat was obtained by mixing 2 ml of
fresh whole blood with 2 mL of 1x PBS and layering onto 2 mL lymphocyte
separation medium (Corning cellgro®). The mixture was centrifuged at 400 x g using
a swing bucket rotor for 5 minutes to separate the buffy coat from the red blood cells
and plasma.
127
Appendix B ± Real-Time PCR Assays Parameters for Detection of Neisseria
gonorrhoeae and Associated Antimicrobial-Resistance Determinants.
gyrA/parC Assay
Components
Taqman Mix 2X
MgCl2- (25mM)
GyrA ABI1 (10µM)
GyrA ABI2 (10µM)
ParC ABI1 (10µM)
ParC ABI2 (10µM)
gyrA WT Probe (10µM)
parC WT Probe (10µM)
Water
Sample
Volume
(Concentration)
25 µl (1X)
2 µl (1mM)
1 µl (200 nM)
1 µl (200 nM)
1 µl (200 nM)
1 µl (200 nM)
1 µl (200 nM)
1 µl (200 nM)
7 µl
10 µl
PPNG Assay
Components
Taqman Mix 2X
MgCl2- (25mM)
PPNG-F1 (10µM)
PPNG-F2 (10µM)
PPNG-R1 (10µM)
PPNG-R2 (10µM)
PPNG-TM1 (10µM)
PPNG-TM2 (10µM)
Water
Sample
penA Assay
Component
Taqman Mix 2X
MgCl2- (25mM)
NG89-F2 (10µM)
NG89-R1(10µM)
NG89-P1 (10µM)
Water
Sample
Volume
(Concentration)
25 µl (1X)
2 µl (1mM)
1 µl (200 nM)
1 µl (200 nM)
1 µl (200 nM)
1 µl (200 nM)
1 µl (200 nM)
1 µl (200 nM)
7 µl
10 µl
Volume
(Concentration)
25 µl (1X)
2 µl (1mM)
2 µl (400 nM)
2 µl (400 nM)
2 µl (400 nM)
7 µl
10 µl
128
Bibliography
(1) Datta, S. D.; Sternberg, M.; Johnson, R. E.; Berman, S.; Papp, J. R.; McQuillan,
G.; Weinstock, H. Gonorrhea and chlamydia in the United States among persons 14
to 39 years of age, 1999 to 2002.; Annals of internal medicine. 2007, 147, 89-96.
(2) Centers for Disease Control and Prevention (CDC). Sexually Transmitted
Diseases Treatment Guidelines, 2015. MMWR Morb Mortal Wkly Rep. 2015, 64, 1135.
(3) Newman, L.; Rowley, J.; Vander Hoorn, S.; Wijesooriya, N. S.; Unemo, M.; Low,
N.; Stevens, G.; Gottlieb, S.; Kiarie, J.; Temmerman, M. Global Estimates of the
Prevalence and Incidence of Four Curable Sexually Transmitted Infections in 2012
Based on Systematic Review and Global Reporting. PLoS One. 2015, 10,
e0143304. Review.
(4) Centers for Disease Control and Prevention (CDC). Chlamydia screening among
sexually active young female enrollees of health plans--United States, 2000-2007.
MMWR Morb Mortal Wkly Rep. 2009, 58, 362-365.
(5) Unemo, M.; Shafer, W. M. Antibiotic resistance in Neisseria gonorrhoeae: origin,
evolution, and lessons learned for the future. Ann N Y Acad Sci. 2011, 1230, E19-28.
(6) Unemo, M.; Del Rio, C.; Shafer, W. M. Antimicrobial Resistance Expressed
by Neisseria gonorrhoeae: A Major Global Public Health Problem in the 21st
Century. Microbiol Spectr. 2016, 4, 1-10.
(7) Kirkcaldy, R. D.; Harvey, A.; Papp, J. R.; Del Rio, C.; Soge, O. O.; Holmes, K.
K.; Hook, E. W.; 3rd, Kubin, G.; Riedel, S.; Zenilman, J.; Pettus, K.; Sanders, T.;
Sharpe, S.; Torrone, E. Neisseria gonorrhoeae Antimicrobial Susceptibility
Surveillance - The Gonococcal Isolate Surveillance Project, 27 Sites, United States,
2014. MMWR Surveill Summ. 2016, 65, 1-19.
(8) Ward, H.; Rönn, M. Contribution of sexually transmitted infections to
the sexual transmission of HIV. Curr Opin HIV AIDS. 2010, 5, 305-10.
(9) Crump, J. A.; Luby, S. P.; Mintz, E. D. The global burden of typhoid fever. Bull
World Health Organ. 2004, 82, 346-353.
(10) Crump, J. A.; Mintz, E. D. Global trends in typhoid and paratyphoid Fever. Clin
Infect Dis. 2010, 50, 241-6. Review.
(11) Mogasale, V.; Maskery, B.; Ochiai, R. L.; Lee, J. S.; Mogasale, V. V.; Ramani,
E.; Kim, Y. E.; Park, J. K.; Wierzba, T. F. Burden of typhoid fever in lowincome and middle-income countries: a systematic, literature-based update with riskfactor adjustment. Lancet Glob Health. 2014, 2, e570-80.
129
(12) Crump, J. A. Typhoid Fever and the challenge of non-malaria febrile illness in
sub-Saharan Africa. Clin Infect Dis. 2012, 54, 1107-9.
(13) Levine, M. M. Mass vaccination to control epidemic and endemic typhoid fever.
Curr Top Microbiol Immunol. 2006, 304, 231-46.
(14) Graham, S. M.; Molyneux, E. M.; Walsh, A. L.; Cheesbrough, J. S.; Molyneux,
M. E.; Hart, G. A.; Nontyphoidal Salmonella infections of children in tropical Africa.
Pediatr Infect Dis J. 2000, 19, 1189-96. Review.
(15) Feasey, N. A.; Dougan, G.; Kingsley, R. A.; Heyderman, R. S.; Gordon, M. A.
Invasive non-typhoidal Salmonella disease: an emerging and neglected tropical
disease in Africa. Lancet. 2012, 379, 2489-99. Review.
(16) Okoro, C. K.; Kingsley, R. A.; Connor, T. R.; Harris, S. R.; Parry, C. M.; AlMashhadani, M. N.; Kariuki, S.; Msefula, C. L.; Gordon, M. A.; et al.
