close

Вход

Забыли?

вход по аккаунту

?

National Geographic N°232 – Janvier 2019-compressed

код для вставкиСкачать
LONDRES
SANTÉ
PATAG O N I E
LE RENOUVEAU DE
LES THÉRAPIES
LES PUMAS DE LA
LA VILLE-MONDE
DU FUTUR
DISCORDE
LES PROMESSES DE LA
MÉDECINE CHINOISE
LA TRADITION À LA
RESCOUSSE DE LA SCIENCE
3’:HIKOKC=UUZZUW:?a@c@n@m@a";
M 04020 - 232 - F: 5,50 E - RD
BEL : 6 € – CH : 9,50 CHF - CAN : 7,99 CAD – D : 7.50 € - ESP : 7 € - GR : 7 € - ITA : 7 € – LUX : 6 € – PORT.CONT. : 7 € – DOM : Avion : 7.5 € ; Surface : 6 € - Maroc : 65 DH – Tunisie : 10 TND – Zone CFA Bateau : 4 000 XAF – Zone CFP Avion : 1 600 XPF - Bateau : 650 XPF.
JANVIER 2019
ÉDITO
Poissons-zèbres, bile d’ours
et grandes aiguilles…
PAR GABRIEL JOSEPH-DEZAIZE
La révolution qu’annonce la médecine personnalisée est sans commune mesure avec tout
ce que nous avons connu jusqu’ici. Elle permet
de lever le voile sur ce qui, dans notre corps,
est toujours resté secret, et d’anticiper ce que
réserve notre avenir médical. Dans son reportage sur la médecine du futur, la journaliste
Fran Smith résume bien la promesse de la
médecine personnalisée : adapter la prévention, le diagnostic et le traitement selon le profil
biochimique de chacun. Les dernières avancées
de la génétique et de l’analyse des données
ouvrent la perspective d’une vie meilleure et
plus longue pour l’être humain.
Il n’est pourtant parfois pas nécessaire
d’attendre des miracles de la technologie pour
réaliser des avancées médicales spectaculaires.
À titre d’exemple, des larves de poissons-zèbres
sont désormais utilisées pour identifier la
chimiothérapie la mieux à même d’éradiquer
le cancer d’un patient.
RÉDACTEUR EN CHEF
Bientôt, l’œil bionique ne relèvera plus de la science-fiction.
Ce prototype a été créé en une heure par une imprimante 3D.
Dans le passé, les Chinois avaient trouvé des
remèdes et des techniques que la science
moderne redécouvre et adjoint à de nouveaux
protocoles. Saviez-vous que, dès le VIIIe siècle,
les guérisseurs chinois utilisaient de la bile d’ours
pour soigner les problèmes de foie et les
hémorroïdes ? Et qu’aujourd’hui elle pourrait
être utilisée contre les maladies cardiaques ?
L’acupuncture, pour sa part, offre un appui
considérable dans la prise en charge de maladies graves comme le cancer. Un centre intégré
de médecine chinoise a ainsi été créé à l’hôpital
de la Pitié-Salpêtrière, à Paris, pour valider l’efficacité de cette pratique plurimillénaire. Et, au
CHU de Lyon-Sud, des patients sont traités,
grâce à elle, contre les effets secondaires de la
chimiothérapie. Corinne Soulay a rapporté un
reportage plein d’espoir. Bonne lecture.
3+272ȗ5(%(&&$+$/(‹48,3('81*0
JANVIER 2019
5
N AT I O N A L G E O G R A P H I C
S O M M A I R E
R E G A R D E R
D É C O U V R I R
22
E X P L O R E R
32
L’AUTRE CÔTÉ DU MIROIR
12
Nos armoires
à pharmacie
En couverture
Bocaux d’ingrédients naturels
utilisés en médecine chinoise.
3KRWRș)ULW]+RƂPDQQ
Dans les salles de bains
du monde entier, les
placards et les armoires
à pharmacie cachent
comprimés, sirops,
toniques, onguents et
autres remèdes.
LA GRANDE IDÉE
Connectée et
high-tech : la
médecine du futur
En continu et en
réseau, les traitements
médicaux de demain
se focaliseront
sur le bien-être et
la prévention.
PA R M A X AG U I L E R A- H E L LW E G
ET AUSSI
L’interview..................... p. 34
Les missions
sur le terrain................. p. 36
Les bêtes de sexe........ p. 37
PA R DA N I E L K R A F T
ET AUSSI
L’infographie................ p. 31
P H OTO G R A P H I E S D E
GA B R I E L E GA L I M B E RT I
Ce numéro comporte deux encarts
multi-noël posés sur une sélection
d’abonnés, une lettre extension
hors-série ADD/ADI Welcome Pack
sur une sélection d’abonnés et
un encart LINVOSGES .
6
Le photographe
médecin
Quand un homme est
confronté à un choix
cornélien entre deux
vocations passionnantes.
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
À
S U I V R E
La sélection. . . . . . . . . . . . . . . . p. 132
Le mois prochain. . . . . . p. 137
Le making of. . . . . . . . . . . . . . p. 138
S O M M A I R E
E N Q U Ê T E S E T
R E P O RTAG E S
Chaque patient
est unique
Basée sur des avancées
dans les domaines
de la génétique et de
l’analyse des données,
la médecine
personnalisée conçoit
des traitements sur
mesure, selon le profil
biochimique du
patient. Cette nouvelle
approche pourrait
bouleverser des
décennies de pratique
médicale.
PAR FRAN SMITH
PHOTOGRAPHIES DE
CRAIG CUTLER
................................................
p. 40
Quand la
médecine chinoise
inspire la science
Les remèdes traditionnels auscultés de près.
PAR PETER GWIN
PHOTOGRAPHIES DE
FRITZ HOFFMANN
.........................................
p. 64
La médecine chinoise
s’invite à l’hôpital
Londres dans le flou
Entre une démographie
galopante et l’approche
du Brexit, quel avenir
pour la ville-monde ?
PAR LAURA PARKER
PHOTOGRAPHIES DE
LUCA LOCATELLI
...............................................
p. 92
Pumas de Patagonie
En France, de plus en
plus d’établissements
de soins proposent
acupuncture et qi gong.
Pour les éleveurs,
les pumas sont des
prédateurs ravageurs ;
pour les touristes, ils
sont une attraction.
PAR CORINNE SOULAY
PHOTOGRAPHIES
D’EMANUELA ASCOLI
.........................................
..............................................
p. 88
PAR ELIZABETH ROYTE
PHOTOGRAPHIES
D’INGO ARNDT
p. 120
DA N S L’ U N I V E R S N AT I O N A L G E O G R A P H I C
LIVRE
Vagues d’exception
TÉLÉVISION
L’Égypte à l’honneur
Suivez le travail des égyptologues qui, grâce à des technologies de pointe,
analysent et restaurent les artefacts du tombeau de Toutankhamon,
mis au jour en ����. Puis, partez à la recherche de la tombe d’Alexandre
le Grand, génie militaire proclamé pharaon, dont le corps n’a jamais été
retrouvé. Enfin, prenez part aux fouilles d’une équipe internationale
d’archéologues, qui exhume des trésors de la vallée des Rois (photo).
Pendant sept semaines, cap sur l’Égypte, avec une série de documentaires
inédits consacrés aux dernières découvertes scientifiques.
Beauté mer, d’Olivier
le Carrer et Ben Thouard.
Sur National Geographic, du 13 janvier au 3 mars, le dimanche, à 20 h 40.
HORS-SÉRIE NATIONAL GEOGRAPHIC TRAVELER
HORS�SÉRIE
DÉCEMBRE 2018 - JANVIER 2019
TRAVELER
100 AVENTURES INOUBLIABLES
100
aventures
inoubliables
Sortir des sentiers battus
Retrouver son corps
Explorer son âme
Agir avec son cœur
Un saut à deux dans
le lac artificiel de
Blue Mesa, dans l’État
du Colorado.
Paradis tropicaux,
rouleaux gigantesques,
houle impétueuse...
Découvrez la splendeur
et la fragilité des mers
du monde entier
à travers 360 clichés
saisissants, mis en
valeur dans un livre
grand format. Le plus :
six dépliants intégrés,
pour apprécier encore
davantage la majesté
du spectacle.
HORS-SÉRIE
100 aventures
inoubliables
TÉLÉVISION
Opération sauvetage
Envie d’un circuit étonnant, d’un voyage
solidaire ou d’une expérience intérieure ?
Pour ce nouveau hors-série, l’équipe de
National Geographic Traveler a sélectionné ��� aventures dont vous reviendrez changé : cours de kung-fu avec les
moines shaolin, ski jusqu’au pôle Sud,
fête de Pâques à Lalibela ou surveillance
des tortues marines au Costa Rica.
En kiosque.
Durant quatre mois,
des chercheurs ont
sillonné le delta
de l’Okavango, au
Botswana, pour étudier
cette zone humide
menacée par l’activité
humaine. Le
documentaire Into
the Okavango retrace
leur expédition.
Sur Nat Geo Wild,
le 27 janvier, à 20 h 45.
Patrimoine en danger, éléphants étonnants et cratère géant
VO S N E W S P R É F É R É E S S U R N AT I O N A LG E O G R A P H I C . F R
I ARCHÉOLOGIE
Selon une étude, le patrimoine des
côtes italiennes, croates, grecques et
tunisiennes est en péril. En cause :
l’élévation du niveau de la mer.
10 N A T I O N A L G E O G R A P H I C
I animaux
Conséquence du braconnage : au
Mozambique, �� � des femelles
éléphants nées depuis vingt-cinq ans
sont dépourvues de défenses.
I SCIENCES
La Nasa a repéré un cratère de �� km
de diamètre, caché sous un glacier
groenlandais. Des chercheurs
pensent à un impact de météorite.
PHOTO : WINDFALL FILMS (ÉGYPTE)
R E G A R D E R
L A T E R R E S O U S TO U S L E S A N G L E S
N AT I O N A L G E O G R A P H I C
12
N AT I O N A L G E O G R A P H I C
NOS ARMOIRES À PHARMACIE
Des habitants du monde entier déballent devant l’objectif les remèdes qu’ils conservent chez eux.
P H OTO G R A P H I E S D E GABRIELE GALIMBERTI
Remo Ballardini,
bibliothécaire à Riva
del Garda, montre le
contenu de son armoire
à pharmacie : des
produits curatifs et
préventifs, dont un
antiseptique local.
I TA L I E
JANVIER 2019
13
R E G A R D E R
SUISSE
Amateurs d’art, Candelita et Arnaud Brunel possèdent aussi une belle collection de médicaments.
I TA L I E
Andrea Buccolini a toujours de la pommade pour les contusions qu’il se fait lors de reconstitutions de batailles.
14
N AT I O N A L G E O G R A P H I C
PHOTO DU BAS : EDOARDO DELILLE
INDE
Les médicaments de cette famille, à Mumbai, sont surtout pour Abbas Ali Sagri (assis), après son infarctus.
L E T TO N I E
Ingrīda Pulekse, institutrice retraitée, conserve les traitements de ses maladies passées.
JANVIER 2019
15
R E G A R D E R
HAÏTI
16
Wholl-Lins Balthazar (à gauche), ici avec sa belle-mère et son cousin, se fie à la médecine traditionnelle,
N AT I O N A L G E O G R A P H I C
notamment aux plantes vendues sur les marchés et au medsen fey – le « docteur feuilles ».
JANVIER 2019
17
R E G A R D E R
C O S TA R I C A
JAP ON
18
Les parents de Johan (en tailleur), 7 ans, ne lui ont pas encore donné son médicament contre l’hyperactivité.
Chez les Kawai, les médicaments de Yasumasa traitent son problème cardiaque, ceux de Nobuko, l’ostéoporose.
N AT I O N A L G E O G R A P H I C
FRANCE
Les Chauffert-Yvart consomment de nombreux médicaments, des anxiolytiques aux antibiotiques.
COLOMBIE
Hilda Tarazona (à droite), sa fille et sa petite-fille partagent maison et armoire à pharmacie.
JANVIER 2019
19
R E G A R D E R
DERRIÈRE LES PHOTOS
P I LU L E S, P OTI ONS ET P OM M A D E S S’AMONC E LLE NT DANS
L E S SA L L E S D E BA I NS ET L E S P L AC ARDS DU MONDE E NTIE R.
le photographe
Gabriele Galimberti pose toujours la
même question lorsqu’il rencontre
quelqu’un : « Puis-je voir ce que votre
armoire à pharmacie contient ? »
Certains sont gênés, d’autres fiers de
la lui montrer. « Les médicaments, dit
Galimberti, révèlent qui sont les gens
– leurs désirs, leurs besoins, leurs
maladies. C’est très intime. »
Que dévoilent nos médicaments ?
Par exemple, notre niveau de richesse.
Les armoires à pharmacie des pays
développés débordent. Dans les pays
plus pauvres, les habitants entassent
les remèdes moins vite, ou pas du tout.
Une Haïtienne n’avait pas un comprimé chez elle : « Si je tombe malade,
j’en achèterai un au vendeur de rue. »
La série photographique Home
Pharma fait partie d’un projet plus
vaste, Happy Pills (« pilules du bonheur »). Galimberti et trois confrères
y documentent la poursuite sans fin
du bonheur à travers les substances
chimiques. Les gens absorbent des
médicaments pour être plus forts,
LO R S D E S E S VOYAG E S ,
SUISSE
pour dormir plus (ou moins, parfois),
vieillir plus lentement, être plus virils,
favoriser la grossesse ou l’empêcher.
Les raisons d’acheter et de stocker
les médicaments sont aussi multiples :
parce qu’ils sont bon marché, ou parce
que les soins plus avancés sont chers,
ou parce que nous nous inquiétons
d’en manquer en cas de besoin, ou
parce qu’on nous les a prescrits et que
nous ne savons que faire du reliquat.
Observez le contenu de différentes
armoires à pharmacie du monde, et
les modes de vie locaux s’esquisseront.
À Paris et à New York, Galimberti a vu
quantité d’anxiolytiques et d’antidépresseurs. Les Indiens ont tendance
à choisir des médicaments portant
des étiquettes indiennes, indépendamment de leur qualité ou de leur
puissance. En Afrique, des armoires
à pharmacie contenaient des médicaments venus de Chine, souvent
dépourvus d’étiquette.
Mais toutes les personnes photographiées avaient ceci en commun :
aucune n’était malade. — DANIEL STONE
Susan Fischer, professeure de yoga, ne recourt qu’à l’homéopathie et aux extraits de plantes.
HOME PHARMA FAIT PARTIE DU PROJET HAPPY PILLS (« PILULES DU BONHEUR »), MENÉ PAR PAOLO WOODS, GABRIELE GALIMBERTI, ARNAUD ROBERT ET EDOARDO DELILLE.
In English, please.
Une parution exceptionnelle 100% bilingue
Toute la presse est sur prismashop.fr
D É C O U V R I R
L E S C H A N G E M E N T S E T L E S I N N O VAT I O N S P O U R D E M A I N
N AT I O N A L G E O G R A P H I C
Connectée et
high-tech : la
médecine du futur
G R Â C E A U X D O N N É E S N U M É R I Q U E S E T À L’A C C E N T M I S S U R L A
P R ÉV E N T I O N, L E S S O I N S S E RO N T T O TA L E M E N T I N D I V I D UA L I S É S .
22
J
N AT I O N A L G E O G R A P H I C
PA R DANIEL KRAFT
connu Harriett sans notre amie
commune, Linda. Je suis médecin en Californie ;
Harriett est responsable de communication dans
la ville de New York. Et Linda a cofondé une entreprise en ligne de génomique personnelle à laquelle
Harriett et moi avons envoyé nos informations
génétiques pour analyse.
Linda nous a présentés après avoir vu qu’Harriett
et moi avions une chose en commun : un type rare
d’ADN mitochondrial, signe que nous sommes lointainement apparentés. Pour m’amuser, j’ai fondé
un groupe Facebook ouvert à ceux qui possèdent
le même variant génétique que le nôtre.
Si je raconte cette histoire, c’est dans un but
précis : faire comprendre qu’Harriett et moi nous
sommes rencontrés grâce à une prouesse scientifique – l’analyse génétique pour tous, à bas coût –,
autrefois inimaginable et désormais courante.