Intracontinental spread of human invasive Salmonella Typhimurium pathovariants in
sub-Saharan Africa. Nat Genet. 2012, 44, 1215-21.
(17) MacLennan, C. A.; Levine, M. M. Invasive nontyphoidal Salmonella disease
in Africa: current status. Expert Rev Anti Infect Ther. 2013, 11, 443-6.
(18) Gordon, M. A. Salmonella infections in immunocompromised adults. J Infect.
2008, 56, 413-22.
(19) Jones, T. F.; Ingram, L. A.; Cieslak, P. R.; Vugia, D. J.; Tobin-D'Angelo, M.;
Hurd, S.; Medus, C.; Cronquist, A.; Angulo, F. J. Salmonellosis outcomes differ
substantially by serotype. J Infect Dis. 2008, 198, 109-14.
(20) Phetsouvanh, R.; Phongmany, S.; Soukaloun, D.; Rasachak, B.; Soukhaseum, V.;
Soukhaseum, S.; Frichithavong, K.; Khounnorath, S.; et al. Causes of communityacquired bacteremia and patterns of antimicrobial resistance in Vientiane, Laos. Am J
Trop Med Hyg. 2006, 75, 978-85.
(21) O'Ryan, M.; Prado, V.; Pickering, L. K. A millennium update on pediatric
diarrheal illness in the developing world. Semin Pediatr Infect Dis. 2005, 16, 125-36.
Review.
(22) Ao, T. T.; Feasey, N. A.; Gordon, M. A.; Keddy, K. H.; Angulo, F. J.; Crump, J.
A. Global burden of invasive nontyphoidal Salmonella disease, 2010. Emerg Infect
Dis. 2015, 21, 941-9.
(23) Centers for Disease Control and Prevention (CDC). Outbreak of Salmonella
serotype Saintpaul infections associated with multiple raw produce items--United
States, 2008. MMWR Morb Mortal Wkly Rep. 2008, 57, 929-34.
(24) Centers for Disease Control and Prevention (CDC). Multistate outbreak of
Salmonella infections associated with peanut butter and peanut butter-containing
130
products--United States, 2008-2009. MMWR Morb Mortal Wkly Rep. 2009, 58, 8590.
(25) Knox, J.; Tabrizi, S. N.; Miller, P.; Petoumenos, K.; Law, M.; Chen, S.;
Garland, S. M. Evaluation of self-collected samples in contrast to practitionercollected samples for detection of Chlamydia trachomatis, Neisseria gonorrhoeae,
and Trichomonas vaginalis by polymerase chain reaction among women living in
remote areas. Sex Transm Dis. 2002, 11, 647-54.
(26) Whiley, D, M.; Tapsall, J. W.; Sloots, T. P. Nucleic Acid Amplification Testing
for Neisseria gonorrhoeae. J. Mol Diagn. 2006, 8, 3 - 15.
(27) Tabrizi, S. N.; Unemo, M.; Limnios, A. E.; Hogan, T. R.; Hjelmevoll, S. O.;
Garland, S. M.; Tapsall, J. Evaluation of six commercial nucleic acid amplification
tests for detection of Neisseria gonorrhoeae and other Neisseria species. J Clin
Microbiol. 2011, 49, 3610-5.
(28) Masek, B. J.; Arora, N.; Quinn, N.; Aumakhan, B.; Holden, J.; Hardick, A.;
Agreda, P.; Barnes, M.; Gaydos C. A. Performance of three nucleic acid amplification
tests for detection of Chlamydia trachomatis and Neisseria gonorrhoeae by use of
self-collected vaginal swabs obtained via an Internet-based screening program. J Clin
Microbiol. 2009, 47, 1663-7.
(29) Rockett, R.; Goire, N.; Limnios, A.; Turra, M.; Higgens, G.; Lambert, S. B.;
Bletchly, C.; Nissen, M. D.; Sloots, T. P.; Whiley, D. M. Evaluation of the cobas
4800 CT/NG test for detecting Chlamydia trachomatis and Neisseria gonorrhoeae.
Sex Transm Infect. 2010, 86, 470-3.
(30) Van Der Pol, B.; Liesenfeld, O.; Williams, J. A.; Taylor, S. N.; Lillis, R. A.;
Body, B. A.; Nye, M.; Eisenhut, C.; Hook, E. W. 3rd. Performance of the cobas
CT/NG test compared to the Aptima AC2 and Viper CTQ/GCQ assays for detection
of Chlamydia trachomatis and Neisseria gonorrhoeae. J Clin Microbiol. 2012, 50,
2244-9.
(31) Gaydos, C. A.; Van Der Pol, B.; Jett-Goheen, M.; Barnes, M.; Quinn, N.; Clark,
C.; Daniel, G. E.; Dixon, P. B.; Hook, E. W. 3rd.; CT/NG Study Group. Performance
of the Cepheid CT/NG Xpert Rapid PCR Test for Detection of Chlamydia
trachomatis and Neisseria gonorrhoeae. J Clin Microbiol. 2013, 51, 1666-72.
(32) Tabrizi, S. N.; Unemo, M, Golparian, D.; Twin, J.; Limnios, A. E.; Lahra, M.;
Guy, R. Analytical evaluation of GeneXpert CT/NG, the first genetic point-of-care
assay for simultaneous detection of Neisseria gonorrhoeae and Chlamydia
trachomatis. J Clin Microbiol. 2013, 51, 1945-47.
131
(33) Brook, G. The performance of non-NAAT point-of-care (POC) tests and rapid
NAAT tests for chlamydia and gonorrhea infections. An assessment of currently
available assays. Sex Transm Infect. 2015, 91, 539-44.
(34) Peeling, R. W.; Holmes, K. K.; Mabey, D.; Ronald, A. Rapid tests for sexually
transmitted infections (STIs): the way forward. Sex Transm Infect. 2006, 82, Suppl 5,
V1-V6.
(35) Reisner, B. S.; Woods, G. L. Times to detection of bacteria and yeasts in
BACTEC 9240 blood culture bottles. J Clin Microbiol. 1999, 37, 2024-6.
(36) Durmaz, G.; Us, T.; Aydinli, A.; Kiremitci, A.; Kiraz, N.; Akgün, Y. Optimum
detection times for bacteria and yeast species with the BACTEC 9120 aerobic blood
culture system: evaluation for a 5-year period in a Turkish university hospital. J Clin
Microbiol. 2003, 41, 819-21.
(37) Onuigbo, M. A. Diagnosis of typhoid fever in Nigeria: misuse of the Widal test.
Trans R Soc Trop Med Hyg. 1990, 84, 129-31.
(38) Nsutebu, E. F.; Ndumbe, P. M.; Koulla, S. The increase in occurrence of typhoid
fever in Cameroon: over diagnosis due to misuse of the Widal test? Trans R Soc Trop
Med Hyg. 2002, 96, 64-7.
(39) Espersen, F.; Høiby, N.; Hertz, J. B. Cross-reactions between Salmonella typhi
and 24 other bacterial species. Acta Pathol Microbiol Scand B. 1980, 88, 243-8.
(40) Olopoenia, L. A.; King, A. L. Widal agglutination test - 100 years later: still
plagued by controversy. Postgrad Med J. 2000, 76, 80-4. Review.
(41) Neil, K. P.; Sodha, S. V.; Lukwago, L.; O-Tipo, S.; Mikoleit, M.; Simington, S.
D.; Mukobi, P.; Balinandi, S.; Majalija, S.; et al. A large outbreak of typhoid fever
associated with a high rate of intestinal perforation in Kasese District, Uganda, 20082009. Clin Infect Dis. 2012, 54, 1091-9.
(42) Sánchez-Jiménez, M. M.; Cardona-Castro, N. Validation of a PCR for diagnosis
of typhoid fever and salmonellosis by amplification of the hilA gene in clinical
samples from Colombian patients. J Med Microbiol. 2004, 53, 875-8.
(43) Nga, TV.; Karkey, A.; Dongol, S.; Thuy, H. N.; Dunstan, S.; Holt, K.; Tu le, T.
P.; Campbell, J I.; Chau, T. T.; Chau, N. V.; Arjyal, A.; Koirala, S.; Basnyat, B.;
Dolecek, C.; Farrar, J.; Baker, S. The sensitivity of real-time PCR amplification
targeting invasive Salmonella serovars in biological specimens. BMC Infect Dis.
2010, 10, 125-34.
(44) Wain, J.; Diep, T. S.; Ho, V. A.; Walsh, A. M.; Nguyen, T. T.; Parry, C. M.;
White, N. J. Quantitation of bacteria in blood of typhoid fever patients and
132
relationship between counts and clinical features, transmissibility, and antibiotic
resistance. J Clin Microbiol. 1998, 36, 1683-7.
(45) Gordon, M. A.; Kankwatira, A. M.; Mwafulirwa, G.; Walsh, A. L.; Hopkins, M.
J.; Parry, C. M.; Faragher, E. B.; Zijlstra, E. E.; Heyderman, R. S.; Molyneux, M. E.
Invasive non-typhoid Salmonellae establish systemic intracellular infection in HIVinfected adults: an emerging disease pathogenesis. Clin Infect Dis. 2010, 50, 953-62.
(46) Knierim, E.; Lucke, B.; Schwarz, J. M.; Schuelke , M.; Seelow, D. Systematic
comparison of three methods for fragmentation of long-range PCR products for next
generation sequencing. PLoS One. 2011, 6, e28240.
(47) Burger, G.; Lavrov, D. V.; Forget, L.; Lang, B. F. Sequencing complete
mitochondrial and plastid genomes. Nat Protoc. 2007, 2, 603-14.
(48) Smejkal, G. B. Proteomics sample preparation, preservation, and fractionation.
Int J Proteomics. 2012, 1, 701230-1.
(49) Tang, J. Unlocking Potentials of Microwaves for Food Safety and Quality. J
Food Sci. 2015, 80, 1776-93. Review.
(50) Gedye, R.; Smith, F.; Westaway, K.; Ali, H.; Balidsera, L.; Laberge, L.; Rousell,
J. The use of microwave ovens for rapid organic synthesis. Tetrahedron Lett.1986,
27, 279-282.
(51) Giguerre, R.; Bray, T. L.; Duncan, S. M.; Majetich, G. Application of
commercial microwave ovens to organic synthesis. Tetrahedron Lett.1986, 41, 49454948.
(52) Stuerga, D.; Delmotte, M. Microwaves in Organic Synthesis. Loupy, A. Ed;
Wiley-VCH Weinheim. 2002. 1-34.
(53) Baghurst, D. R.; Mingos, D. M. P. Application of microwave dielectric heating
effects to the synthetic problems in chemistry. Chem Soc Rev. 1991. 20, 1- 47.
(54) Grabiel, C.; Gabriel, S.; Grant, E. H.; Halstead, B. S.; Mingos, D. M. P. Delectric
parameters relevant to microwave dielectric heating. Chem Soc Rev. 1998, 27, 213223.
(55) Vela, G. R.; Wu, J. F. Mechanism of lethal action of 2,450-MHz radiation on
microorganisms. Appl Environ Microbiol. 1979, 37, 550-3.
(56) Woo, I. S.; Rhee, I. K.; Park, H. D. Differential damage in bacterial cells by
microwave radiation on the basis of cell wall structure. Appl Environ Microbiol.
2000, 66, 2243-7.
133
(57) Zhou, B. W.; Shin, S. G.; Hwang, K.; Ahn, J. H; Hwang, S. Effect of microwave
irradiation on cellular disintegration of Gram positive and negative cells. Appl
Microbiol Biotechnol. 2010, 87, 765-70.
(58) Yaghmaee, P.; Durance, T. D. Destruction and injury of Escherichia coli during
microwave heating under vacuum. J Appl Microbiol. 2005, 98, 498-506.
(59) Rougier, C.; Prorot, A.; Chazal, P.; Leveque, P.; Leprat, P. Thermal and
nonthermal effects of discontinuous microwave exposure (2.45 gigahertz) on the cell
membrane of Escherichia coli. Appl Environ Microbiol. 2014, 80, 4832-41.
(60) Bélanger, J. M.; Paré, J. R. Applications of microwave-assisted processes (MAP)
to environmental analysis. Anal Bioanal Chem. 2006, 386, 1049-58. Review.
(61) Bélanger, J. M.; Paré, J. R.; Poon, O.; Fairbridge, C.; Ng, S.; Mutyala, S.
Hawkins, R. Remarks on various applications of microwave energy. J Microw Power
Electromagn Energy. 2008, 42, 24-44. Review.
(62) Alcázar, J.; Oehlrich, D. Recent applications of microwave irradiation to
medicinal chemistry. Future Med Chem. 2010, 2, 169-76.