La convergence des technologies numériques et
E N ’AU R A I S JA M A I S
PROTHÈSES
L’œil bionique, bientôt une réalité
Fabriquer un œil bionique est compliqué, mais .
des chercheurs viennent de faire une avancée :
à l’aide de la 3D, ils ont imprimé une mosaïque
de photorécepteurs sur un support ovoïdal
en verre. Les particules d’argent utilisées
comme « encre » sont restées en place, malgré
la surface courbe, et les photodiodes ont
converti la lumière en électricité avec une
efficacité de 25 %. — R A C H E L H A R T I G A N S H E A
des réseaux sociaux nous a permis de connaître nos
génotypes et de partager ces découvertes avec le
reste du monde connecté.
Depuis, nous avons assisté à une explosion de
progrès et d’innovations techniques qui ont
le potentiel de redéfinir de nombreux aspects de
la santé et de la médecine.
Les innovations que je vais décrire, et dont beaucoup n’en sont qu’à leurs balbutiements, sont
impressionnantes en tant que telles. Ce que j’apprécie aussi, c’est qu’elles nous permettent de nous
éloigner d’un système de soins compartimentés
pour nous diriger vers un modèle de « santé connectée ». Imaginez : une attention individualisée, en
temps réel, portée à votre santé et à votre bien-être,
permise par l’analyse de données. Il ne s’agit plus
simplement de soigner les maladies, mais, de plus
en plus, de les anticiper.
les données
médicales des patients n’étaient collectées que
ponctuellement, surtout lors d’un séjour à l’hôpital, et se retrouvaient dispersées entre des dossiers
papier et des systèmes d’archivage électroniques.
Aujourd’hui, il existe une meilleure option : la technologie personnalisée, capable de surveiller en permanence les signes vitaux et d’enregistrer les
données de manière détaillée.
À peine une décennie après la révolution des
« objets connectés », symbolisée par le lancement
du premier bracelet Fitbit, les dispositifs de surveillance de la santé sont omniprésents. La plupart
servent à mesurer et à enregistrer l’activité sportive.
À l’avenir, ces moniteurs seront essentiels pour prévenir, diagnostiquer et soigner les maladies.
Des tatouages électroniques et des capteurs
adhésifs pourront réaliser un électrocardiogramme,
mesurer la fréquence respiratoire, vérifier le taux
de glycémie et envoyer les résultats par Bluetooth.
D A N S L’A N C I E N M O D È L E D E S O I N S ,
INFORMATION
L’explosion des données de santé
À quelle vitesse se développent les données
liées à la santé ? Selon un rapport de la faculté
de médecine de Stanford, « le volume des
données de santé croît à un rythme
astronomique : 153 exaoctets (1 exaoctet =
1 milliard de gigaoctets) ont été produits en
2013 et on estime que 2 314 exaoctets le seront
en 2020, ce qui donne un taux de croissance
annuelle d’au moins 48 % ».
NANOSCIENCES
L’origami ADN
Cette approche consiste à fabriquer
des formes à l’échelle nanométrique,
en utilisant la technique de l’origami
pour plier de l’ADN. Les bioingénieurs
entrent la forme souhaitée dans un
algorithme, qui détermine comment
plier un long brin (ou séquence)
d’ADN en des formes en 2D et 3D,
maintenues par des fragments d’ADN
plus courts. D’autres molécules
réparties sur la surface de la séquence
lui donnent sa fonction, par exemple
apporter des subtances à un endroit
du corps. Selon Mark Bathe, du MIT,
le « graal » serait de franchir la barrière
hémato-encéphalique, qui empêche
nombre de médicaments d’atteindre
le cerveau. —T H E R E S A M A C H E M E R
PHOTOS : REBECCA HALE, ÉQUIPE DU NGM (ŒIL) ;
ERIK BENSON ET BJÖRN HÖGBERG, INSTITUT KAROLINSKA
DÉCOUVRIR
|
LA GRANDE IDÉE
OBJETS
CONNECTÉS
Des lentilles pour diabétiques
Des lentilles de contact pourraient mesurer
la glycémie d’un patient dans ses larmes. Des
Sud-Coréens ont réussi à y fixer un système
électronique souple et transparent, qui ne
gêne pas la vision et envoie du courant à des
capteurs régulant le glucose. — E V E C O N A N T
ROBOTIQUE
La gélule qui se déplie
Nouveauté chez les robots origami : un rectangle,
contenant un aimant, capable de se plier en
accordéon pour tenir dans une gélule à ingérer.
Ce robot, en phase de test, se déplie dans les
intestins pour saisir et emporter un petit objet
avalé par accident ou réparer un tissu abîmé par
ce dernier. — L O R I C U T H B E R T
Les aides ou les prothèses auditives avec capteurs intégrés ne se contenteront pas d’amplifier
le son ; elles suivront aussi le rythme et les mouvements du cœur.
Demain, les lentilles de contact intelligentes
contiendront des milliers de biocapteurs et seront
conçues pour détecter les signes avant-coureurs du
cancer et d’autres pathologies. Des modèles en
développement pourraient un jour mesurer la glycémie dans les larmes, pour aider les diabétiques
à gérer leur alimentation et leur traitement.
Parmi les dispositifs implantables sous la peau,
on pourrait trouver des puces RFID contenant le
dossier médical du patient. Des dispositifs à ingérer sous forme de gélules se déploieront dans le système gastro-intestinal, afin d’effectuer des tâches
telles que la délivrance de médicaments.
Un patch de monitorage sur l’abdomen d’une
femme enceinte pourra détecter les contractions
du muscle utérin, pour mieux déterminer quand
le travail commence. Il y aura même une aide hightech pour les bébés en couveuse : un casque audio
diffusera une musique apaisante ou stimulante,
tandis qu’un scanner vérifiera si cela fonctionne,
en observant les ondes cérébrales du prématuré.
Et si nous voulions collecter des données médicales quand les gens ne portent aucun dispositif ?
Des ingénieurs de l’Institut de technologie du
Massachusetts (MIT) ont modifié une sorte de
boîtier Wi-Fi pour qu’il capte les signes vitaux et
les cycles du sommeil de plusieurs personnes
vivant sous le même toit.
À mesure que de nouvelles techniques de détection apparaîtront, elles fourniront davantage
de données et d’informations biomédicales qui,
elles-mêmes, pourront être reliées à la masse croissante des données génomiques. Cela ouvrira ainsi
de nouveaux champs pour optimiser le bien-être,
comprendre les maladies, et choisir les méthodes
de prévention et les interventions les mieux
adaptées à chaque patient.
d’outils numériques, couplés à l’analyse de données et à l’intelligence artificielle, renforcera sans doute la
précision et la vitesse des diagnostics, améliorera
la détection des maladies à un stade précoce et augmentera ainsi les chances d’obtenir un traitement
efficace ou de guérir. Bon nombre de ces outils
seront sans doute liés à la téléphonie mobile.
Grâce à des applications et à des capteurs, un
téléphone portable pourra réaliser des électrocardiogrammes et surveiller une arythmie dangereuse ; un logiciel et un microphone pourront y être
ajoutés pour « écouter » une toux et diagnostiquer
une éventuelle pneumonie. Afin d’améliorer le traitement de l’hypertension – un risque majeur de
mort prématurée –, des capteurs actuellement en
développement pourraient mesurer en continu la
pression artérielle. Et ce, sans brassard.
L’ É V E N TA I L D E P L U S E N P L U S L A R G E
CARDIOLOGIE
Un patch connecté
Plus petit qu’un timbre, ce patch a le rythme
dans la peau – le rythme cardiaque, s’entend.
Il mesure la pression artérielle en émettant
des ultrasons qui traversent la peau et sont
réfléchis par les tissus et le sang. Puis, il envoie
les données à un ordinateur portable. — E . C .
24
PHOTOS : KIM KYOUNG CHAE, UNIST (LENTILLE) ; JASON DORFMAN, MIT CSAIL (GÉLULE) ; CHONGHE WANG ET SHENG XU, UC À SAN DIEGO
SOINS POSTNATALS
THÉRAPIE MUSICALE
F R A G I L E S , L E S B É B É S P R É M AT U R É S P O U R R A I E N T M I E U X
S E P O RT E R G RÂC E À L A MU S I Q U E .
Dans la majeure partie du monde,
les naissances avant terme – à
37 semaines de gestation ou avant –
ont augmenté ces vingt dernières
années. Quitter trop tôt l’univers
nutritif et protecteur de l’utérus peut
entraîner des complications et
nécessite souvent un séjour dans une
unité de soins intensifs néonatals.
Aux Hôpitaux universitaires de
Genève (Suisse), la musique est
intégrée dans le parcours de soins de
certains prématurés. Mais, contrairement aux programmes musicaux
d’autres unités de néonatalogie,
ce projet novateur s’articule autour
de trois chansons précises, que les
nouveau-nés écoutent grâce à un
casque audio spécialement conçu
pour leur tête minuscule et fragile.
PHOTO : CRAIG CUTLER
Développé par la néonatologue
Petra Huppi, la chercheuse Manuela
Filippa et le compositeur Andreas
Vollenweider, l’étude vise notamment
à comprendre comment la musique
affecte le cerveau d’un prématuré.
Pendant que des bébés écoutent
les morceaux, leur cerveau est
scanné par IRM et les résultats sont
comparés à ceux de bébés non
exposés à la musique. Les chansons,
courtes, ont été composées pour
aider les prématurés à s’endormir,
se réveiller ou interagir.
Les premières données sont
encourageantes : l’IRM révèle une
meilleure connectivité cérébrale chez
les bébés exposés aux chansons, et un
meilleur rythme journalier de veille et
de sommeil. — C AT H E R I N E Z U C K E R M A N
25
U n l i v re c o m m e u n h y m n e à l a m e r
La mer dans ce qu’elle a de plus puissant.
Un espace indéfinissable, théâtre de l’existence
et de toutes les découvertes, de la création comme du chaos.
360 clichés grand format de Ben Thouard et 6 dépliants panoramiques :
un spectacle grandiose aux quatre coins de la planète
et au plus profond des abysses.
DISPONIBLE EN LIBRAIRIE
2 8 8 pa ges , 8 9 €
www.editions-prisma.com
DÉCOUVRIR
|
LA GRANDE IDÉE
NEUROLOGIE
Thérapie de choc pour le cerveau
L’utilisation de l’électricité comme moyen
thérapeutique a fait du chemin depuis le
premier pacemaker. Des électrodes implantées
dans le cerveau, visibles sur cette radiographie,
envoient des impulsions électriques, pour
ce qu’on appelle une stimulation cérébrale
profonde (SCP). Ces « pacemakers du cerveau »
ont donné de bons résultats, notamment
dans le traitement de troubles obsessionnels
compulsifs et de la maladie de Parkinson. Autre
espoir : une patiente de la Cleveland Clinic
(États-Unis), paralysée du côté gauche du corps
après une crise cardiaque en 2015, a réussi
à rejouer à la balle avec ses petits-enfants après
des mois de kinésithérapie, d’ergothérapie et
de SCP. — P AT R I C I A E D M O N D S
Le développement rapide de la recherche sur
le microbiote humain – c’est-à-dire les milliards de
bactéries sur et dans le corps de chaque individu –
fait apparaître des modes de diagnostic inédits et
progresser la science. Les analyses génétiques permettraient de décrypter les secrets du microbiote
intestinal, dont les déséquilibres sont soupçonnés
de jouer un rôle dans l’obésité, les maladies inflammatoires chroniques de l’intestin, ainsi que les maladies cardiovasculaires et même neurologiques.
Grâce à l’intelligence artificielle et à l’apprentissage automatique, des outils de diagnostic peuvent
être programmés pour lire des échantillons de
tissus et des radiographies. Des chercheurs chez
Google ont créé des algorithmes de recherche de
motifs à partir des scanographies rétiniennes de plus
de ��� ��� patients, et la technologie a « appris » à
repérer quels motifs prédisaient une hypertension
ou un risque accru de maladie cardiaque. Lors
d’essais comparatifs, les outils digitaux ont fourni
des analyses plus précises que des pathologistes,
des dermatologues ou des radiologues humains.
de plus en plus dispensés dans
un espace mélangeant le monde réel au monde virtuel. La majorité des interactions patient-médecin
ne nécessitent ni « imposition des mains » ni examen clinique. Des consultations privées en vidéoconférence entre un patient et un médecin auront
lieu par le biais de sites Internet. Des instruments
sans fil et connectés, comme des pèse-personnes
ou des brassards de tensiomètre, permettront de
mesurer les signes vitaux du patient et de les partager avec le médecin. Un dermatologue pratiquant
la télémédecine pourra utiliser un selfie que vous
lui aurez envoyé pour établir le prédiagnostic d’un
L E S SO I NS S ERON T
CANCÉROLOGIE
Un selfie
pour aider
au diagnostic
Une application pour
smartphone, en
développement à
l’université d’État de
Washington, permettrait
de diagnostiquer le
cancer du pancréas en
cherchant des signes de
jaunisse dans le blanc
des yeux. Prenez un selfie
et l’appli l’utilisera pour
vérifier votre taux de
bilirubine. S’il est élevé,
c’est un signe possible
de la maladie. — L . C .
PHOTOS : CENTRE MÉDICAL WEXNER DE L’UNIVERSITÉ D’ÉTAT DE L’OHIO (RADIOGRAPHIE) ; REBECCA HALE, ÉQUIPE DU NGM
DÉCOUVRIR
|
LA GRANDE IDÉE
PROTHÈSES
DES MEMBRES
IMPRIMÉS EN 3D
C H AQ U E A N N É E , D E S M I L L I E R S
DE GENS PERDENT UN MEMBRE
CORPOREL . UNE SOLUTION PEU
O N É R E U S E S E M E T E N P L AC E .
Les membres artificiels sont souvent
créés à partir d’un moulage en plâtre.
Transformer ce moulage en une
emboîture bien adaptée au moignon
est une opération aussi coûteuse
que laborieuse.
Dans le monde, nombreux sont
les amputés qui ne peuvent pas
bénéficier de prothèses. La
téléphonie mobile et l’impression en
3D pourraient apporter une solution,
selon Albert Yu-Min Lin, un
« Explorateur National Geographic »
ayant perdu une partie de sa jambe
en 2016. Les appareils photo
des téléphones pourraient scanner
les membres résiduels et fournir
les mesures à des professionnels
équipés d’imprimantes en 3D, qui
produiraient des emboîtures sur
mesure, à bas coût et expédiables
partout. — C H R I S T I N A N U N E Z
Albert Lin en Arizona,
à Antelope Canyon.
28
N AT I O N A L G E O G R A P H I C
PHOTO : BRUNA BORTOLATO
DEMAIN, LES ORDONNANCES
POURRAIENT ÊTRE
DÉLIVRÉES PAR UN ROBOT
CONTRÔLÉ À DISTANCE PAR
UN FOURNISSEUR OU UN
ALGORITHME QUI VÉRIFIERA
LA POSOLOGIE.
grain de beauté d’aspect suspect et vous dire si vous
pouvez être rassuré ou s’il est préférable de vous
déplacer pour venir consulter.
À l’avenir, vos ordonnances pourraient comporter plus de « digicaments ». Déjà utilisés à petite
échelle, ils sont conçus pour améliorer le bien-être
ou gérer un problème de santé sans médicament
ni soin direct – simplement en recourant à un logiciel ou à des échanges numériques avec un praticien
qui fournit renseignements et encouragements.
Bien que la majorité d’entre eux soient encore à
l’étude, des digicaments ont prouvé leur efficacité.
Exemples : au moins deux entreprises ont développé des applications pour réduire le bruit entêtant des acouphènes en exerçant le cerveau à
diminuer leur intensité – et, à en croire certains
patients, cela marche. Pour gérer les défaillances
du cœur, la Mayo Clinic (États-Unis) a prescrit à des
patients une application qui suit leur pression artérielle, leur activité physique et d’autres facteurs.
Résultat : une baisse de �� � des réadmissions
à l’hôpital pour problèmes cardiaques.
Demain, les ordonnances ordinaires pourraient
être délivrées par un robot comparable à un distributeur de billets, contrôlé à distance par un fournisseur ou un algorithme qui vérifiera la posologie.
Un médecin pourrait également consulter vos tests
d’ADN pour déterminer les médicaments les plus
adaptés à votre profil génétique.
Il y a quelques mois, des scientifiques de Harvard
et du MIT ont trouvé une méthode destinée à prédire plus précisément le risque pour un individu
de développer cinq maladies mortelles. Pour cela,
ils ont étudié les modifications de l’ADN en �,� millions de points du génome humain et utilisé un
algorithme sophistiqué. Mais même les tests génétiques qui analysent seulement certaines parties
du génome – comme le test que j’ai fait – peuvent
fournir des informations précieuses sur la prédisposition à la démence, à la maladie de Parkinson,
au diabète et à d’autres problèmes de santé. Encore
une fois, les progrès des technologies médicales
pourraient être bénéfiques à Harriett et à moi.