(63) Watanabe, K.; Kakita, Y.; Kashige, N.; Miake, F.; Tsukiji, T. Effect of ionic
strength on the inactivation of micro-organisms by microwave irradiation. Lett Appl
Microbiol. 2000, 31, 52-6.
(64) Kakita, Y.; Kashige, N.; Murata, K.; Kuroiwa, A.; Funatsu, M.; Watanabe, K.
Inactivation of Lactobacillus bacteriophage PL-1 by microwave irradiation. Microbiol
Immunol. 1995, 39, 571-6.
(65) Rasmussen, J. P.; Barbez, P. H.; Burgoyne, L. A.; Saint C. P. Rapid preparation
of cyanobacterial DNA for real-time PCR analysis. Lett Appl Microbiol. 2008, 46, 149.
(66) Jadaon, M. M.; Dashti, A. A.; Lewis, H. L.; Habeeb, F. M. Whole blood
polymerase chain reaction and restriction fragment length polymorphism: a simplified
method by microwave irradiation. Med Princ Pract. 2009, 18, 280-3.
(67) Ozdemir-Kaynak, E.; Yesil-Celiktas, O. Microwave-assisted digestion combined
with silica-based spin column for DNA isolation from human bones. Anal Biochem.
2015, 486, 44-50.
(68) Port, J. R.; Nguetse, C.; Adukpo, S.; Velavan, T. P. A reliable and rapid method
for molecular detection of malarial parasites using microwave irradiation and loop
mediated isothermal amplification. Malar J. 2014, 13, 454-59.
134
(69) Yang, Y.; Hang, J. Fragmentation of genomic DNA using microwave irradiation.
J Biomol Tech. 2013, 24, 98-103.
(70) Aslan, K.; Previte, M. J. R.; Zhang, Y.; Gallagher, T.; Baillie, L.; Geddes, C. D.
Extraction and detection of DNA from Bacillus anthracis spores and the vegetative
cells within 1 minute, Anal Chem. 2008, 80, 4125-4132.
(71) Zhang, Y.; Agreda, P.; Kelley, S.; Gaydos, C. A.; Geddes, C. D. Development
of a microwave-accelerated metal-enhanced fluorescence 40 second.; <100 CFU/ml
point of care assay for the detection of Chlamydia trachomatis. IEEE Trans Biomed
Eng. 2011, 58, 781-784.
(72) Tennant, S. M.; Zhang, Y.; Galen, J. E.; Geddes, C D.; and Levine, M. M. Ultrafast and Sensitive detection of Non-typhoidal Salmonella using microwaveaccelerated metal-enhanced fluorescence (MAMEF). PloS One. 2011, 6, e18700.
(73) Joshi, L. T.; Mali, B. L.; Geddes, C. D.; Baillie, L. Extraction and sensitive
detection of toxins A and B from the human pathogen Clostridium difficile in 40
seconds using microwave-accelerated metal-enhanced fluorescence. PLoS One. 2014,
e104334.
(74) Previte, M. J. R.; Aslan, K.; Geddes, C. D. Spatial and Temporal Control of
Microwave Triggered Chemiluminescence: A Protein Detection Platform. Anal
Chem. 2007, 79, 7042-52.
(75) Compton, R. C.; McPhedran, R. C.; Popovic, Z.; Rebeiz, G. M.; Tong, P. P.;
Rutledge, D. B. Bow-tie antennas on a dielectric half-space: Theory and experiment.
IEEE Trans Antennas Propag. 1987, 35, 622-31.
(76) Grober, R. D.; Schoelkofp, R. J.; Prober, D. E. Optical antenna: Towards a unify
efficiency near-field optical probe. Appl Phys Lett. 1997, 70, 1354-56.
(77) Lakowicz, J. R. Principles of Fluorescence Spectroscopy, 3rd ed.; Springer
Science+Business Media: New York, 2006.
(78) Ritchie, R. H. Plasma Losses by Fast Electrons in Thin Films. Physical Review.
1957, 106, 874-881.
(79) Peng, H. I.; Miller, B. L. Recent advancements in optical DNA biosensors:
exploiting the plasmonic effects of metal nanoparticles. Analyst. 2011, 136, 436-47.
Review.
(80) Deng, W.; Xie, F.; Baltar, H. T.; Goldys, E. M. Metal-enhanced fluorescence in
the life sciences: here, now and beyond. Phys Chem Chem Phys. 2013, 15, 1569515708.
135
(81) Aslan, K.; Geddes, C. D. Metal-Enhanced Fluorescence: Progress Towards a
Unified Plasmon-Fluorophore Description. In Metal-Enhanced Fluorescence, Geddes,
C. D..; Ed; Wiley: New Jersey. 2010, Vol.; p 1.
(82) Zhang, Y.; Dragan, A.; Geddes, C. D. Wavelength Dependence of MetalEnhanced Fluorescence. Journal of Physical Chemistry C. 2009, 113, 12095-12100.
(83) Aslan, K.; Previte, M. J. R.; Zhang, Y.; Geddes, C. D. Surface plasmon coupled
fluorescence in the ultraviolet and visible spectral regions using zinc thin films.
Analytical Chemistry. 2008, 80, 7304-7312.
(84) Lakowicz, J. R. Radiative decay engineering: biophysical and biomedical
applications. Anal Biochem. 2002, 298, 1-24.
(85) Dragan, A. I.; Geddes, C. D. Metal-enhanced fluorescence: The role of quantum
yield, Q0, in enhanced fluorescence. Applied Physics Letters. 2012, 100, 093115.
(86) Dragan, A. I.; Bishop, E, S.; Casas-Finet, J. R.; Strouse, R. J.; McGivney, J.;
Schenerman, M. A.; Geddes, C. D. Distance Dependence of Metal-Enhanced
Fluorescence. Plasmonics. 2012, 7, 739-744.
(87) Bondre, N.; Zhang, Y.; Geddes, C. D. Metal-Enhanced Fluorescence based
calcium detection: Greater than 100-fold increase in signal/noise using Fluo-3 or
Fluo-4 and Silver Nanostructures. Sensors and Actuators B: Chemical. 2011, 152, 8287.
(88) Karolin, J.; Geddes, C. D. Reduced lifetimes are directly correlated with
excitation irradiance in metal-enhanced fluorescence. Journal of Fluorescence. 2012,
22, 1659-62.