Si vous ne pouvez pas rencontrer vos médecins
en personne, des robots pourraient-ils faire aussi
bien qu’eux ? Ces derniers pourraient bientôt trier
les appels et donner des renseignements. Un infirmier « chatbot » tentera de comprendre ce qui vous
arrive en vous interrogeant sur vos symptômes et
IMAGE CONFOCALE TRICOLORE : JAMES HAYDEN, INSTITUT WISTAR
TECHNOLOGIE
La réalité virtuelle au service
des praticiens et des patients
La réalité augmentée (RA) et la réalité virtuelle
(RV) passent de l’univers du jeu vidéo à l’univers
médical. Des étudiants en médecine ou en soins
infirmiers apprennent l’anatomie et la physiologie
en explorant les organes humains en RV. Des
interventions, disponibles en RV sur Internet,
permettent aux étudiants d’observer à distance
les gestes du chirurgien, en adoptant son point
de vue. La thérapie par RV met à profit les
expériences immersives pour mieux traiter
douleurs et phobies. La RA peut superposer des
données d’imagerie à des interventions réelles,
pour qu’un chirurgien visualise l’intérieur d’un
corps ou soit guidé à distance. — D . K .
GÉNÉTIQUE
Dépister le cancer
de la prostate
Si les cancers de la prostate à haut
risque peuvent être mortels, ceux
à faible risque ne nécessitent parfois
qu’une simple surveillance. Mais tous
pourraient bénéficier de récentes
découvertes de la Cleveland Clinic.
Une équipe de scientifiques y a
constaté que les patients ayant une
anomalie génétique en lien avec
la testostérone réagissaient différemment à certains médicaments – ce
qui ouvrirait la voie à des traitements
personnalisés. D’autres chercheurs
ont développé un nouveau test
sanguin, qui prédit le risque de
cancer de la prostate avec plus de
fiabilité que les tests existants. — P. E .
Les cellules cancéreuses
de la prostate apparaissent
en fluorescence.
29
DÉCOUVRIR
|
LA GRANDE IDÉE
INTELLIGENCE ARTIFICIELLE
en cherchant des informations dans vos dispositifs
médicaux connectés et dans les dossiers médicaux
de gens comme vous, établis en production participative. Si votre demande est plus d’ordre psychologique que physique, vous pourrez demander de
l’aide à un thérapeute virtuel programmé pour discuter comme un humain, proposer des solutions
de développement personnel et vous prêter une
oreille compatissante.
Les robots pourraient aussi participer aux soins
lors de rendez-vous médicaux en face à face. Imaginez un phlébotomiste robotisé, apte à confirmer
par ultrasons quelle veine il vaut mieux piquer, puis
capable de réaliser la prise de sang ou de poser une
perfusion. Dans les pays souffrant d’une pénurie
de personnel soignant, certains robots pourraient
servir à soulever et à déplacer les patients, et à interagir socialement avec eux. D’autres, programmés
pour faire office de coach et d’assistant kinésithérapeute, pourraient aider les patients à suivre assidûment leur programme d’exercices.
de ces progrès,
il est tout aussi important de les partager. Selon des
estimations, en ����, dans les pays à revenu faible
ou intermédiaire, �,� millions de personnes
seraient mortes, faute d’accès aux soins. Et � autres
millions auraient péri à cause de soins de mauvaise
qualité. Nous pouvons changer cela, en partageant
ces nouvelles technologies médicales et d’autres,
liées à la santé et au bien-être. Dès aujourd’hui. c
Mieux identifier les cancers
Bien identifier des cellules cancéreuses sur un
échantillon de tissu pulmonaire (ci-dessous,
à gauche) est essentiel pour la réussite du
traitement. Et c’est ce en quoi pourrait exceller
l’intelligence artificielle (IA). Dans une étude,
la même technologie que Google utilise pour
identifier des objets en ligne a été configurée
pour reconnaître des formes de cancer. En
quelques secondes, elle en a trouvé deux dans
un échantillon de tissu (ci-dessous, à droite),
de manière aussi précise qu’un humain. — L . C .
Pour l’échantillon de gauche, l’IA a
analysé, à droite, les tissus pulmonaires
sains (en gris) et deux formes de cancer
(en rouge et en bleu).
S ’ I L E S T F O R M I DA B L E D E B É N É F I C I E R
Formé à Stanford et à Harvard, Daniel Kraft est médecin, chercheur
et président de la faculté de médecine à l’université Singularity.
KINÉSITHÉRAPIE
Soutien robotisé
Pour pallier les problèmes graves de
motricité, telle une paralysie partielle,
les scientifiques travaillent sur des
dispositifs robotisés qui enveloppent
et soutiennent le corps à la manière
des exosquelettes, et améliorent
ainsi la posture et la force physique
des patients. — N ATA S H A D A LY
GENOME CANCER ATLAS (IMAGE DES TISSUS) ; NICHOLAS COUDRAY, ÉCOLE DE MÉDECINE DE L’UNIVERSITÉ DE NEW YORK (CARTE THERMIQUE) ; MARCEL VAN DEN BERGH
D É C O U V R I R
|
L’ I N F O G R A P H I E
LES EFFETS
DES DÉPENSES
DE SANTÉ
ESPÉRANCE DE VIE
1980
1980
(en moyenne à la naissance)
de la chirurgie de pointe aux
traitements contre le sida, ont fortement amélioré les résultats
en matière de santé depuis les années 1980. Dans les pays riches,
les dépenses de santé ont augmenté et on vit plus longtemps.
Mais, aux États-Unis, l’explosion des coûts s’accompagne d’une
hausse plus faible de l’espérance de vie. L’accès inégal aux soins
et une prévention déficiente dont sont victimes de nombreux
habitants pourraient en partie expliquer cette différence.
L E S I N N OVAT I O N S M É D I C A L E S ,
P A R A L B E R T O L U C A S L Ó P E Z E T R YA N T. W I L L I A M S
DÉPENSES DE SANTÉ
2015
ESPÉRANCE DE VIE
2015
(en moyenne à la naissance)
(par personne et par an, en dollars)
84
En 35 ans,
les autres pays ont
plafonné les tarifs
médicaux et les
dépenses de santé
pour garantir un
large accès aux soins
de la population.
Les États-Unis n’y ont
pas imposé de limite.
En 1980,
l’espérance
de vie et les
dépenses
de santé
aux États-Unis
étaient
comparables
à celles des
autres pays
développés.
9 000 $
83
82
8 000
81
7 000
79
6 000
ÉT
AT
S-
UN
IS
80
78
78
5 000
En 2015,
77
76
4 000 $
4 000
3 000
3 000
2 000
2 000
1 000
1 000
75
74
73
les États-Unis
affichent les plus
fortes dépenses
de santé par
habitant mais
l’espérance de
vie la plus faible
parmi les pays
développés – en
partie à cause
d’une mauvaise
prévention pour
les plus pauvres.
72
71
0$
0$
Pays sans couverture de
santé universelle
Pays avec une couverture
de santé universelle privée
ou publique.
* INCLUT SEULEMENT LES PAYS DE L’OCDE POUR LESQUELS DES DONNÉES SONT DISPONIBLES. L’OCDE RÉUNIT 36 DES PAYS LES PLUS DÉVELOPPÉS ET LES PLUS RICHES DU MONDE.
SOURCES : ESTEBAN ORTIZ-OSPINA, OURWORLDINDATA.ORG, UNIVERSITÉ D’OXFORD ; DIVISION DE LA POPULATION DE L’ONU ; OCDE.STAT
E X P L O R E R
L E S MYST È R E S E T L E S M E RV E I L L E S D U Q U OT I D I E N
N AT I O N A L G E O G R A P H I C
|
L ’A U T R E C Ô T É D U M I R O I R
Le photographe médecin
J
P A R M A X AG U I L E R A - H E L LW E G
I L AVA I T C H O I S I D E S A U V E R
DES VIES AU LIEU
D E T É M O I G N E R À T R AV E R S
SES PHOTOS. UN COUP
DE TÉLÉPHONE INOPINÉ
L’A F A I T C H A N G E R D E V O I E .
32
N AT I O N A L G E O G R A P H I C
sur mon portable
lors de mes études de médecine. Mes amis savaient
que composer mon numéro ne servait à rien. J’étais
interne, travaillais parfois près de ��� heures par
semaine et m’occupais de près de �� patients en
même temps. Même ma mère a arrêté d’appeler.
J’utilisais mon téléphone pour consulter des applis
médicales : celle précisant quel antibiotique prescrire pour quel agent infectieux, celle qui aidait à
choisir les traitements, celle enregistrant les résultats de labo à ne pas oublier.
Et puis, un jour, mon portable a sonné. J’étais en
pleine tournée des patients. Je suis sorti dans le
couloir. Le numéro m’était inconnu, mais l’indicatif régional était celui de Washington. Je me suis
dit que ça devait être important.
« Salut, Max, m’a lancé une voix, c’est Todd. »
Todd James est responsable photo à National
Geographic. Nous ne nous étions pas parlés depuis
dix ans, quand j’avais quitté la photographie pour
la médecine. « J’ai un boulot pour toi », a-t-il dit.
C’était un reportage concernant la recherche sur
les cellules souches. Todd voulait m’expédier aux
quatre coins du globe. Mon cerveau s’est mis à
frétiller – ouais, c’était ça, la vraie vie : sur la route,
avec mon appareil photo et l’exploration pour toute
mission. J’avais arrêté la photo après vingt ans et
avoir réalisé que je ne voulais plus être un simple
voyeur, mais vivre moi-même l’expérience.
Ce déclic, je l’avais eu lors d’un reportage sur une
neurochirurgienne. Elle pratiquait une opération
de la moelle épinière. Le patient était redressé, son
crâne maintenu dans une sorte d’étau, sa colonne
vertébrale étirée, permettant à la chirurgienne
d’opérer debout et à hauteur d’yeux, avec un accès
’A I C E S S É D E R E C E VO I R D E S A P P E L S
JANVIER 2019
33
parfaitement dégagé. À un moment, elle m’avait
dit : « Là, photographiez ça » – en l’occurrence, une
moelle épinière blanche et dénudée.
J’avais réalisé que cette chose n’avait jamais vu
l’éclat du jour. Pourtant, en cet instant, elle était en
pleine lumière. Je l’avais su aussitôt : voilà ce que
je voulais faire pour le restant de mes jours. J’avais
alors demandé à tous les magazines pour lesquels
j’avais travaillé de me confier tous les reportages
sur la médecine et les médecins.
« Je sais pas trop, ai-je répondu à Todd. J’ai des
patients à voir tout de suite. Je te rappelle. » J’étais
en plein dilemme. Cette première passion que j’avais
écoutée pendant tant d’années était toujours là.
L’envie de voir le monde. Décider de la couleur, de
la lumière, de ce qu’on laisse dans le cadre ou non,
de la façon de raconter une histoire. La joie intense
de regarder à travers l’objectif. Dans l’après-midi,
j’ai croisé le directeur adjoint de mon programme
d’internat. Il m’a rappelé que mon prochain mois de
stage pouvait être consacré à la recherche. « Ce reportage, me suis-je dit, c’est de la recherche, non ? »
J’ai rappelé Todd. Selon lui, je pouvais boucler
le reportage en �� jours et �� séances photos dans
�� pays. La première d’entre elles se passerait dans
mon hôpital du Massachusetts, où se déroulait un
essai clinique utilisant les cellules souches pour
traiter le lupus. Puis je partirai pour l’Europe.
À Berlin, je suis allé dans l’ancien laboratoire de
Rudolf Virchow, qui, au ���e siècle, prouva que
toute cellule était issue de la division d’une cellule
préexistante. Je voulais un cliché illustrant le pouvoir d’une cellule souche pluripotente. En assemblant des spécimens pathologiques, j’ai composé
un être humain abstrait : des cheveux de la tête d’un
bébé mort-né, un cerveau, un cœur hypertrophié,
un foie, des os et des dents – tous ces fragments de
nous qui pourraient venir d’une seule cellule souche.
J’avais oublié comment mesurer la luminosité
au posemètre, mais le reste est revenu tout de suite.
J’avais vingt ans d’expérience, et tant de choses
avaient capoté dans tellement de situations et avec
tant de gens que je savais gérer. Peu après, j’ai
entamé mon premier stage dans une unité de soins
intensifs. J’étais conscient qu’il me faudrait encore
vingt ans pour acquérir la maîtrise requise – et que
je voulais obtenir – pour devenir un bon médecin.
Un an plus tard, j’étais interne avec des étudiants
de première année à former. Je me suis demandé
quelle spécialité choisir. Et là, j’ai su : je voulais
refaire de la photo, tourner des films, raconter des
histoires comme si c’était la chose la plus importante du monde. J’ai quitté la médecine, mais avec
un savoir scientifique durement gagné et l’expérience d’avoir soigné des malades – une sorte de
doctorat ès-condition humaine. J’avais reçu un
appel et devais y répondre. L’appel de la création.
Photographe et cinéaste, Max Aguilera-Hellweg se focalise sur
des sujets scientifiques et médicaux. Il a réalisé les clichés de
« Pourquoi nous sommes accros » (numéro de septembre 2017).
34
N AT I O N A L G E O G R A P H I C
E X P L O R E R
|
L’ I N T E RV I E W
SUIVEZ VOTRE
L E D R M I C H A E L R O I Z E N est responsable en chef du bien-être à la
Cleveland Clinic. L E D R M I C H A E L
C R U PA I N est consultant médical en
chef pour une émission de télévision
américaine The Dr. Oz Show. Tous
deux font depuis longtemps le lien
entre une meilleure alimentation
et une meilleure santé. Selon eux,
les données scientifiques confirment
que « le moment où l’on mange est
aussi essentiel que ce que l’on mange
pour le maintien d’un poids adapté,
la prévention et la guérison de certaines maladies, et pour une vie
longue, pleine d’énergie et de bonheur. » Ils ont bien voulu répondre
à nos questions.
Quels faits scientifiques fondent
votre approche de l’alimentation ?
Nous avons tous entendu parler de
l’horloge biologique – le rythme circadien, qui envoie des signaux
chimiques à certains moments pour
nous aider à nous réveiller, à dormir
ou à faire d’autres activités. Eh bien,
nous avons aussi une horloge alimentaire, avec une fonction similaire :
synchroniser notre alimentation avec
les réactions chimiques du corps.
Selon cette horloge, l’idéal est
d’avoir des apports énergétiques plus
gros en début de journée, et plus
faibles ensuite. Mais notre corps
demande l’inverse – plus de calories
le soir, et moins le matin. C’est un
héritage de l’époque où l’approvisionnement en nourriture des humains
était aléatoire et où il valait mieux
stocker l’énergie. Aujourd’hui, notre
planning alimentaire a des effets
négatifs sur notre santé. Des études
chez l’animal et l’humain l’ont lié au
vieillissement prématuré, aux maladies chroniques et à la prise de poids.
Nous devons donc surmonter la
répartition des prises alimentaires
née de cette pulsion et la modifier
– plus en début de journée, moins à la
fin –, afin d’aligner nos habitudes sur
notre horloge interne.
Manger certains
aliments aide le corps
à mieux gérer certaines
situations précises.
HORLOGE ALIMENTAIRE
S I VO U S Ê T E S E N C O L È R E
Mangez des pois chiches
grillés. Ils apportent des
protéines et des fibres de
bonne qualité. Leur texture
croustillante et un goût
délicieux plairont aux
personnes à cran et affamées.
S I VO U S A L L E Z À U N
P R E M I E R R E N D E Z �VO U S
Vous pouvez calmer votre
stress en mangeant juste
avant des aliments qui vont
augmenter lentement le
niveau d’énergie : avocat, noix
(bons acides gras) et blanc de
dinde en tranches (bonnes
protéines) sur un toast de pain
complet (glucides complexes).
FPO
S I VO U S Ê T E S M A L A D E
Mamie avait raison : la soupe
de poulet fait du bien, pour
plusieurs raisons. Elle améliore
la viscosité du mucus et
contient des ingrédients aux
propriétés anti-inflammatoires.
WILL SHOOT
IN STUDIO
S I VO U S AV E Z
UN ENTRETIEN
D ’ E M B AU C H E
Au petit déjeuner, saupoudrez
des graines de lin broyées
sur des flocons d’avoine.
Cette source de lipides et
de vitamines de bonne
qualité aide à améliorer
la concentration et les
fonctions du cortex cérébral.
Le café contribue à affûter
les capacités d’attention et
de résolution des problèmes.
Buvez-en une ou deux
tasses (pas plus) trois quarts
d’heure avant l’entretien.
S I VO U S VO U L E Z
PROTÉGER
VO T R E C E RV E AU
Quels sont les principes fondamentaux de ce mode d’alimentation ?
Quelques ajustements de nos habitudes alimentaires aideront à synchroniser notre système interne.
Voici les plus importants :
�) Idéalement, ne manger qu’aux
heures où il fait jour, soit une fenêtre
d’environ douze heures ou, mieux
encore, de moins de douze heures.
Cela signifie d’arrêter les raids nocturnes sur le frigo.
�) Manger plus le matin et à midi, et
moins à mesure que les heures
passent. Notre corps fonctionnera
PHOTO : MARK THIESSEN
mieux – et sera en meilleure santé – si
nous faisons le plein de calories par
anticipation, au lieu de les consommer plus tard dans la journée.
Quels bénéfices peut-on en retirer ?
Ce mode d’alimentation vous aidera
à éviter, atténuer, voire éliminer des
maladies. En suivant ces lignes directrices, on peut améliorer sa qualité
de vie : meilleur sommeil, davantage
d’énergie et, tout simplement, meilleure santé générale.
Le saumon contient de bons
acides gras, qui ont prouvé
leur action positive pour
protéger le cerveau contre les
problèmes liés à la mémoire.
L’un des plats préférés de
Michael Roizen est le burger
au saumon au petit déjeuner.
S I VO U S AV E Z S O U V E N T
MAL À LA TÊTE
Mangez des épinards. Ils
contiennent des vitamines B
et d’autres nutriments qui
aider à réduire l’incidence
des migraines.
S I VO T R E FA M I L L E E S T
S UJ E T T E AU C A N C E R
Mangez beaucoup de
légumes, surtout les crucifères
(chou-fleur, chou, etc.), riches
en nutriments anticancer.
CETTE INTERVIEW A ÉTÉ ÉDITÉE POUR PLUS DE CLARTÉ
ET DE CONCISION.
JANVIER 2019
35
E X P L O R E R
|
LES MISSIONS SUR LE TERRAIN
LE BIOLOGISTE PANAMÉEN
QUI PISTE LES FÉLINS
Chaque mois, découvrez
le quotidien d’un
chercheur, d’un aventurier
ou d’un photographe
dont le projet est soutenu
par National Geographic.
P A R C O R I N N E S O U L AY
Ricardo Moreno
(à gauche) pose un
collier GPS sur un ocelot,
dans le parc national de
la Soberanía, au Panama.
SA PA S S I O N P O U R L E S F É L I N S , Ricardo Moreno,
�� ans, la doit à une enfance passée à regarder
des documentaires de National Geographic
et à suivre son chat. « Je suis fasciné par la
majesté, la ruse et la patience des félins, en
particulier des jaguars », confie le biologiste
panaméen, nommé « Explorateur émergent
National Geographic » en ����.
Depuis ����, il étudie leur répartition et
leurs déplacements dans son pays. « J’installe des pièges photographiques et je pose
des colliers GPS afin de récolter le maximum
d’informations », détaille celui qui est aussi
président de la fondation Yaguará Panamá.
Ses journées sont longues : lever à � h ��,
puis entre huit et dix heures à escalader des
reliefs abrupts. « Nous observons des jaguars,
des ocelots, des pumas, ainsi que des proies
telles que les porcs des montagnes. Il m’arrive
de faire face à une centaine de ces bêtes et
36 N A T I O N A L G E O G R A P H I C
de devoir grimper aux arbres ! Parmi les
risques, il y a aussi les trafiquants de drogue
qui sillonnent les forêts, armés. »
Une des missions de Yaguará Panamá est
de favoriser la coexistence entre hommes
et félins. « Au Panama, au moins ��� jaguars
ont été tués par la population entre ���� et
����, déplore le biologiste. Mais, sans ce prédateur, le nombre d’herbivores augmenterait : ils mangeraient les graines d’arbres et
la végétation aurait du mal à se régénérer. »
Les travaux de Ricardo Moreno servent
aussi à éclairer les politiciens. « Nos données permettront aux autorités de prendre
des décisions pour rétablir la continuité du
corridor biologique forestier, précise-t-il.
Les jaguars ne peuvent pas traverser certaines zones, où les routes et les villages se
développent. Or, le Panama est un pont
entre le nord et le sud de l’Amérique. »
PHOTO : RICARDO MORENO, NATIONAL GEOGRAPHIC IMAGE COLLECTION
E X P L O R E R
|
LES BÊTES DE SEXE
IL L’AIME MÛRE,
ELLE N’EN FAIT
Q’UNE BOUCHÉE
A U M O M E N T D E S ’A C C O U P L E R , pourquoi le
mâle de l’araignée Latrodectus geometricus ne
choisit-il pas de jeunes femelles ? Après tout,
elles sont plus fécondes que leurs aînées ;
n’exigent pas de parade nuptiale longue et élaborée ; et, surtout, ne concluent pas leurs ébats
en dévorant leur partenaire, contrairement à leurs
consœurs plus âgées – ce qui a donné à cette
espèce le nom vernaculaire de « veuve brune ».
Prenant en considération ces atouts évidents,
une équipe scientifique basée en Israël s’attendait à ce que les mâles aillent vers les partenaires
les plus jeunes. Elle a organisé des orgies d’araignées, en proposant à ces messieurs des compagnes de tous les âges. Les conclusions ont été
publiées dans la revue Animal Behaviour.
Pour copuler avec une femelle plus âgée,
un mâle L. geometricus est capable d’affronter
de nombreux rivaux ou d’exécuter un rituel de
séduction pouvant durer jusqu’à six heures.
Au moment fatidique, il insère l’un de ses deux
organes sexuels dans l’un des deux orifices de
sa partenaire tandis que celle-ci entreprend
de le dévorer vivant. Si le mâle en réchappe et
s’il n’est pas trop mutilé, il peut tenter de
s’accoupler à nouveau avec la femelle.
Au cours de l’étude, quand les mâles pouvaient copuler avec des femelles de tous âges,
ils s’accouplaient avec moins de la moitié des
plus jeunes, mais avec ��� � des plus âgées.
Aucun des mâles ayant opté pour la jeunesse n’a
été victime d’un cannibalisme fatal, alors que
cela a été le cas pour plus de la moitié des autres.
Pour Shevy Waner, coauteur de l’étude, cette
attirance suicidaire est incompréhensible. Une
piste, toutefois : les femelles âgées pourraient
émettre des phéromones sexuelles plus puissantes, compensant par la chimie ce qui leur
manque en fécondité et en jeunesse.
Cette veuve brune a été
photographiée à
l’Audubon Nature Institute
(La Nouvelle-Orléans, Louisiane).
— PAT R I C I A E D M O N D S E T K AT I E WAT K I N S
PHOTO : JOEL SARTORE
JANVIER 2019
37
INSPIRER - EXPLORER - PARTAGER
HORS-SÉRIE NATIONAL GEOGRAPHIC TRAVELER
HORS�SÉRIE
DÉCEMBRE 2018 - JANVIER 2019
TRAVELER
100 AVENTURES INOUBLIABLES
100
aventures
inoubliables
Sortir des sentiers battus
Retrouver son corps
Explorer son âme
Agir avec son cœur
Un saut à deux dans
le lac artificiel de
Blue Mesa, dans l’État
du Colorado.
ACTUELLEMENT EN KIOSQUE
3+272ȗ67()$12817(57+,1(5
N AT I O N A L G E O G R A P H I C
JANVIER 2019
Médecine personnalisée................. p. 40
Médecine chinoise........................... p. 64
Londres.............................................. p. 92
Pumas de Patagonie........................ p. 120
E N Q U Ê T E S E T R E P O RTAG E S
92
PHOTO : LUCA LOCATELLI
� LONDRES PEUT�ELLE RELEVER
SES DÉFIS TOUT EN RESTANT UN
CENTRE FINANCIER MAJEUR ET
UN LIEU AT TRAYANT OÙ VIVRE ? �
SCIENCE
la médecine
personnalisée
s’apprête à révolutionner les soins.
Elle surveillera notre santé en temps
réel, prédira les risques de cancer,
de maladies cardio-vasculaires
et d’autres affections. Et elle concevra
des suivis individualisés.
CHAQUE
PATIENT
EST UNIQUE
PA R F RA N S M I T H
PHOTOGRAPHIES DE CRAIG CUTLER
PA G E P R É C É D E N T E
ORGANES
MINIATURES
À l’hôpital Cedars-Sinai
(Los Angeles), des
chercheurs ont recréé
de la moelle épinière
d’un malade souffrant
d’une sclérose latérale
amyotrophique (SLA)
sur une puce organique.
Les neurones moteurs
(en blanc) et un vaisseau
sanguin (en rouge) issus
de cellules souches du
patient forment un tissu
vivant (image agrandie,
à l’arrière-plan). Avec
un microscope, les
chercheurs observent
le travail des neurones
en temps réel. Leur
objectif : concevoir
des puces capables de
prévoir les effets de
différents médicaments
sur chaque patient.
IMAGE COMPOSITE : CRAIG CUTLER
(MAIN ET PUCE) ; SAMUEL SANCES,
CEDARS-SINAI (ARRIÈRE-PLAN)
CI� CONTRE
LA VOIX DE MAMAN
Cristina Iossa chante
pour Alessandro, son fils
prématuré, à l’unité de
soins intensifs néonatals
de l’hôpital universitaire
de Modène (Italie).
Dans ce type d’unités,
les parents sont plus
présents, de nos jours.
« La voix d’une mère qui
parle à son nouveau-né
constitue l’une des
médecines personnalisées les plus primitives,
car c’est à lui qu’elle
s’adresse, et à personne
d’autre », selon Manuela
Filippa, chercheuse
aux universités du Val
d’Aoste et de Genève.
Percevoir la voix de la
mère aide le cerveau
du nouveau-né à se
développer au mieux
pour bien interpréter
les sons et comprendre
le langage, estiment
les chercheurs.
E
LLE AVAIT VAINCU un cancer du sein
au stade � grâce à une chimiothérapie massive et à une double
mastectomie. Douze années plus
tard, Teresa McKeown a connu une
terrible récidive. Et, cette fois, la
chimiothérapie a échoué. Jour
après jour, assise dans son salon,
trop malade pour bouger, Teresa a
tenu quatre journaux intimes – l’un pour son mari, les autres pour ses
trois grands enfants. Elle rassemblait son énergie pour consigner
ses pensées concernant un avenir qu’elle ne serait plus là pour voir.
Les tumeurs intestinales lui rendaient l’absorption de nourriture
quasi impossible. Teresa McKeown dépérit jusqu’à peser moins de
�� kg. Elle devait être opérée pour ôter les tumeurs. Elle se souvient
avoir confié à sa fille aînée : « Si les choses tournent mal ou si une complication survient après l’opération, je prie pour avoir une fin rapide.
J’ignore combien de temps je pourrai supporter encore de souffrir. »
Désespérée mais déterminée, elle demanda à son chirurgien, Jason
Sicklick, s’il connaissait un traitement expérimental susceptible de
prolonger sa vie. Or Sicklick était le coresponsable d’un protocole expérimental à la pointe de ce qu’on appelle la médecine personnalisée
– ou médecine de précision.
Cette approche recourt aux dernières avancées de la génétique et de
l’analyse des données. Elle ouvre de nouvelles possibilités de traitement du cancer et pourrait bouleverser la pratique habituelle de la
médecine. Plutôt que de classer les patients par catégories générales
de maladies, la médecine personnalisée tente d’adapter la prévention,
le diagnostic et le traitement selon le profil biochimique de chacun.
Teresa McKeown décida de participer à I-PREDICT, un projet d’oncologie personnalisée mené au Moores Cancer Center, à San Diego.
Au lieu de privilégier une thérapie donnée, les chercheurs y analysent
l’ADN des cellules cancéreuses de chaque patient. Grâce à des algorithmes spécifiques, un ordinateur balaie les données de milliers de
variations génétiques, de centaines d’anticancéreux et de millions
d’associations de médicaments. Il s’agit de trouver le traitement le plus
à même de cibler les tumeurs cancéreuses spécifiques du patient. Le
traitement peut recourir à une nouvelle immunothérapie, à une
chimiothérapie des plus traditionnelles, à l’hormonothérapie, voire à
des médicaments qui n’étaient pas conçus pour soigner le cancer.
« C’est un principe très simple, précise Razelle Kurzrock, directrice
du département d’oncologie personnalisée du Moores Cancer Center.
Pour chaque patient, vous choisissez les médicaments en fonction du
seul profil de ses tumeurs. Nous ne travaillons pas sur une partie de
l’organisme du patient ni en fonction de ce que l’on sait d’un type de
cancer dont souffrent une centaine d’autres malades. Le traitement
ne concerne que le patient qui se tient en face de moi. »
Les tumeurs de McKeown étaient truffées de mutations variées.
« C’est le genre de patients face auxquels nous ne pouvions qu’avouer
notre impuissance », reconnaît Kurzrock. Mais ces patients sont aussi
les meilleurs candidats pour tester l’efficacité d’une nouvelle classe de
produits immunothérapeutiques, les inhibiteurs de points de contrôle
immunitaires (ICI). Ces médicaments empêchent
(suite page 49)
44
N AT I O N A L G E O G R A P H I C
CAPTEURS
PORTABLES
Des dispositifs sans fil
miniaturisés remplacent
les encombrants appareils de monitorage.
Une surveillance plus
étendue des patients
et des interventions
plus précoces
pourraient sauver des
vies et économiser des
milliards. À l’université
Northwestern, des
ingénieurs ont inventé
des dispositifs adhésifs,
tel ce capteur flexible
(dans la main droite
du sujet), qui remplit
toutes les fonctions
d’un moniteur d’hôpital
– et bien d’autres.
SOURCE : JOHN A. ROGERS, GROUPE
DE RECHERCHE DU CENTRE SIMPSON
ET QUERREY D’ÉLECTRONIQUE
BIO-INTÉGRÉE À L’UNIVERSITÉ
NORTHWESTERN
PA G E S U I VA N T E
La Biobank britannique
stocke des échantillons
de sang, d’urine et
de salive de plus de
500 000 personnes
dans des bacs à - 80 °C.
Un robot récupère les
spécimens que des
scientifiques utilisent
pour découvrir des
liens entre les variants
génétiques et un type
de maladie.
AMRA MEDICAL AB (IRM)
GRAISSE : C’EST LA
PLACE QUI COMPTE
RÉ PART IT ION D E LA
M A S S E G RA IS S EU S E
Viscères
Plus
L’indice de masse corporelle (IMC) mesure l’obésité
et les risques pour la santé. Mais il n’explique pas,
par exemple, pourquoi une personne en surpoids peut
être en bonne santé. Les données obtenues par IRM
montrent que le plus important est l’endroit du corps
où la masse graisseuse s’accumule.
Poids
normal
Foie
Muscles
La graisse sous-cutanée peut être moins nocive que
la viscérale, qui entoure les organes. Les graisses
des viscères, des muscles et du foie (lignes orange,
ci-dessous) sont liées aux troubles métaboliques.
Sous-cutanée
Viscérale
Quatre
femmes avec
un IMC
de 24. Leur
graisse
est répartie
de façon
différente.
Probabilités de :
Moins
Individu
moyen en
bonne santé
Mauvaise santé
Maladies du cœur
Fortes
Bonne santé
Faibles
Diabète de type 2
Troubles métaboliques
Mauvaise santé
Bonne santé
Obésité
Quatre
femmes avec
un IMC
de 32.
Leur graisse
est répartie
de façon
différente.
KURT MUTCHLER ET JASON TREAT, ÉQUIPE DU NGM ; KELSEY NOWAKOWSKI
SOURCES : BIOBANK, R-U ; JENNIFER LINGE, AMRA MEDICAL AB
(suite de la page 44)
les protéines tumorales
de se fixer sur les cellules immunitaires et de les
bloquer. Le patient peut ainsi combattre à nouveau son cancer. Et plus il y a de mutations, plus
les cibles que les cellules immunitaires doivent
attaquer et éradiquer sont nombreuses.
Le programme I-PREDICT a désigné pour
McKeown le nivolumab, un ICI d’habitude utilisé contre les mélanomes graves, les cancers du
rein et certains cancers des poumons, mais pas
contre le cancer du sein. Après deux injections,
les marqueurs tumoraux de son sang avaient
diminué de plus de �� �. Quatre mois et quelques
injections additionnelles plus tard, les tests ne
montraient plus aucun signe de cancer.