(89) Dragan, A. I.; Geddes, C. D. Excitation volumetric effects (EVE) in MetalEnhanced Fluorescence. Physical Chemistry Chemical Physics. 2011, 13, 3831-38.
(90) Karolin, J.; and Geddes, C. D. Spectral Shifts in Metal-Enhanced Fluorescence.
Appl Phys Lett. 2014, 105, 063102.
(91) Caygill, R. L.; Blair, G. E.; Millner, P. A. A review on viral biosensors to detect
human pathogens. Anal Chim Acta. 2010, 681, 8-15. Review.
(92) Arora, P.; Sindhu, A.; Dilbaghi, N.; Chaudhury, A. Biosensors as innovative
tools for the detection of food borne pathogens. Biosens Bioelectron. 2011, 28, 1-12.
Review.
(93) Ermini, M. L.; Mariani, S.; Scarano, S.; Minunni, M. Bioanalytical approaches
for the detection of single nucleotide polymorphisms by Surface Plasmon Resonance
biosensors. Biosens Bioelectron. 2014, 61, 28-37. Review.
136
(94) Campbell, C. T.; Kim, G. SPR microscopy and its applications to highthroughput analyses of biomolecular binding events and their kinetics. Biomaterials.
2007, 28, 2380-92. Review.
(95) Aslan, K.; Geddes, C. D. Microwave-accelerated metal-enhanced fluorescence:
Platform technology for ultrafast and ultra-bright assays. Anal Chem. 2005, 77, 80578067.
(96) Aslan, K.; Geddes, C. D. New tools for rapid clinical and bioagent
diagnostics: microwaves and plasmonic nanostructures. Analyst. 2008, 133, 146980. Review.
(97) Mohammed, M.; Aslan, K. Rapid and Sensitive Detection of p53 Based on
DNA-Protein Binding Interactions Using Silver Nanoparticle Films and Microwave
Heating. Nano Biomed Eng. 2014, 6, 76-84.
(98) Ahirwar, R.; Tanwar, S.; Bora, U.; Nahar, P. Microwave non-thermal effect
reduces ELISA timing to less than 5 minutes. RSC Adv. 2016, 6, 20850-7.
(99) Aslan, K.; Malyn, S. N.; Geddes, C. D. Fast and sensitive DNA hybridization
assays using microwave-accelerated metal-enhanced fluorescence. Biochem Biophys
Res Commun. 2006, 348, 612-6177.
(100) Aslan, K.; Zhang, Y.; Hibbs, S.; Baillie, L.; Geddes, C. D. Microwaveaccelerated metal-enhanced fluorescence: application to detection of genomic and
exosporium anthrax DNA in <30 seconds. Analyst. 2007, 132, 1130-1138.
(101) Aslan, K.; Geddes, C. D. Microwave-Accelerated and Metal-Enhanced
Fluorescence Myoglobin Detection on Silvered Surfaces: Potential Application to
Myocardial Infarction Diagnosis. Plasmonics. 2006, 1, 53-59. (Aslan and Geddes ±
A) ± Also below.
(102) Aslan, K.; Huang, J.; Wilson, G. M.; Geddes, C. C. Metal-enhanced
fluorescence -based RNA sensing. J Am Chem Soc. 2006, 128, 4206-7.
(103) Aslan, K.; Holley, P.; Geddes, C. D. Microwave-Accelerated MetalEnhanced Fluorescence (MAMEF) with silver colloids in 96-well plates: Application
to ultra-fast and sensitive immunoassays, High Throughput Screening and drug
discovery. J Immunol Methods. 2006, 312,137-47.
(104) Aslan, K.; Geddes, C. D. Microwave-accelerated metal-enhanced fluorescence
(MAMEF): application to ultra- fast and sensitive clinical assays. J Fluoresc. 2006,
16, 3-8.
137
(105) Aslan, K.; Grell, T. A. Rapid and sensitive detection of troponin I in human
whole blood samples by using silver nanoparticle films and microwave heating. Clin
Chem. 2011, 57, 746-52.
(106) Gedikli, S.; Tabak, O.; Tomsuck, O.; Cabuk, A. Effect of Microwaves on Some
Gram Negative and Gram Positive Bacteria. J App Biol Sci. 2007, 2, 67-71.
(107) Thatcher, S. A. DNA/RNA preparation for molecular detection. Clin Chem.
2015, 61, 89-99. Review.
(108) Melendez, J. H.; Huppert, J. S.; Jett-Goheen, M.; Hesse, E. A.; Quinn, N.;
Gaydos, C. A.; Geddes CD. Blind evaluation of the microwave-accelerated metalenhanced fluorescence ultra-rapid and sensitive Chlamydia trachomatis test by use of
clinical samples. J Clin Microbiol. 2013, 51, 2913-20.
(109) Melendez, J. H.; Santaus, T. M.; Brinsley, G.; Kiang, D.; Mali, B.; Hardick, J.;
Gaydos, C. A.; Geddes, C. D. Microwave-accelerated method for ultra-rapid
extraction of Neisseria gonorrhoeae DNA for downstream detection. Anal Biochem.
2016, 510, 33-40.
(110) Silhavy, T. J.; Kahne, D.; Walker, S. The Bacterial Cell Envelope. Cold Spring
Harb Perspect Biol. 2010, 2, a000414.
(111) Nachamkin, I.; Panaro, N. J.; Li, M.; Ung, H.; Yuen, P. K.; Kricka, L. J.;
Wilding, P. Agilent 2100 Bioanalyzer for Restriction Fragment Length
Polymorphism Analysis of the Campylobacter jejuni Flagellin Gene. J Clin Micro.
2001, 39, 754-57.
(112) Yang, S.; Ramachandran, P.; Hardick, A.; Hsieh, Y. H.; Quianzon, C.; Kuroki,
M.; Hardick, J.; Kecojevic, A.; Abeygunawardena, A.; Zenilman, J.; Melendez, J.; et
al. (2008) Rapid PCR-Based Diagnosis of Septic Arthritis by Early Gram-Type
Classification and Pathogen Identification. J Clin Microbiol.2008, 46, 1386±1390.
(113) Yang, S.; Rothman, R. E.; Hardick, J.; Kuroki, M.; Hardick, A.; Dorshi, V.;
Ramachandran, P.; Gaydos, C. A. Rapid Polymerase Chain Reaction-based Screening
Assay for Bacterial Biothreat Agents. Acad Emerg Med. 2008, 15, 388-392.