Par une chaude journée d’été, un an et demi
après le début de l’expérience, Teresa McKeown,
�� ans, me fait visiter son jardin, à Valley Center,
en Californie. « J’adore cette façon de chercher
l’origine de la mutation et de trouver le moyen
de la cibler, dit-elle. C’est si différent de la
chimio, qui vous perturbe à tous les niveaux. »
L
A M É D E C I N E P E R S O N N A L I S É E bat en
brèche l’approche de la médecine
conventionnelle. Celle-ci, d’ordinaire,
propose des prescriptions et des traitements en
général plus efficaces que nuisibles, mais qui
peuvent fort bien ne pas vous convenir. La médecine personnalisée admet que chacun possède
un profil moléculaire différent, et que ce profil
a un impact considérable sur notre santé.
Des chercheurs du monde entier créent des
instruments d’une précision inconcevable voilà
à peine une décennie : séquençage super-rapide
de l’ADN, génie tissulaire, reprogrammation cellulaire, manipulation génétique, entre autres.
Bientôt, la science et la technique prédiront pour
chacun les risques de cancer, de maladies cardiovasculaires et d’innombrables autres maux, des
années avant leur survenue. Ces recherches
ouvrent aussi des perspectives (séduisantes ou
inquiétantes, selon le point de vue) d’éliminer
les maladies héréditaires grâce à la modification
des gènes au sein des embryons.
Pour l’heure, la recherche ouvre la voie à des
thérapies personnalisées pour vaincre les cancers les plus récalcitrants. Au printemps ����,
des chercheurs de l’Institut national du cancer
des États-Unis (NCI) ont fait état d’un cas de
rémission extraordinaire d’un cancer du sein
métastasique. La patiente, Judy Perkins, avait
suivi une thérapie expérimentale recourant à ses
propres cellules immunitaires pour combattre
les tumeurs dont elle souffrait. L’équipe soignante, dirigée par Steven Rosenberg, pionnier
de l’immunothérapie, avait séquencé l’ADN de
ses tumeurs afin d’en analyser les mutations.
L’équipe avait aussi extrait un échantillon de
cellules immunitaires appelées lymphocytes
infiltrant les tumeurs (LIT). Elle avait testé ces
LIT pour savoir lesquels reconnaissaient les anomalies génétiques dans la tumeur de la malade.
Les chercheurs ont ensuite reproduit les LIT
« gagnants » à des milliards d’exemplaires. Puis
ils les ont injectés dans l’organisme de Perkins,
en plus d’un inhibiteur de point de contrôle, le
pembrolizumab. Plus de deux années après,
Judy Perkins ne montre aucun signe de cancer.
Un succès ne fait pas une révolution médicale.
Deux autres malades soignés par l’équipe de
Rosenberg sont décédés. « Je suis une petite
lueur, dit Perkins. Nous avons besoin de plein
d’autres petites lueurs pour acquérir les données
qui permettront de maîtriser le système immunitaire. » Le tournant n’est peut-être pas le traitement en lui-même, mais ce qu’il laisse entrevoir
du potentiel de la médecine personnalisée. Car
c’est aussi par les mutations spécifiques à chacun
qu’un cancer peut causer la perte du malade.
Le séquençage des �,� milliards de paires de
bases de notre ADN a été achevé en ����, grâce
à un projet long de treize ans, impliquant six
pays et près de ��� millions d’euros – le tout pour
un seul génome. Aujourd’hui, un séquençage
revient à environ ��� euros, et les machines les
plus récentes livrent les résultats dans la
journée. Cette technologie, associée à l’analyse
moléculaire la plus pointue, permet de découvrir les incroyables variations biochimiques qui
font de chacun de nous un être unique.
Or plus nous comprenons à quel point chacun
est unique, plus la médecine conventionnelle
apparaît fruste. La génomique nous révèle, par
exemple, que des médicaments censés convenir
à tous, telles les statines ou les corticostéroïdes,
quoique bénéfiques pour la plupart des patients,
ne le sont pas pour un grand nombre d’entre eux.
Aux États-Unis, l’Agence des produits alimentaires et médicamenteux (FDA) a identifié une
centaine de médicaments qui ne marcheraient
pas chez les patients avec certains variants génétiques, mais qui leur sont pourtant prescrits.
MÉDECINE PERSONNALISÉE
49
LE CORPS SOUS
SURVEILLANCE
PERMANENTE
La médecine personnalisée adapte le traitement
à l’individu. La santé personnalisée utilise des
données détaillées pour aider chacun à adapter
ses comportements et à effectuer des choix
de vie sains. Il s’agit, en premier lieu, d’éviter de
devoir recourir à un traitement. Cela suppose
de recueillir, transmettre et stocker des données
sur la santé d’un individu tout au long de sa vie.
Pendant le sommeil
De petites électrodes assez
souples pour s’adapter aux
textiles pourraient donner
naissance à des taies
d’oreiller et à des draps
capables d’enregistrer
les ondes cérébrales et les
habitudes de sommeil.
Dans la cuisine
Bientôt, des réfrigérateurs
pourraient contrôler
les aliments stockés et
consigner leurs informations
nutritionnelles. La qualité
des aliments, leur fraîcheur
et les habitudes alimentaires seraient examinées.
Au réveil
Des toilettes analysant selles
et urine en quête d’indices
de maladies sont en cours
de conception. À l’avenir,
des miroirs intelligents
pourraient mesurer les
signes vitaux, et les brosses
à dents analyser la salive.
Le problème peut se révéler fatal. Le clopidogrel est un médicament contre la formation de
caillots sanguins chez des patients cardiaques.
Or un quart de ces derniers possèdent un variant
génétique qui produit une forme défectueuse
d’un enzyme requis pour activer le médicament.
Alan Shuldiner (université du Maryland) a
découvert que, avec ce médicament, le risque
d’une nouvelle attaque cardio-vasculaire ou de
décès dans l’année ayant suivi la première est
deux fois plus important parmi cette population
que chez les personnes dépourvues du variant.
D
Michael Snyder,
directeur du Centre de génomique et
de médecine personnalisée à l’université Stanford, traque les marqueurs moléculaires
et physiologiques de son propre corps. Snyder
et son équipe analysent un flux continu d’informations au crible de son ADN, qui a été séquencé :
mesures concernant le sang ou l’urine, données
50
EPUIS NEUF ANS,
En étant connecté
Des téléphones intelligents
pourraient analyser des
indices de dépression
(par exemple, l’étiolement
des relations sociales) et
prévenir l’usager de risques
de problèmes touchant
à sa santé mentale.
issues des biocapteurs qu’il porte aux poignets,
à l’annulaire et au bras droits, prélèvements de
selles. Snyder passe IRM, échocardiogrammes
et scanners afin de détecter d’éventuels changements dans ses organes et ses muscles, mesurer
l’évolution de sa masse osseuse…
Snyder, �� ans, n’a rien d’un hypocondriaque.
Il tente d’appliquer ces techniques à la détection
de maladies au tout premier stade de leur manifestation, avant qu’elles ne deviennent sources
de problèmes. Il s’est choisi comme cobaye, car
il était convaincu que personne ne serait capable
de suivre fidèlement le programme de tests et
d’analyses qu’il s’impose.
Voilà quatre ans, avant même qu’il ne tombe
malade, ses capteurs ont signalé une infection
grâce aux changements de son rythme cardiaque
et du taux d’oxygène dans son sang. Quand la
fièvre est apparue, Snyder a soupçonné la maladie de Lyme. À l’heure où les tests habituels
confirmaient son intuition, il avait déjà achevé
sa cure d’antibiotiques. Il a également observé
sur lui-même le développement d’un diabète de
type �. Son ADN révélait une prédisposition,
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
Un cercle vertueux
Les facteurs de risque pour la santé
d’un sujet sont évalués et comparés
aux données d’une vaste population.
Cela permet de suggérer des choix
ou des interventions bénéfiques
pour le sujet. La surveillance passive
au quotidien est la clé d’une
amélioration constante de son état.
En voiture
Des capteurs pourraient
avertir le conducteur
de niveaux de pollution
dangereux, d’une
alcoolémie élevée dans
l’haleine, d’une conduite
marquée par un état de
stress ou de somnolence.
Évaluation
Évaluation
des risques
risques
des
Antécédents familiaux
Dépistage génétique
Facteurs socio-économiques
Facteurs environnementaux
Pendant son jogging
Des appareils connectés ou des
membranes électriques sur la
peau peuvent capter l’activité
physique, les signes vitaux ou
mesurer l’exposition aux rayons
ultraviolets, tandis qu’un
« soutien-gorge intelligent »
détecterait le cancer du sein.
mais, Snyder étant mince et dépourvu d’antécédents familiaux, il n’en a pas tenu compte. À la
suite d’une éprouvante infection virale, son taux
de glucose a grimpé, et est resté élevé. Il a alors
envisagé qu’il puisse s’agir du diabète. Comme
Snyder, son médecin avait d’abord balayé l’hypothèse, mais les tests ont confirmé le diabète.
Snyder a abandonné les sucreries, doublé ses
heures de vélo, s’est mis à courir � km quatre fois
par semaine, a éliminé les aliments favorisant
l’hyperglycémie et rectifié son régime. Neuf
mois plus tard, son taux de glucose était redevenu normal. Entre-temps, Snyder avait recruté
plus d’une centaine de volontaires désireux de
suivre un processus évaluatif similaire.
J’ai moi-même signé pour passer une batterie
de tests à Stanford – séquençage d’ADN compris.
Orit Dagan-Rosenfeld, conseillère en génétique
et membre de l’équipe de Snyder, m’a reçue dans
un petit bureau. Avais-je bien compris que le
séquençage de mon ADN pouvait révéler des
résultats qui exigeraient un traitement (par
exemple, en cas de mutations du gène BRCA,
à l’origine du cancer du sein ou du cancer de
Banque
Banque
de données
données
de
Veille
Veille
sanitaire
sanitaire
Dans votre corps
Des lentilles de
contact vérifieraient la
pression et le taux de
glucose dans l’œil. Des
implants peuvent déjà
surveiller l’activité
cardiaque, et les taux
d’azote et d’oxygène.
Apprentissage automatique
Reconnaissance de formes
Intervention médicale précoce
Changements de comportement
Au laboratoire
Des « nez électroniques » pourraient analyser les composés
volatiles lors de l’expiration
ou dans les sécrétions (sueur,
salive), afin de détecter
les « empreintes olfactives »
de maladies, dont les cancers
du poumon ou des ovaires.
l’ovaire) ? Me rendais-je bien compte que le test
pouvait révéler des problèmes sur lesquels je
n’aurais aucune prise, telle l’existence du gène
APOE�, qui augmente le risque d’Alzheimer ?
Et voulais-je connaître toutes les données ?
ou ne connaître que celles qui exigeraient un
traitement ? ou tout ignorer ?
Je voulais tout savoir. Un nœud à l’estomac
m’a fait comprendre qu’une partie de moi n’était
pas d’accord. Des infirmières ont nettoyé mes
fosses nasales et l’intérieur de mes joues, avant
de me prélever seize fioles de sang.
Dans l’attente des résultats, je repensais aux
dix années qui avaient vu mon père sombrer
dans la démence sénile. Était-ce mon héritage
génétique ? Pour cesser de broyer du noir, je
m’efforçais de penser à ma mère. À �� ans, elle
vivait seule à New York, prenait le bus et le
métro, dansait et jouait au mah-jong.
Les tests génétiques promettent un plus grand
contrôle sur votre santé, mais, pour la première
fois de ma vie, j’ai considéré ma santé comme
un héritage – heureux ou non, mais sur lequel
je n’avais nulle prise.
(suite page 58)
JASON TREAT, ÉQUIPE DU NGM, KELSEY NOWAKOWSKI. ILLUSTRATION : CHRISTOPHER DELORENZO.
SOURCE : SANJIV SAM GAMBHIR, UNIVERSITÉ STANFORD.
MÉDECINE PERSONNALISÉE
51
PRÉLEVER ET TESTER
Les chirurgiens ôtent une
tumeur, à la fondation
Champalimaud, à Lisbonne.
Des cellules cancéreuses
seront tranplantées dans
des larves de poisson-zèbre
et traitées avec la chimiothérapie du patient, afin
d’en tester l’efficacité.
LE TEST DU
POISSON-ZÈBRE
Le poisson-zèbre pourrait devenir un puissant
outil pour identifier
la chimiothérapie la
mieux à même de tuer
le cancer d’un patient.
Des biologistes de
la fondation
Champalimaud ont
injecté des cellules
tumorales de patients
dans des larves de
poissons-zèbres. Ils ont
ensuite testé sur ces
larves la chimiothérapie utilisée sur les
patients. Pour quatre
patients sur cinq,
CI-DESSUS : RITA FIOR, FONDATION CHAMPALIMAUD
les larves ont auguré
correctement de l’efficacité des médicaments.
Des souris élevées avec
des tumeurs humaines
ont été utilisées lors
d’essais similaires.
Cependant, la procédure est coûteuse
et prend des mois.
Le poisson-zèbre peut
être élevé facilement
et à peu de frais dans
des récipients, et testé
en seulement quatre
jours. Chez un poissonzèbre servant à un test
(ci-dessus), les cellules
tumorales humaines
apparaissent en
magenta, les noyaux
cellulaires, en bleu,
et les vaisseaux
sanguins, en vert.
TUEURS DE CANCER
Judy Perkins figure
ici sur fond de lymphocytes infiltrant les
tumeurs (LIT, des
globules blancs) qui ont
permis de soigner son
cancer du sein (voir les
tomographies, page
de droite, en bas).
Elle avait été amputée
du sein gauche après
un premier diagnostic.
Lors d’une récidive,
la chimiothérapie, les
traitements hormonaux
et les thérapies ciblées
n’ont pas empêché
la prolifération d’une
nouvelle tumeur
dans sa poitrine.
L’espérance de vie de
Judy Perkins n’était
que de quelques mois.
On lui a alors appliqué
un traitement
expérimental, créé par
Steven Rosenberg,
de l’Institut national du
cancer des États-Unis
(NCI), consistant à lui
injecter 82 milliards de
ses propres cellules LIT,
qu’elle a surnommées
son « armée »
(voir l’infographie,
pages suivantes).
À droite :
des coupes
transversales
montrent
l’élimination de
la tumeur
par le
traitement.
AVA N T L E T R A I T E M E N T
Tumeur
TOMOGRAPHIES : STEVEN ROSENBERG, INSTITUT NATIONAL DU CANCER DES ÉTATS-UNIS (NCI)
28 MOIS APRÈS
UNE SUPERIMMUNITÉ
Le séquençage génomique
de la tumeur a permis
d’identifier 62 mutations
cancéreuses.
Parmi les cellules immunitaires
(lymphocytes), on en identifie
certaines qui reconnaissent
4 des 62 mutations.
TTTTAAGATCCAATGATCTTCAAA
ACGCTGCAAGATTCTCAACCTGC
TTTACTAAGCGCTGGGTCCTACTC
CAGCGGGATTTTTTATCTAAAGA
CGATGAGAGGAGTATTCGTCAGA
CCACATAGCTTTCATGTCCTGATC
GGAAGGATCGTTGGCGCCCGACC
CTCAGACTCTGTAGTGAGTTCTAT
GTCCGAGCCATTGCATGCGAGAT
CGGTAGATTGATAGGGGATACAG
AATATCCCTGGATGCAATAGACG
GACAGCTTGGTATCCTAAGCGTA
GTCGCGCGTCCGAACCCAGCTCT
ACTTTAGAGGCCTCGGATTCTGG
TGCCCGCAGGCCGCAGAACCGAT
TAGGGGCATGTACAACAATATTT
ATTAGTCACCTTTGAGACACGAT
CTCCCACCTCACTGGAATTTAGTT
CCTGCTATAATTAGCCTTCCTCAT
TTTTAAGATCCAATGATCTTCAAA
ACGCTGCAAGATTCTCAACCTGC
TTTACTAAGCGCTGGGTCCTACT
CCAGCGGGATTTTTTATCTAAAG
ACGATGAGAGGAGTATTCGTCAG
ACCACATAGCTTTCATGTCCTGAT
CGGAAGGATCGTTGGCGCCCGAC
CCTCAGACTCTGTAGTGAGTTCT
ATGTCCGAGCCATTGCATGCGAG
ATCGGTAGATTGATAGGGGATAC
AGAATATCCCTGGATGCAATAGA
CGGACAGCTTGGTATCCTAAGCG
TAGTCGCGCGTCCGAACCCAGCT
CTACTTTAGAGGCCTCGGATTCT
GGTGCCCGCAGGCCGCAGAACCG
ATTAGGGGCATGTACAACAATAT
TTATTAGTCACCTTTGAGACACG
ATCTCCCACCTCACTGGAATTTAG
TTCCTGCTATAATTAGCCTTCCTC
(suite de la page 51)
Rien ne clochait chez
moi, m’a appris Dagan-Rosenfeld lorsque nous
avons examiné les résultats. Mais je ne me
sentais pas aussi soulagée que je l’aurais cru.