(114) Hardick, J.; Won, H.; Jeng, K.; Hsieh, Y. H.; Gaydos, C. A.; Rothman R. E.;
Yang, S. Identification of Bacterial Pathogens in Ascitic Fluids from Patients with
Suspected Spontaneous Bacterial Peritonitis by use of Broad-Range PCR (16S PCR)
coupled with High-Resolution Melt Analysis. J Clin Microbiol. 2012, 50, 2428-32.
(115) Rothman, R. E.; Ramachandran, P.; Yang, S.; Hardick, A.; Won, H.; Kecojevic,
A.; Quianzon, C.; Hsieh, Y.; Gaydos, C. A. Use of Quantitative Broad-based
Polymerase Chain Reaction for Detection and Identification of Common Bacterial
Pathogens in Cerebrospinal Fluid. Acad Emerg Med. 2010, 17, 741-47.
138
(116) Won, H.; Yang, S.; Gaydos, C. A.; Hardick, J.; Ramachandran, P.; Hsieh, Y.
H.; Kecojevic, A.; Njanpop-Lafourcade, B. M.; Mueller, J. E.; et al, A broad range
assay for rapid detection and etiologic characterization of bacterial meningitis:
performance testing in samples from sub-Sahara. Diagn Microbiol Infect Dis. 2012,
74, 22-7.
(117) Fujikawa, H.; Ushioda, H;, Kudo, Y. Kinetics of Escherichia coli destruction by
microwave irradiation. Appl Envirom Microbiol. 1992, 58, 920-4.
(118) Jeng, D. K.; Kaczmarek,. K. A.; Woodworth, A. G.; Balasky, G. Mechanism of
microwave sterilization in the dry state. Appl Envirom Microbiol. 1987, 53, 2133-7.
(119) Takashima, S.; Gabriel, C.; Sheppard, R. J.: Grant, E. H. Dielectric behavior of
DNA solution at radio and microwave frequencies (at 20 degrees C). Biophys J. 1984,
46, 29-34.
(120) Adair, R. K. Extremely low frequency electromagnetic fields do not interact
directly with DNA. Biolelectromagnetics. 1998, 19, 136-8.
(121) Di Mascio, P.; Wefers, H.; Do-Thi H.P.; Lafleur, M. V.; Sies, H. Singlet
molecular oxygen causes loss of biological activity in plasmid and
bacteriophage DNA and induces single-strand breaks. Biochim Biophys Acta. 1989,
1007, 151-17.
(122) Wefers, H.; Di Mascio, P.; Do-Thi H.P.; Shulte-Frohlinde, D.; Sies, H. Effects
of singlet oxygen on the biological activity of DNA and its involvement in single
strand-break formation. Basic Life Sci,. 1988, 49, 473-7.
(123) Sies, H.; Menck, C. F. Singlet oxygen induced DNA damage. Mutat Res. 1992.
275, 3-6. Review
(124) Atamma, H.; Cheung, I.; Ames, B.N. A method for A method for detecting
abasic sites in living cells: age-dependent changes in base excision repair. Proc Natl
Acad Sci U S A. 2000. 97, 686-91.
(125) Wolf, F. L.; Torsello, A.; Tedesco, B.; Fasanella, S.; Boninsegna, A.;
'¶$VFHQ]R 0 *UDVVL & $]]HQD * % &LWWDGLQL $ -Hz extremely low
frequency electromagnetic fields enhance cell proliferation and DNA damage:
possible involvement of a redox mechanism. Biochim Biophys Acta. 2005.1743, 1209.
(126) Beh, C. J.; Zhou, W.; Wang, T. H. PDMS-glass bonding using grafted
polymeric adhesive ± alternative process flow for compatibility with patterned
biological molecules. Lab Chip. 2012, 4120-27.
139
(127) Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. A DNA-based
method for rationally assembling nanoparticles into macroscopic materials. Nature.
1996, 382, 607-9.
(128) Stevenson, K. A.; Muralidharan, G.; Maya, L.; Wells, J. C.; Barhen, J.;
Thundat, T. J. Covalent attachment of gold nanoparticles to DNA templates. Nanosci
Nanotechnol. 2002, 2, 397-404.
(129) Zhang, X.; Servos, M. R.; Liu, J. J. Instantaneous and quantitative
functionalization of gold nanoparticles with thiolated DNA using a pH-assisted and
surfactant-free route. Am Chem Soc. 2012, 134, 7266-9.
(130) Ripa, T.; Nilsson, P. A variant of Chlamydia trachomatis with deletion in
cryptic plasmid: implications for use of PCR diagnostic tests. Euro Surveill. 2006, 11.
E061109.
(131) Ripa, T.; Nilsson, P. A. A Chlamydia trachomatis strain with a 377-bp deletion
in the cryptic plasmid causing false-negative nucleic acid amplification tests. Sex
Transm Dis. 2007, 34, 255-6.
(132) Abugo, O. O.; Herman, P.; Lakowicz, J. R. Fluorescence properties of albumin
blue 633 and 670 in plasma and whole blood. J Biomed Opt. 2001, 6, 359-65.
(133) Deng, T.; Li, J.; Zhang, L. L.; Jiang, J. H.; Chen, J. N.; Shen, G. L.; Yu, R. Q.
A sensitive fluorescence anisotropy method for the direct detection of cancer cells in
whole blood based on aptamer-conjugated near-infrared fluorescent nanoparticles.
Biosens Bioelectron. 2010, 25, 1587-91.
(134) Michel, C. E.; Sonnex, C.; Carne, C. A.; White, J. A.; Magbanua, J. P.; Nadala,
E. C. Jr; Lee, H. H. J. Clin Chlamydia trachomatis load at matched anatomic sites:
implications for screening strategies. J Clin Microbiol. 2007, 45, 1395-402.
(135) Recuero-Checa, M. A.; Sharma, M.; Lau, C.; Watkins, P. A.; Gaydos, C. A.;
Dean, D. Chlamydia trachomatis growth and development requires the activity of
host Long-chain Acyl-CoA Synthetases (ACSLs). Sci Rep. 2016, 6, 23148.
(136) Peeling, W. R. Laboratory diagnosis of Chlamydia pneumoniae infections. Can
J Infect Dis. 1995. 6, 198-203. Review.