Entre-temps, mon reportage m’avait montré le
chemin que la science devait encore accomplir
avant d’interpréter tous les messages de l’ADN.
Ce que j’ai bel et bien appris, en revanche, c’est
que j’ai du mal à métaboliser certains médicaments, dont le clopidogrel.
Michael Snyder a réalisé des découvertes
génétiques importantes chez près de �� � de ses
volontaires. Par exemple, l’un d’entre eux suivait
depuis plusieurs années un traitement pour un
diabète de type � – à tort, car il souffrait d’une
forme rare et héréditaire de cette maladie.
Snyder, de son côté, a réussi à contenir son
diabète pendant cinq ans. Puis, son taux de sucre
s’est remis à grimper. Alors, il a changé de régime
alimentaire, soulevé de la fonte – en vain.
Son taux de sucre montait encore. Il a pris des
médicaments pendant plusieurs mois – sans
résultat. Il estime que les changements successifs dans son hygiène de vie ont eu un effet
58
Des recherches de pointe expérimentent
des traitements allant au-delà de la création
de nouveaux médicaments. Aux États-Unis,
l’Institut national du cancer (NCI) teste
une forme d’immunothérapie qui identifie
les mutations à l’origine des tumeurs,
puis déclenche la riposte du système
immunitaire du patient. Voici les étapes
du traitement qui a guéri Judy Perkins.
Les lymphocytes
infiltrant les tumeurs
(LIT) sont isolés
et cultivés.
préventif. Mais même la médecine personnalisée la plus pointue (doublée d’un souci quasi
religieux de se maintenir en bonne santé) reste
sans doute impuissante face aux handicaps
inscrits dans notre ADN.
S
nous sommes
tous semblables à plus de �� �. Ce qui
nous distingue : quelques millions de
variants génétiques en moyenne. Jusqu’à présent, les scientifiques ont catalogué ��� millions
de mutations différentes, depuis de grosses
altérations jusqu’à des disparités dans un seul
des nucléotides qui composent l’ADN.
Parmi ces variants, lesquels ne sont que
d’inoffensives excentricités ? Et lesquels représentent une menace ? Une expérience menée à
l’université Vanderbilt illustre l’ampleur du défi
que constitue la question. En étudiant l’ADN de
� ��� personnes, les chercheurs ont identifié
��� variants inhabituels dans deux gènes liés
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
UR LE PLAN GÉNÉTIQUE,
Les LIT sont reproduits
pour produire des milliards
de cellules anticancer.
à des troubles du rythme cardiaque. Ils ont alors
demandé à trois laboratoires de déterminer
quels étaient les variants à l’origine de ces anomalies. Le premier en a sélectionné ��, le deuxième, ��, et le troisième, ��. Les trois labos
n’étaient d’accord que sur quatre variants.
Les chercheurs ont alors comparé les résultats
des laboratoires avec les dossiers médicaux des
sujets concernés. Ils ont découvert que presque
aucun des patients possédant des variants
potentiellement préoccupants ne souffraient
de troubles du rythme cardiaque.
Comprendre les messages du code génétique
exige aussi un suivi considérable au fil des ans.
En effet, les mutations risquées sont rares. Les
maladies qui y sont associées peuvent prendre
beaucoup de temps avant de se développer.
Avec l’UK Biobank, la Grande-Bretagne est
à la tête des études dans le domaine. Cette
banque d’échantillons biologiques héberge les
secrets médicaux de ��� ��� Britanniques, tous
volontaires, âgés de �� à �� ans. Un congélateur
aussi large qu’une route à double sens et haut
d’une demi-douzaine de mètres conserve des
Les LIT injectés dans
le corps de Judy Perkins
détruisent le cancer.
prélèvements de leur sang, de leur urine et de
leur salive – soit �� millions d’échantillons,
stockés dans des tubes minuscules disposés
dans des bacs et estampillés de codes-barres
garantissant l’anonymat des donneurs.
Les ordinateurs de la Biobank sont connectés
aux dossiers médicaux des participants, car les
indices fournis par l’ADN ne se dévoilent que
lorsque les chercheurs peuvent établir un lien
entre des variants génétiques et les particularités ou les affections des personnes étudiées.
« Hélas, chacun finit un jour ou l’autre par être
source d’informations de ce genre, observe Rory
Collins, le directeur du projet et le principal
chercheur. Mais ces données auront un rapport
avec une maladie spécifique seulement chez une
petite partie des volontaires. »
La Biobank possède des tissus génotypés de
chaque donneur et le procédé consiste à analyser le génome en quête de variants individuels.
Elle travaille désormais au séquençage de
l’exome (parties des gènes exprimées sous forme
de protéines) des donneurs. L’analyse génotypique permet de découvrir
(suite page 62)
JASON TREAT, ÉQUIPE DU NGM ; KELSEY NOWAKOWSKI. ILLUSTRATION : CHRISTOPHER DELORENZO.
SOURCE : STEVEN ROSENBERG, INSTITUT NATIONAL DU CANCER DES ÉTATS-UNIS (NCI)
MÉDECINE PERSONNALISÉE
59
UNE CONCEPTION
AU JOUR PRÈS
Après une fécondation
in vitro (FIV), Carolyn
Bilson brandit son
échographie devant
Ilan Tur-Kaspa (en bleu),
directeur médical de
l’Institut de reproduction humaine (IHR),
à Chicago. Carolyn
Bilson et Tim O’Brien
ont conçu Westley
(à droite) grâce à un
transfert d’embryon
personnalisé. Tur-Kaspa
a étalonné 238 gènes
de l’utérus de Bilson
pour déterminer à
quelle date celle-ci
serait la plus réceptive
à l’implantation (une
étude encore en cours
a constaté une
augmentation de 24 %
des taux de grossesse
par FIV avec cette
méthode). L’échographie de l’utérus
de Bilson (en haut,
à gauche) montrait que
sa muqueuse endométriale présentait une
épaisseur de 8,9 mm,
ce qui suffit en général
pour une implantation.
Or les tests génétiques
ont révélé que la
fenêtre optimale
s’ouvrirait deux jours
plus tard que la date
prévue et qu’il faudrait
plus de traitements
hormonaux. Une autre
échographie (en haut,
à droite) montre le fils
de Bilson suçant son
pouce, treize semaines
après la conception.
CI-DESSUS : AVEC L’AIMABLE AUTORISATION DE LA FAMILLE BILSON/O’BRIEN (TOUS)
(suite de la page 59)
des bizarreries ou des
anomalies que les scientifiques savent devoir
rechercher. Le séquençage de l’exome est l’occasion d’en découvrir de nouvelles.
Plus de � ��� chercheurs dans le monde utilisent la mine d’informations que constitue la
base de données de la Biobank. Ils étudient
la génétique de maladies telles que le cancer,
l’ostéoporose ou la schizophrénie, et même des
habitudes aussi diverses que l’usage de la marijuana ou la tendance à veiller tard.
Cependant, ces recherches ne peuvent pas
s’appliquer à toutes les populations, car les
études portent essentiellement sur des populations blanches. Cet inconvénient se retrouve
dans d’autres bases de données très fournies.
En ����, une analyse des études sur les liens
entre gènes et maladies a révélé que �� � des
participants étaient d’ascendance européenne.
Sept ans plus tard, des chercheurs de l’université de Washington ont constaté une plus large
diversité des origines, mais surtout parce qu’un
plus grand nombre d’études provenaient d’Asie.
Les chercheurs utilisent toutefois les données
disponibles pour optimiser la médecine personnalisée. Le Broad Institute (Massachusetts) a
dévoilé une sorte de fiche préventive des risques
personnels de maladie. Des algorithmes calculent le risque de développer cinq maladies
graves fréquentes : affections cardiaques, cancer
du sein, diabète de type �, fibrillation auriculaire
et maladie inflammatoire de l’intestin.
Ce concept de fiche préventive est né d’une
découverte troublante. Beaucoup d’entre nous
portons de nombreuses mutations qui, séparément, ne présentent aucun danger, mais dont
l’accumulation devient problématique. Dans le
cas du cancer du sein, l’ensemble de ces petites
mutations est aussi dangereux qu’une mutation
du type BRCA� et bien plus répandu. Dans un
futur assez proche, les médecins utiliseront des
systèmes similaires pour évaluer les risques de
leurs patients – peut-être dès la naissance.
U
à l’Institut de médecine
régénérative de l’hôpital Cedars-Sinai,
à Los Angeles, j’admire de magnifiques
cellules vues au microscope. Quelques mois plus
tôt, ces taches que je vois sur un écran étaient des
cellules sanguines prélevées chez un donneur
62
N APRÈS-MIDI,
adulte. Les chercheurs en ont extrait des cellules
souches embryonnaires. Par la suite, une équipe
dirigée par Clive Svendsen, neurochimiste et
directeur de l’Institut, les a transformées en une
version rudimentaire de tissu nerveux spinal (de
la moelle épinière) portant la signature génétique du donneur. « Ça ressemble à de la sciencefiction, n’est-ce pas ?, observe Svendsen. Il n’y a
pas si longtemps, c’était de la science-fiction. »
L’objectif est de créer des modèles qui faciliteront l’étude des affections spécifiques à un
patient. Par exemple, dans le laboratoire de Clive
Svendsen, un chercheur travaillant sur le cancer
des ovaires synthétisera une version miniature
des trompes de Fallope (tubes utérins) à partir
du sang prélevé sur une personne atteinte de ce
même cancer. L’équipe dédiée aux maladies de
l’appareil digestif créera du tissu intestinal à
partir du sang ou de la peau. Svendsen et son
équipe, qui étudient la maladie de Parkinson et
d’autres affections neurodégénératives, produisent du tissu spinal et cérébral.
Presque n’importe quel tissu prélevé sur un
adulte peut être utilisé. Les scientifiques le
reprogramment, utilisant les protéines impliquées dans l’expression des gènes pour muer
une cellule mature en une cellule ressemblant
à une cellule embryonnaire. Les cellules reprogrammées (dites « cellules souches pluripotentes ») ainsi obtenues sont déposées dans une
solution riche en facteurs de croissance et autres
protéines. La « recette » est concoctée avec grand
soin, afin de synthétiser au mieux tous les tissus
fonctionnels que le chercheur désire obtenir.
Une fois le tissu créé, les scientifiques le
mettent de côté et déposent les cellules sur une
puce – une plaque translucide de la taille d’une
carte mémoire. Fabriquée par Emulate, une
entreprise de Boston, cette puce organique est
innervée de minuscules canaux qui transportent
le sang et les nutriments vers les cellules pour
en favoriser la maturation.
Selon Clive Svendsen, ce modèle permettra
de tester de nouveaux médicaments et de
connaître à l’avance la réaction d’un malade à
un traitement donné. Déterminer quel médicament est le plus efficace pour un patient est souvent un processus pénible, dit-il. Et d’évoquer
l’épilepsie : « Nous infligeons à des gosses trois
mois d’enfer en essayant un médicament après
l’autre. Avec la puce, on peut prescrire un médicament différent chaque jour jusqu’au moment
où on trouve celui qui empêchera les crises. »
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
Des voix s’élèvent, affirmant que les cellules
reprogrammées sur une puce ne fournissent
qu’une vue partielle de ce qui se déroule réellement au sein d’un corps. Je demande donc à
Clive Svendsen comment, par exemple, il pourrait savoir si un médicament contre l’épilepsie
risque d’être toxique pour le foie ou le cœur. C’est
simple, me répond-il : son laboratoire utiliserait
des cellules souches pour créer des versions
miniatures de ces deux organes, que l’on testerait avec les médicaments en cause.
J
U S Q U ’O Ù L E S T E C H N O LO G I E S cellulaires
et génétiques peuvent-elles repousser
les limites de la médecine ? Le laboratoire de Shoukhrat Mitalipov, à l’université des
sciences et de la santé de l’Oregon, fournit
quelques pistes. Mitalipov a utilisé une sorte de
ciseau moléculaire du nom de Crispr-Cas� pour
uniques. Mais, que la méthode soit validée ou
non, la communauté scientifique en vient progressivement à accepter le caractère inéluctable
des modifications embryonnaires.
Je demande à Mitalipov s’il ne craint pas
que ces expériences conduisent à la formation
d’embryons dotés de caractères spécifiques,
à la grande joie des parents. « Je ne fais pas de
la manipulation, me réplique-t-il. Je fais de
la correction. Est-ce que c’est mal ? »
En ����, le premier bébé-éprouvette a suscité
beaucoup d’anxiété. Que nous réservaient les
manipulateurs de la vie ? Depuis, plus de � millions de bébés sont nés grâce à la fécondation in
vitro et à d’autres techniques de reproduction.
Quant à la première transplantation cardiaque,
en ����, elle a fait craindre que les médecins ne
mettent prématurément fin à la vie de patients
comateux, dans le but de prélever leur cœur.
Les peurs se sont estompées à mesure que ces
avancées techniques se sont banalisées. Quand
le séquençage de l’ADN, l’édition génomique et
La communauté scientifique en vient progressivement à accepter
le caractère inéluctable des modifications embryonnaires.
modifier l’ADN d’embryons humains. Avec son
équipe internationale, il a coupé un segment
dans un gène paternel pour supprimer une
mutation responsable de l’apparition d’une
maladie cardiaque mortelle, la cardiomyopathie
hypertrophique. En parallèle, ils ont fécondé des
ovules de donneuses saines avec le sperme d’un
homme atteint de cette maladie.
Si ces embryons pouvaient devenir des bébés,
ils ne seraient pas frappés par la maladie ou ne
transmettraient pas l’anomalie génétique à la
descendance familiale. Mitalipov n’avait pas
l’intention de mener l’expérience aussi loin. Les
chercheurs ont cultivé les embryons pendant
environ trois jours, avant de retirer les cellules
et de procéder à des analyses plus poussées.
Le bricolage des génomes embryonnaires a
longtemps été considéré comme tabou. La technique de réparation de Mitalipov n’a pas fonctionné dans tous les cas. Il estime cependant
qu’avec une approche plus pointue, elle pourrait
être utilisée pour éliminer n’importe laquelle
des �� ��� maladies associées à des mutations
d’autres prouesses techniques permettront de
sauver des vies, on pourrait assister à un phénomène similaire. La révolution qu’annonce la
médecine personnalisée est toutefois sans
commune mesure avec tout ce que nous avons
connu. Elle nous permettra de lever le voile sur
ce qui, dans notre corps, est toujours resté secret,
et d’anticiper ce que nous réserve notre avenir
médical. Elle fait entrer la science dans un
nouvel univers, celui des manipulations
biologiques – et des guérisons.
Judy Perkins, qui a survécu au cancer grâce
aux progrès de l’immunothérapie et de la technologie génomique, souhaiterait que l’on se
montre plus lucide face aux potentialités que
la science vient de libérer. « C’est comme l’énergie nucléaire, affirme-t-elle. Si on en perd le
contrôle, ça peut très, très mal finir. Mais,
si on la maîtrise, c’est fabuleux. » c
Fran Smith a écrit « Pourquoi nous sommes accros »
dans le numéro de septembre 2017. Le précédent
reportage de Craig Cutler portait sur la biotechnologie en agriculture (octobre 2014).
MÉDECINE PERSONNALISÉE
63
SANTÉ
QUAND LA
MÉDECINE CHINOISE
INSPIRE LA SCIENCE
L A MÉDECIN E T RA D IT IO N N E L L E C HI NO I S E E ST EN TR A I N
DE C HA NGER L E S P RAT IQ U E S D E S O I NS D E SA N TÉ MO D ER NE S.
Par Peter Gwin • Photographies de Fritz Hoffmann
Version de 1620 du
Classique de la médecine
interne de l’Empereur
Jaune, compilé pour
la première fois il y a
environ 2 100 ans.
PHOTOGRAPHIE RÉALISÉE
À LA BIBLIOTHÈQUE NATIONALE
DE MÉDECINE DES ÉTATS-UNIS
66
1
2
3
4
8
9
10
11
15
16
17
18
24
25
N AT I O N A L G E O G R A P H I C
22
23
5
6
7
Les guérisseurs
chinois utilisent
depuis plus
de 2 200 ans tout un
éventail de produits
naturels, dont
le notoginseng
(cousin du ginseng),
l’hippocampe,
le bouton de rose,
la réglisse et le
placenta humain.
Ces substances et
des milliers d’autres
restent en usage en
Chine et ailleurs.
Les bocaux n° 1, 8, 15
et 22 (première
colonne) présentent
des ingrédients
utilisés dans un traitement prometteur
contre le cancer,
appelé PHY906.
12
19
13
20
14
21
1. Racine de pivoine blanche
2. Hippocampes
3. Tubercule de Gastrodia
4. Feuilles de lotus
5. Rhizome de roseau
6. Angélique chinoise
7. Tortue trionyx de Chine
8. Racine de scutellaire
du Baïkal
9. Peaux d’agrumes
10. Nid de guêpes séché
11. Mues de cigale
12. Pachyme (ou fu ling)
13. Racine de livèche
du Sichuan
14. Placenta humain
15. Jujubes
16. Feuilles d’épimède
17. Cereus à floraison nocturne
18. Encens
19. Fruits de patole
(Trichosanthes)
20. Feuille de pérille
21. Feuilles de séné
22. Racine de réglisse
23. Boutons de roses
24. Racine de digitale
de Chine
25. Fruits de Siraitia grosvenorii
26. Vers de terre
27. Graines de lotus
28. Fruits du jasmin du Cap
LES ÉLÉMENTS NE SONT PAS TOUS
À LA MÊME ÉCHELLE. PHOTOGRAPHIES
RÉALISÉES AU COLLÈGE IMPÉRIAL
DE MÉDECINE TRADITIONNELLE
ORIENTALE, À SANTA MONICA
(CALIFORNIE) ET AU NATIONAL
WILDLIFE PROPERTY REPOSITORY,
À COMMERCE CITY (COLORADO) ;
SOURCES : ROBERT NEWMAN,
COLLÈGE IMPÉRIAL DE MÉDECINE
TRADITIONNELLE ORIENTALE ; AMY
MATECKI, CENTRE INTERNATIONAL
DE MÉDECINE INTÉGRATIVE
26
27
28
À G AU C H E
James Harrison,
ancien joueur de
football américain,
a recouru à une
forme d’acupuncture et à d’autres
thérapies chinoises
pour soulager ses
douleurs : « Si cela
peut m’aider
à me sentir bien,
je n’ai pas besoin
de preuves
scientifiques. »
À DROITE
À l’université du
Minnesota, un cœur
de porc bat depuis
des heures, dans
une version synthétisée d’acide biliaire
d’ours. Depuis plus
de mille ans, les
guérisseurs chinois
prescrivent la bile
d’ours, notamment
contre l’épilepsie
et pour le cœur.
Je tiens dans la main
un cœur chaud,
qui bat encore. C’est
un globe luisant
de tissus violets, roses
et blancs, plus gros
qu’une balle de tennis.
Je sens ses chambres se contracter, j’entends
le sifflement du fluide qu’il pompe encore. C’est
visqueux, et dégage une odeur légèrement âcre.
L’organe est vivant. Huit heures plus tôt,
j’ai vu Paul Iaizzo, professeur de chirurgie à l’université du Minnesota, le prélever sur un porc
anesthésié, dans son laboratoire en sous-sol. Il
l’a ensuite branché sur des tubes faisant office
d’artères et de veines, et a relancé le rythme
cardiaque d’une impulsion électrique.
Le cœur se contracte et palpite. Je trouve cela
étrange, mais, plus encore, beau et hypnotique.
Ce cœur bat en partie parce que Paul Iaizzo l’a
traité avec un bain de composants chimiques
imitant ceux de la bile d’ours. C’est l’application
scientifique d’une conviction que les guérisseurs
chinois défendaient déjà au ����e siècle : la bile
d’ours est bonne pour le corps humain.
70
N AT I O N A L G E O G R A P H I C
PLANTE ANTICANCER
Yung-Chi Cheng, de
l’université Yale,
examine un plant de
notoginseng dans
un centre de recherche
du Yunnan. Il étudie
des traitements par
les plantes inspirés
d’anciennes formules
chinoises – dont un, en
phase d’essai clinique,
contre le cancer.
Un marché de la bile d’ours reste d’ailleurs
vivace. En Asie, des ours vivent enfermés dans
de petites cages, avec des cathéters pour drainer
leurs fluides. Les organisations de défense des
animaux dénoncent cette pratique. Pourtant,
tout en tenant le cœur palpitant du porc, j’écoute
Iaizzo m’expliquer comment les substances qui
préservent les organes des ours de l’atrophie
pendant l’hibernation pourraient protéger les
organes humains. Et je ne peux m’empêcher de
me demander : la bile d’ours aurait-elle sauvé
le cœur défaillant de mon père ? Sauvera-t-elle
le mien, un jour, ou celui de mes enfants ?
peu de sujets
soulèvent plus de controverses que la médecine
chinoise traditionnelle. Des débats relancés par
les travaux de chercheurs tels qu’Iaizzo et bien
DA N S L E S C E RC L E S M É D I C AUX ,
d’autres, qui étudient les remèdes traditionnels
avec des techniques de pointe et effectuent des
découvertes intéressantes. Celles-ci pourraient
avoir des conséquences sur la médecine moderne.
La Chine dispose de l’un des corpus d’observations médicales documentées les plus anciens,
offrant aux scientifiques un énorme trésor où
puiser. Ces archives remontent au ���e siècle
av. J.-C. À l’époque, les guérisseurs se lancèrent
dans l’étude du corps, l’interprétation de ses
fonctions et la description de ses réactions à
divers traitements – dont les plantes, le massage
et l’acupuncture. Depuis plus de � ��� ans, des
érudits amplifient et affinent ces connaissances.
Le résultat est un canon de littérature médicale traitant de tout type de problèmes de santé,
du simple rhume aux maladies vénériennes, aux
paralysies et à l’épilepsie.
(suite page 76)
MÉDECINE CHINOISE
71
L’ESSOR DU GOJI
Des baies de goji sèchent
dans une ferme de la
province du Qinghai, dans
le nord-ouest de la Chine.
Entre autres bienfaits, elles
sont réputées améliorer
le sommeil et les performances sportives. La
demande pour ces baies
stimule leur production
dans de nouvelles régions
agricoles, comme le
Qinghai, où les fruits sont
plus gros. L’efficacité des
baies varie en fonction
des sols et du climat.
PRODUITS ANIMAUX
Cette boutique de
Guangzhou (Canton)
se spécialise dans les
parties de daim (bois,
pénis, tendons…), qui
servent dans d’anciens
remèdes. L’utilisation
de parties d’animaux
freine l’acceptation
de la médecine
chinoise traditionnelle
en Occident.
Caption tk ipsem lorem
uis vend occab ipsam
res et et larum et lame
ipis ea que molor pore
pro blaceribus diosm
quis aspie brndan isa
adipsus cearu ptatemp
ossimil litatur sin pore
nulpa consequo berro
quae. Ucillori omll auda
dolorecus ul volporm
orum quat gium quiat.
(suite de la page 71)
Ce savoir est conservé
dans des ouvrages aux titres énigmatiques, tels
le Classique des pouls (���e siècle), Prescriptions
valant mille onces d’or (���e siècle) ou Secrets
médicaux d’un fonctionnaire (����e siècle).
La médecine traditionnelle est restée la principale source des soins en Chine jusqu’au début
du ��e siècle. Le dernier empereur des Qing fut
alors renversé par Sun Yat-sen, un médecin formé
à l’école occidentale, qui promut une pratique
fondée sur la science. Aujourd’hui, les médecins
chinois sont formés aux techniques de pointe.
Pourtant, la médecine traditionnelle demeure
vivace au sein du système de santé du pays.
La plupart des hôpitaux chinois ont une salle
dévolue aux traitements anciens. Citant la capacité de la médecine traditionnelle à réduire les
coûts et à générer des traitements innovants (et,
bien sûr, à promouvoir le prestige national), le
président Xi Jinping a fait de cet héritage un
pivot de la politique de santé chinoise.
la médecine chinoise
traditionnelle de pseudoscience et de charlatanisme. Ils dénoncent ses bizarreries, comme la
pratique très ancienne consistant à allumer des
feux d’artifice pour chasser les démons, et de
mystérieux concepts encore en vigueur – par
exemple, la nébuleuse « énergie vitale » (ou qi,
soit, littéralement, « la vapeur qui s’élève du
riz »). D’autres s’insurgent aussi contre son
recours aux parties d’animaux, et avertissent des
dangers potentiels de ses formules végétales.
« Il est rare de trouver quelqu’un qui l’examine
objectivement », prévient l’historien de la médecine Paul Unschuld. Figure de proue de l’histoire
de la médecine chinoise (et souvent critique
implacable de l’interprétation que l’on en fait),
Unschuld a recueilli et traduit des centaines de
vieux textes médicaux. Il travaille à l’heure
actuelle avec une start-up sino-allemande à
l’analyse systématique de formules où puiser des
idées de traitements pour certaines maladies,
dont l’épilepsie. « Généralement, les gens ne voient
� L’UN DES MÉDICAMENTS
que ce qu’ils veulent voir,
ajoute Unschuld à propos
LES PLUS ANCIENS ET LES PLUS
de la médecine chinoise,
EFFICACES, ET VALIDÉ PAR LA
et ils n’arrivent pas à analyser pleinement son
SCIENCE, VIENT DE LA MÉDECINE
bien-fondé et ses failles. »
TRADITIONNELLE : L’ASPIRINE. �
J’ai fait l’expérience
YUNG�CHI CHENG, PROFESSEUR DE PHARMACOLOGIE À YALE
de ce guêpier lors d’un
reportage sur le braconnage des rhinocéros pour
Ailleurs, dans les meilleures universités amé- leur corne. De vieilles recettes chinoises presricaines et européennes, mais aussi asiatiques, crivent la corne de rhinocéros pour guérir la
des chercheurs analysent de façon scientifique fièvre et le mal de tête. Au Viêt Nam, j’ai renconles principes fondamentaux de remèdes tradi- tré des patients qui l’utilisent contre la gueule
tionnels pour des maladies comme le cancer, de bois et les effets secondaires de la chimiothéle diabète et Parkinson.
rapie. Selon de multiples études scientifiques,
En parallèle, les patients commencent aussi la corne, composée de kératine (la substance des
à mélanger le moderne et l’ancien. Quand la ongles des humains), n’a peu ou pas d’effet pharmédecine occidentale ne les soulage pas, les maceutique perceptible quand on l’ingère. Mais
Américains se tournent de plus en plus vers des son effet placebo apaise des patients. Après la
traitements traditionnels. Parmi ceux-ci, l’acu- publication de mon article, j’ai reçu des lettres
puncture et les ventouses – une thérapie mus- de lecteurs furieux dénonçant la « fumisterie »
culaire qui recourt à la succion et adoptée par et la « cruauté » de la médecine chinoise, et sa
proximité avec la « sorcellerie ».
de nombreux athlètes professionnels.
Le marché de la corne de rhinocéros en Asie
Internet favorise la diffusion de remèdes
à base d’herbes, souvent moins chers que les est un facteur crucial de l’extinction prévisible
produits pharmaceutiques prescrits par un de l’espèce. Et outre, les ours et de nombreux
médecin. En ����, les ventes de compléments animaux – dont des espèces en danger, comme
naturels ont atteint � milliards de dollars aux le tigre, le léopard et l’éléphant – sont braconnés
États-Unis – une hausse de �� � depuis ����.
sur leurs territoires ou élevés pour des parties
76
N AT I O N A L G E O G R A P H I C
D E S M É D E C I N S Q UA L I F I E N T
de leur corps ou leurs organes. Mais certaines
pratiques de la médecine moderne sont également controversées. L’efficacité de nombreux
antidépresseurs fait l’objet de vifs débats, et des
études montrent qu’ils sont à peine plus efficaces que des placebos. Ils n’en sont pas moins
commercialisés massivement et fréquemment
prescrits – un marché qui pèse des milliards.
Si on l’envisage à la lumière d’autres exemples
(surprescription d’opioïdes, soutien de médecins à des régimes alimentaires à la mode, pratiques chirurgicales douteuses), l’indignation
occidentale face à la médecine traditionnelle
chinoise paraît plus hypocrite qu’hippocratique.
À ce propos, l’histoire de l’huile de serpent est
instructive. Cet onguent traditionnel, à base de
graisse d’un serpent de la mer de Chine, a longtemps été synonyme d’escroquerie. D’après les
historiens, ce remède fut introduit aux États-Unis
au ���e siècle par des immigrants chinois recrutés pour construire les voies ferrées. Ceux-ci
l’utilisaient pour soigner leurs douleurs articulaires et musculaires. La substance acquit une
réputation douteuse, car des colporteurs américains se mirent à vendre des huiles minérales
sous le nom d’« huile de serpent ».
Oui, mais : des études montrent que la graisse
du serpent de mer de Chine contient un taux
d’acides gras oméga-� plus élevé que le saumon.
Les omégas-� sont réputés réduire les inflammations et le mauvais cholestérol, améliorer la
cognition et aider à atténuer la dépression. On
les utilise aujourd’hui dans plusieurs produits
cosmétiques. Au début des années ����, des chercheurs japonais ont nourri des souris avec de la
graisse du serpent Laticauda. Ils ont constaté
une augmentation des capacités des cobayes à
nager et à se repérer dans un labyrinthe.
lance
avec un petit rire Yung-Chi Cheng, professeur
de pharmacologie à la faculté de médecine de
l’université Yale. Les gens oublient que l’un des
médicaments les plus anciens et les plus efficaces, et validé par la science, vient de la médecine traditionnelle : l’aspirine. »
Les Égyptiens de l’Antiquité utilisaient des
feuilles de myrte contre courbatures et douleurs.
Le médecin grec Hippocrate (��e siècle av. J.-C.),
considéré comme le père de la médecine occidentale, préconisait un extrait d’écorce de saule
contre la fièvre. Les scientifiques européens
comprirent seulement dans les années ���� que
« N E J E T E Z PA S L E B É B É AV E C L’ E AU D U B A I N ,
l’ingrédient actif dans les deux produits est
l’acide salicylique, et le synthétisèrent. De nos
jours, l’aspirine ne coûte presque rien et est sans
doute le médicament le plus rentable du monde.
« Cela a commencé par des gens qui ont
constaté l’efficacité de l’écorce de saule, avant
de l’utiliser pour traiter des maladies, explique
Cheng. Dans ce cas, la science a suivi la médecine, et non l’inverse. »
L’aspirine n’est pas le seul exemple d’un médicament moderne dissimulé dans des traitements
traditionnels. En ����, Tu Youyou, une chimiste
de la République populaire de Chine, annonça
la découverte d’une substance antipaludique
contenue dans une plante médicinale chinoise
mentionnée dans une formule du ��e siècle.
Pendant la guerre du Viêt Nam, Tu Youyou
avait été enrôlée sur un projet militaire secret,
pour aider le Viêt-cong à combattre le paludisme, responsable d’environ la moitié de leurs
pertes. Dans le même but, des scientifiques occidentaux ont testé plus de ��� ��� molécules.
Tu se demandait si la réponse ne se trouvait
pas dans les classiques de la médecine chinoise.
Elle testa plusieurs plantes associées à la fièvre,
et trouva un remède à base d’une plante aux
fleurs jaunes, l’armoise annuelle. Le médicament issu de ses recherches, l’artémisinine, a
sauvé des millions de vies et lui a valu le prix
Nobel de médecine en ����.
Je suis en train
de suivre Yung-Chi Cheng dans son laboratoire
labyrinthique, à Yale. C’est là que son équipe
analyse les composants caractéristiques d’un lot
de plantes pour en étudier la valeur médicinale.
Au milieu des soupirs et des gargouillis de
diverses expériences chimiques, je capte des
bouffées de poivre noir, romarin, camphre, gingembre, chili, cannelle, et d’autres odeurs que
je n’arrive pas à identifier. Le fond de ma gorge
picote. Je crois que je vais éternuer. Je constate
que j’ai très envie de nourriture thaïlandaise.
Cheng a l’air du partisan-type de la médecine
chinoise traditionnelle. Il a émigré de Taïwan
vers les États-Unis il y a cinq décennies, mais, à
�� ans, parle encore l’anglais avec un fort accent.