(137) Boyd. M. A.; Tennant, S. M.; Melendez, J. H.; Toema, D.; Galen, J. E.; Geddes,
C. D.; Levine, M. M. Adaptation of red blood cell lysis represents a fundamental
breakthrough that improves the sensitivity of Salmonella detection in blood. J Appl
Microbiol. 2015, 118, 1199-209.
(138) Bolan, G. A.; Sparling, F. P.; Wasserheit, J. N. The emerging threat of
untreatable gonococcal infection. N. Engl J Med. 2012, 366, 485-487.
140
(139) Brook, G. The performance of non-NAAT point-of-care (POC) tests and rapid
NAAT tests for chlamydia and gonorrhea infections. An assessment of currently
available assays. Sex Transm Infect. 2015, 91, 539-44. Review.
(140) Whiley, D. M.; Buda, P. J.; Bayliss, J.; Cover, L.; Bates, J.; Sloots, T. P. A new
confirmatory Neisseria gonorrhoeae real-time PCR assay targeting the porA
pseudogene. Eur J Clin Microbiol Infect Dis. 2004, 23, 705-710.
(141) Whiley, D. M.; Anderson, T. P.; Barrat, K.; Beaman, M. H.; Carter, M.;
Freeman, K.; Hallsworth, P.; Limnios, E. A.; Lum,G.; Merien, F.; et al. Evidence that
the gonococcal porA pseudogene is present in a broad range of Neisseria
gonorrhoeae strains; suitability as a diagnostic target. Pathology. 2006, 38, 445-8.
(142) Gurtler, V.; Mayall, B. C.; Wang, J. HRM confirmation of Neisseria
gonorrhoeae LQFOLQLFDOVSHFLPHQVE\*ĺ$SRVLWLRQPXWDWLRQGHWHFWLRQLQWKH
16S rRNA gene before sequencing and after porA confirmation. J Microbiol
Methods. 2012, 89,148-52.
(143) Mangold, K. A.; Regner, M.; Tajuddin, M.; Tajuddin, A.M.; Jennings, L.; Du,
H.; Kaul, K. L. Neisseria species identification assay for the confirmation of Neisseria
gonorrhoeae-positive results of the COBAS Amplicor PCR. J Clin Microbiol. 2007,
45, 1403-9.
(144) Bhat, K. S.; Gibbs, C. P.; Barrera, O.; Morrison, S. G.; Jahnig, F.; Stern, A,;
Kupsch, E. M.; Meyer, T. F.; Swanson, J. The opacity proteins of Neisseria
gonorrhoeae strain MS11 are encoded by a family of 11 complete genes. J.Mol
Microbiol. 1991, 5, 1889-901.
(145) Geraats-Peters, C. W.; Brouwers, M.; Schneeberger, P. M.; van der Zanden, A.
G.; Bruisten, S. M.; Weers-Pothoff, G.; Boel, C. H.; van den Brule, A. J. Harmsen, H.
G.; Hermans, M. H. Specific and sensitive detection of Neisseria gonorrhoeae in
clinical specimens by real-time PCR. J clin Microbiol. 2005, 43, 5653-9.
(146) Hone, D. M.; Harris, A. M.; Chatfield, S.; Dougan, G.; Levine, M. M.
Construction of genetically defined double aro mutants of Salmonella Typhi. Vaccine.
1991, 9, 810-6.
(147) Levine, M. M.; Galen, J.; Barry, E.; Noriega, F.; Chatfield, S.; et al.
Attenuated Salmonella as live oral vaccines against typhoid fever and as live vectors.
J Biotechnol. 1996, 44, 193-6.
(148) Wang, J. Y.; Noriega, F. R.; Galen, J. E.; Barry, E.; Levine, M. M. (2000)
Constitutive expression of the vi polysaccharide capsular antigen in attenuated
Salmonella enterica serovar Typhi oral vaccine strain CVD 909. Infect Immun. 2000,
68, 4647-52.
141
(149) Malorny, B.; Löfström, C.; Wagner, M.; Krämer, N.; Hoorfar, J. Enumeration
of Salmonella bacteria in food and feed samples by real-time PCR for quantitative
microbial risk assessment. Appl Environ Microbiol. 2008, 74, 1299-1304.
(150) Whiley, D. M.; Sloots, T. P. Comparison of three in-house multiplex PCR
assays for the detection of Neisseria gonorrhoeae and Chlamydia trachomatis using
real-time and conventional detection methodologies. Pathology. 2005, 3, 364-70.
(151) Tabrizi, S. N.; Chen, S.; Garland, S. M. Evaluation of opa-based real-time PCR
for detection of Neisseria gonorrhoeae. Sex Transm Dis. 2005, 32, 199-202.
(152) Giles, J.; Hardick, J.; Yuenger, J.; Dan, M.; Reich, K.; Zenilman, J. Use of
applied biosystems 7900HT sequence detection system and TaqMan assay for
detection of quinolone-resistant Neisseria gonorrhoeae. J Clin Microbiol. 2004, 42,
3281-3.
(153) Goire, N.; Freeman, K.; Tapsall, J. W.; Lambert, S. B.; Nissen, M. D.; Sloots,
T. P. Enhancing gonococcal antimicrobial resistance surveillance: a real-time PCR
assay for detection of penicillinase-producing Neisseria gonorrhoeae by use of
noncultured clinical samples. J Clin Microbiol. 2011, 49,513-8.
(154) Ochiai, S.; Ishiko, H.; Yasuda, M.; Deguchi, T. Rapid detection of
the mosaic structure of the Neisseria gonorrhoeae penA Gene, which is associated
with decreased susceptibilities to oral cephalosporins. J Clin Microbiol. 2008, 46,
1804-10.
(155) Bissessor, M.; Tabrizi, S. N.; Fairley, C. K.; Danieleswki, J.; Whitton, B.; Bird,
S.; Garland, S.; Chen, M. Y. Differing Neisseria gonorrhoeae bacterial loads in the
pharynx and rectum in men who have sex with men: implications for gonococcal
detection, transmission, and control. J Clin Microbiol. 2011, 49, 4304-6.
(156) Belland, R. J.; Morrison, S. G.; Ison C.; Huang, W. M. Neisseria gonorrhoeae
acquires mutations in analogous regions of gyrA and parC in fluoroquinoloneresistant isolates. Mol Microbiol. 1994, 14, 371-80.
(157&HQWHUVIRU'LVHDVH&RQWURODQG3UHYHQWLRQ&'&8SGDWHWR&'&¶VVH[XDOO\
transmitted diseases treatment guidelines, 2006: fluoroquinolones no longer
recommended for treatment of gonococcal infections MMWR Morb Mortal Wkly Rep.
2007, 51, 332-336.
(158) Kirkcaldy, R. D.; Hook, E. W. 3rd.; Soge, O, O.; Del Rio, C.; Kubin, G.;
Zenilman, J. M.; Papp, J. R. Trends in Neisseria gonorrhoeae Susceptibility to
Cephalosporins in the United States, 2006-2014. JAMA. 2015, 314, 1869-71.
(159) Mariani, S.; Minunni, M. Surface plasmon resonance applications in clinical
analysis. Anal Bioanal Chem. 2014, 406, 2303-23. Review.
142
(160) Haynes, W. M. (2013). CRC handbook of chemistry and physics: A readyreference book of chemical and physical data. Boca Raton: CRC Press.
(161) Hsu, S. H.; Lin, Y. Y.; Lu, S. H.; Tsai, I. F.; Lu, Y. T.; Ho, H. T.
Mycobacterium tuberculosis DNA Detection Using Surface Plasmon Resonance
Modulated by Telecommunication Wavelength. Sensors (Basel). 2014, 14, 458-67.
(162) Milkani, E.; Morais, S.; Lambert, C. R.; McGimpey, W. G. Detection of
oligonucleotide mismatches with a surface plasmon resonance sensor. Biosens
Bioelectron. 2010, 25, 1217-20.
(163) Peterson, A. W.; Heaton, R. J.; Georgiadis, R. M. The effect of surface probe
density on DNA hybridization. Nucleic Acids Res. 2001. 29, 5163-8.
(164) Wong, E. L.; Chow, E.; Gooding, J. J. DNA recognition interfaces: The
influence of interfacial design on the efficiency and kinetics of hybridization.
Langmuir. 2005, 21, 6957-65.
(165) Gong, P.; Lee, C. Y.; Gamble, L. J; Castner, D. G; Grainger, D. W.
Hybridization behavior of mixed DNA/alkylthiol monolayers on gold:
characterization by surface plasmon resonance and 32P radiometric assay. Anal
Chem. 2006, 78, 3326-34.
(166) Tennant, S. M.; Toema, D.; Qamar, F.; Iqbal, N.; Boyd, M. A.; Marshall, J. M.;
Blackwelder, W. C.; Wu Y.; Quadri, F.; Khan, A.; Aziz, F.; et al. Detection of
Typhoidal and Paratyphoidal Salmonella in Blood by Real-time Polymerase Chain
Reaction. Clin Infect Dis. 2015, 61, Suppl 4:S241-50.
(167) Zotti-Martelli, L.; Peccatori, M.; Scarpato, R.; Migliore, L. Induction of
micronuclei in human lymphocytes exposed in vitro to microwave radiation. Mutat
Res. 2000, 472, 51-8.
(168) Tice, R. R.; Hook, G. G.; Donner, M.; McRee DI.; Guy AW. Genotoxicity of
radiofrequency signals. Investigation of DNA damage and micronuclei induction in
cultured human blood cell. Biolectromagnetics. 2002, 23, 113-26.
(169) Campisi, A.; Gulino, M.; Acquaviva, R.; Bellia, P.; Raciti, G.; Grasso, R.;
Musumeci, F.; Vanella, A.; Triglia, A. Reactive oxygen species levels and DNA
fragmentation on astrocytes in primary culture after acute exposure to low intensity
microwave electromagnetic field. Neurosci Lett. 2010, 473, 52-5.
(170) Fossey, J.; Lefort, D.; Sorba, S. Free Radicals in Organic Chemistry. Wiley:
New Jersey. 1995.
(171) Quan, Xie.; Zhang, Y.; Chen, Shuo, Zhao, Y.; Yang, F. Generation of hydroxyl
radical in aqueous solution by microwave energy using activated carbon as catalyst
143
and its potential in removal of persistent organic substances J Mol Catal A: Chem.
2007, 263, 216-222.
(172) Wang, J.; Guo, Y.; Liu, B.; Jin, X.; Liu, L.; Xu, R.; Kong, Y.; Wang, B.
Detection and analysis of reactive oxygen species (ROS) generated by nano-sized
TiO2 powder under ultrasonic irradiation and application in sonocatalytic degradation
of organic dyes. Ultrason Sonochem. 2011, 18, 177-83.
(173) Wang, J.; Guo, Y.; Gao, J.; Jin, X.; Wang, Z.; Wang, B.; Li, K.; Li, Y.
Detection and comparison of reactive oxygen species (ROS) generated by
chlorophyllin metal (Fe, Mg and Cu) complexes under ultrasonic and visible-light
irradiation. Ultrason Sonochem. 2011, 18, 1028-34.
(174) Zhang, Z.; Yu, F.; Huang, L.; Jiatieli, J.; Li, Y.; Song, L.; Yu, N.; Dionysiou, D.
' &RQILUPDWLRQ RI K\GUR[\O UDGLFDOV ‡2+ JHQHUDWHG LQ WKH SUHVHQFH RI 7L2
supported on AC under microwave irradiation. J. Hazard. Mater. 2014, 278, 152-7.
(175) Valko, M.; Rhodes, C. J.; Moncola, J.; Izakovic, M.; Mazura, M. Free radicals,
metals and antioxidants in oxidative stress-induced cancer. Chem boil Interact. 2006,
160, 1-40.
(176) Schurch, S.; Bernal-Mendez, E.; Leumann, C. J Electrospray tandem mass
spectrometry of mixed-sequence RNA/DNA oligonucleotides. J Am Soc Mass
Spectrom. 2002, 13, 936-45.
(177) Andersen, T. E.; Kirpekar, F. RNA Fragmentation in MALDI Mass
Spectrometry Studied by H/D-Exchange: Mechanisms of General Applicability to
Nucleic Acids. J Am Soc Mass Spectrom. 2006, 17, 1353-68.
(178) Zhang, Y.; Aslan, K.; Previte, M. J, Geddes, C. D. Plasmonic engineering of
singlet oxygen generation. Proc Natl Acad Sci U S A. 2008, 105, 1798-802.
144
Документ
Категория
Без категории
Просмотров
0
Размер файла
4 690 Кб
Теги
sdewsdweddes
1/--страниц
Пожаловаться на содержимое документа