Il fait partie d’une génération de Chinois marqués par leur fort attachement aux traditions.
« Je ne savais pas grand-chose de la médecine
chinoise », concède-t-il. Ses parents, dit-il, l’amenaient chez des médecins pratiquant la médecine scientifique.
(suite page 81)
C ’ E S T L A PA N I Q U E DA N S MO N N E Z .
MÉDECINE CHINOISE
77
CONSULTATION
À Chengdu, un médecin
traditionnel prend le
pouls d’une patiente. Il
inspecte la langue et
examine des parties du
corps pour identifier
les symptômes, puis
prescrit le traitement
destiné à rétablir
l’équilibre du corps et
à évacuer la maladie.
Caption tk ipsem lorem
uis vend occab ipsam
res et et larum et lame
ipis ea que molor pore
pro blaceribus diosm
quis aspie brndan isa
adipsus cearu ptatemp
ossimil litatur sin pore
nulpa consequo berro
quae. Ucillori omll auda
dolorecus ul volporm
orum quat gium quiat.
À DROITE
À Chengdu, Ren Yanyu,
2 mois, est baigné dans
une solution à base de
plantes pour détoxifier
et refroidir son corps
durant les mois d’été
humides. Le traitement
participe de la philosophie chinoise qui vise à
préserver le bien-être
général du corps avant
que les affections
ne se déclarent.
CI�DESSOUS
Dans une clinique de
Beckley (États-Unis),
Jeff Hendricks
bénéficie d’une séance
d’acupuncture et
d’une technique de
combustion de plantes
(moxibustion) pour
atténuer des douleurs
dues à quatre années
de service militaire. Le
traitement, approuvé
par les associations
d’anciens combattants,
réduit les besoins
en médicaments
conventionnels.
80
N AT I O N A L G E O G R A P H I C
(suite de la page 77)
Les recherches de YungChi Cheng sont solidement ancrées dans le terrain scientifique. Il a conçu des traitements
antiviraux pour des maladies chroniques,
comme l’hépatite B. Il se demandait aussi si
d’autres traitements à base de plantes telles que
l’armoise n’attendaient pas d’être redécouverts.
L’un de ceux qu’il a trouvés pourrait s’avérer
capital dans le traitement des cancers.
Cheng ouvre un pot. Il me tend une pincée
d’une poudre baptisée PHY��� : « Goûtez. » J’en
dépose une pincée sur ma langue. C’est amer,
avec un soupçon de réglisse.
Dans les années ����, Cheng a observé que de
nombreux patients atteints d’un cancer interrompaient leur chimiothérapie à cause des effets
secondaires – diarrhée et nausées sévères,
notamment. Mais les patients qui achevaient
leur chimiothérapie vivaient en général plus
longtemps. Donc, s’est dit Cheng, la diminution
des effets secondaires pouvait augmenter l’espérance de vie. Il savait également que la médecine
chinoise traditionnelle propose de nombreux
remèdes phytothérapeutiques pour traiter la
diarrhée et les nausées. Sa collègue Shwu-Huey
Liu, une experte en chimie pharmaceutique qui
parle couramment le mandarin, a commencé à
éplucher l’énorme collection des textes médicaux chinois de la bibliothèque de Yale.
Dans un livre ancien, le Traité des atteintes
du froid, imprimé sur du papier de bambou, la
chercheuse a trouvé une médication vieille de
� ��� ans : un mélange de scutellaire, de réglisse,
de pivoine et de jujube, décrit comme traitant
« la diarrhée, les douleurs abdominales et les
chaleurs brûlantes dans l’anus ».
L’équipe de Yung-Chi Cheng s’est lancée dans
la préparation de différentes moutures de la formule. Ces vingt dernières années, les chercheurs
sont passés des tests sur les souris aux essais sur
des patients en cours de traitement anticancéreux, – le tout, sous la supervision de l’Institut
national du cancer des États-Unis.
Presque tous les patients ayant pris la préparation ont ressenti un soulagement de leurs
nausées et des désordres gastro-intestinaux.
Mais autre chose est arrivée : leurs tumeurs
se sont réduites plus vite que celles des patients
qui n’avaient pas pris la préparation. « Je ne
m’attendais pas à cela, concède Cheng. La
question était donc : pourquoi ? »
Deux acteurs essentiels de la fabrication des
médicaments anticancéreux (Johnson & Johnson
et Bristol-Myers Squibb) aimeraient également
connaître la réponse. Lors d’un salon pharmaceutique, à Philadelphie, j’écoute Peikwen, le fils
de Cheng, expliquer aux représentants de laboratoires ce que l’on sait du fonctionnement du
PHY���. Diplômé de Stanford et détenteur d’un
MBA, Peikwen, �� ans, a créé une société avec
son père pour commercialiser le PHY��� et élaborer d’autres remèdes phytothérapeutiques.
Vêtu d’un impeccable costume anthracite, et
maîtrisant le mandarin, la terminologie médicale et l’argot de la Silicon Valley, Peikwen sait
se montrer convaincant. Il établit un pont entre
les médecines occidentale et orientale. En analysant les tumeurs des souris ayant reçu la préparation, explique-t-il, les chercheurs ont observé
un développement significatif des macrophages
mangeurs de tumeurs – les globules blancs qui
phagocytent les cellules cancéreuses.
L’interaction entre les différentes plantes
semble jouer un rôle capital. « C’est vraiment là
que se situe la clé, affirme Peikwen. Le PHY���
est un cocktail de produits
(suite page 84)
MÉDECINE CHINOISE
81
ÉTAPES D’UNE
PHYTOTHÉRAPIE
1
2
DIAGNOSTIQUER LE PATIENT
Le praticien cherche à identifier la maladie d’un
patient en procédant à un examen complet,
avec prise du pouls et inspection de la langue.
Les empereurs
Ce sont les ingrédients
principaux. Ils ciblent les
causes et les symptômes
immédiats de la maladie.
RÉUNIR LES INGRÉDIENTS
Chaque patient est unique. Des personnes
présentant les mêmes symptômes peuvent
recevoir des prescriptions très différentes.
Les ministres
Ces plantes intensifient
les effets de l’empereur.
En parallèle, ils ciblent les
symptômes sous-jacents.
Les assistants
Ils traitent les symptômes
secondaires, éliminent les
toxines et optimisent les
effets des autres plantes.
Les guides
Pas toujours nécessaires
dans les prescriptions, ils
fournissent des principes
actifs aux zones ciblées.
PLANTE S DONT L’ A CTION
E S T SCIE NTIFIQU EMENT
ATTE STÉE POU R
Racine de réglisse CI RI
CI combattre l’infection
RI réduire l’inflammation
TF faire tomber la fièvre
Fruit du forsythia CI RI
Rhizome de roseau TF
Graine de bardane RI
GOÛT
EFFICACITÉ
Feuille de bambou CI RI TF
Graine de soja fermentée
Racine de platycodon CI
Fleur de chèvrefeuille CI RI TF
Fleurs de Schizonepeta CI RI
FORM
ULE D
U Y IN
Q IA O
Feuille de menthe CI RI TF
UN REMÈDE AU RHUME
Les prescriptions à base d’une ou plusieurs plantes sont une
composante essentielle de la médecine traditionnelle chinoise.
Elles sont personnalisées selon l’état du patient, son âge,
son sexe et sa morphologie. Est décrite ici la façon de préparer
le yin qiao, un mélange de dix plantes pour traiter le rhume.
LA THÉORIE DE L’ÉQUILIBRE
QUATRE PROPRIÉTÉS
Le corps consiste en des qualités opposées
mais complémentaires (yin et yang), qui lui
assurent un équilibre sain. On considère que
les traitements respectant les quatre propriétés et les cinq saveurs favorisent l’équilibre.
Les plantes sont qualifiées
de chaudes ou froides
selon leur capacité à traiter
des affections considérées
comme associées au froid
(yin) ou au chaud (yang).
Froid
Frais
Neutre
Tiède
Brûlant
3
4
ÉLABORER LA PRESCRIPTION
Selon la prescription, il existe diverses façons de
traiter une plante pour en extraire les propriétés
curatives et en obtenir la puissance requise.
Broyeur
médicinal
TRAITER LE PATIENT
Une prescription traditionnelle est conçue à la
fois pour cibler des parties spécifiques du corps
et pour rééquilibrer la totalité du système.
Point
d’acupuncture
C’est le pao zhi : les herbes
sont écrasées, torréfiées,
brûlées ou frites pour en
obtenir l’essence et en
éliminer les impuretés.
Méridien
Cheminement dans
le corps, à travers
lequel l’énergie est
censée s’écouler.
Traditionnel et artisanal
Le remède est pris dans un
bouillon ou un thé de racines
de roseau, ou appliqué sur
des points d’acupuncture.
Le broyeur s’utilise
parfois pour les plantes
molles (telle la menthe).
Mortier et pilon servent
pour les plantes dures.
Mortier
et pilon
Patch
Tisane
Les plantes sont bouillies,
parfois pendant des
heures, ce qui est réputé
amalgamer leurs
propriétés curatives.
Prêt à l’emploi et standardisé
Des remèdes génériques sont
vendus en pilules ou sachets,
mais les infusions de plantes
brutes seraient plus efficaces.
Bouilloire
Gélules
Poudre
CINQ SAVEURS
Des saveurs différentes ont
des propriétés curatives
spécifiques, et peuvent
cibler des zones du corps et
des organes particuliers.
Piquant
Stimule la
transpiration
et la circulation
sanguine
Salé
Favorise les
mouvements de
l’intestin.
Amer
Réduit la
température.
Sucré
Soulage la
douleur.
Acide
Arrête la transpiration, la toux
et la diarrhée.
MONICA SERRANO ET DAISY CHUNG, ÉQUIPE DU NGM ; MANYUN ZOU ; MEG ROOSEVELT. ILLUSTRATION : JIWOON PAK. CALLIGRAPHIE : JAMIE WU. SOURCES : CENTRE NATIONAL D’INFORMATION SUR
LES BIOTECHNOLOGIES DES ÉTATS-UNIS (NCBI) ; ZHANG WEI, INSTITUT CHINOIS DE MATERIA MEDICA, ACADÉMIE DES SCIENCES MÉDICALES CHINOISES ; LINN YEH CHING
(suite de la page 81)
chimiques, guère différent des cocktails chimiques qui ont fini par
se montrer efficaces pour les patients atteints
du sida. Nous ne faisons que décoder la formule
d’origine pour la recombiner en vue d’une thérapie moderne, scientifiquement fondée. »
À ce jour, le PHY��� a été utilisé dans huit
essais sur l’homme, en parallèle à plusieurs protocoles de chimiothérapie et de radiothérapie
traitant des cancers colorectal, du foie et du pancréas, explique Peikwen au public. « Nous espérons que le PHY��� sera le premier médicament
multiplantes approuvé par l’Agence des produits
alimentaires et médicamenteux (FDA). »
au cœur de la Chine,
dans un train à grande vitesse à la marche très
souple, comme flottant au-dessus de la voie. La
vieille Chine défile sous nos yeux, patchwork
sans fin de champs sous un ciel gris d’hiver.
Peikwen a accepté de me montrer la provenance des plantes, à condition de ne révéler ni
le nom des fermiers ni la localisation des exploitations. Ici, la Chine est plate, avec des champs
aux sillons nets et précis à perte de vue. Mais, au
milieu du blé, du riz et du colza, des milliers de
fermiers entretiennent des lopins de plantes.
Pour satisfaire la demande mondiale croissante en produits phytothérapeutiques, les agriculteurs chinois consacrent des surfaces de plus
en plus importantes à des centaines de plantes
médicinales. En Chine, le chiffre d’affaires du
secteur a atteint �� milliards d’euros en ����.
Mais attendez avant de plaquer votre boulot
pour vous lancer dans la culture des plantes. Car
il y a un hic : produire des plantes de qualité
médicinale est extraordinairement difficile. Le
pouvoir chimique de chaque plante varie grandement en fonction de nombreux facteurs : les
minéraux du sol, l’altitude, la période et le mode
de récolte. Et puis, il y a les sous-espèces qui
peuvent paraître identiques, mais ont des compositions chimiques légèrement différentes.
Demandez donc à un fumeur de joints la différence d’effet d’une variété de marijuana à l’autre.
Ou interrogez un planteur de café. En Éthiopie,
selon les régions, le taux de caféine des grains
d’arabica peut aller de un à six. Et la quantité de
caféine diffère aussi en fonction de la façon dont
les grains sont torréfiés et infusés.
C’est en partie à cause de ces complications
que la FDA a approuvé seulement deux prescriptions médicamenteuses à base de plantes : un
P E I KW E N E T MO I F O N Ç O N S
traitement des verrues génitales, à base d’extrait
de thé vert, et un remède contre la diarrhée, à base
de sang-dragon (latex d’un arbre d’Amérique du
Sud). Ces deux traitements font appel à une
seule plante chacun. Or le PHY��� en contient
quatre. Cela signifie qu’il faut contrôler plus de
variables pour obtenir un produit fiable.
Nous atteignons l’un des champs d’où sont
issus les ingrédients du PHY���. Je suis déçu.
Hormis le fait que l’agriculteur, Chen, s’exprime
en mandarin, nous pourrions aussi bien être
dans le Kansas. Chen porte des bottes boueuses,
une lourde parka et une casquette de base-ball.
Il sort son iPhone et fait traduire le nom chinois
de sa culture. Réponse : « pivoine ».
Nous effectuons le tour des champs de
pivoines et de scutellaires buissonnantes.
Chen nous explique la rotation des cultures, la
composition du sol et l’analyse de l’eau, les protocoles de plantation et de récolte. Avant d’expédier les plantes, ajoute-t-il, les techniciens de la
société taïwanaise Sun Ten (associée à Peikwen
SOIGNER PAR LE FEU
Dans un traitement des
douleurs articulaires
par le feu, un tissu
imbibé d’alcool qui
recouvre le patient est
enflammé pour
réchauffer la peau et
ouvrir les pores, avant
l’application d’une
huile de macération de
plantes. Le bien-fondé
de la méthode reste
cependant à évaluer.
et à son père) procèdent à de multiples tests pour
reconfirmer l’espèce. Ils dépistent les microorganismes, les toxines et les métaux lourds. Et
ils effectuent des tests qualitatifs.
« Vous connaissez l’expression “De la ferme à
la table”, dit Peikwen. L’idée, ici, c’est : de la
ferme à la table de chevet. » Je réplique que l’on
croirait un slogan publicitaire. Mais c’est la
vérité, assure Chen : « La plupart des fabricants
de remèdes phytothérapeutiques ne se fournissent pas dans des fermes comme celle-ci. Ils
s’approvisionnent à Bozhou. »
S I V O U S A C H E T E Z D E S P L A N T E S médicinales
chinoises sur Internet, elles seront sans doute
passées par Bozhou. Cette ville de l’est du pays
est le cœur de l’univers de la médecine chinoise.
Chaque jour, �� ��� courtiers y vendent des milliers de produits auprès de �� ��� acheteurs
d’Asie du Sud-Est. Tous ces gens s’entassent
dans une structure colossale évoquant un stade
de football recouvert d’un dôme.
Le matin où je visite Bozhou, le marché est
déjà une ruche bruyante. Le long d’allées interminables, je zigzague d’un étalage caverneux à
l’autre. Chacun est plein de fûts, de sacs, de
palettes et de brouettes débordant d’à peu près
toutes les plantes, les minéraux et les créatures
du globe – sans oublier les articles exotiques, tels
les pénis de daims, les placentas humains, les
os de buffles d’Asie et les hippocampes séchés.
La racine du ginseng, censée tout guérir,
occupe un secteur de la taille d’un supermarché.
Il y en a du rouge et du blanc, du sauvage et du
cultivé, du frais et du séché, à quelques euros
comme à plusieurs milliers. On trouve ici à peu
près tous les ingrédients imaginables, mais peu
d’éléments sur les lieux et modes de production.
Je repère aisément les quatre ingrédients du
PHY���. Cependant, les revendeurs ne savent
pas grand-chose de leur origine.
Avant de quitter le marché, tout près du secteur du velours du cerf, j’avise une boîte en verre
avec une rangée de bouteilles remplies d’un
liquide jaunâtre. J’interroge le vendeur, qui
demande à son voisin de traduire. « Pris à l’ours,
me dit ce dernier. Très bon. »
En tant que patron
du Visible Heart Lab, le laboratoire de l’université du Minnesota, il s’intéresse à leur physiologie unique et étudie leur mode d’hibernation.
Iaizzo énumère les mystères liés aux ours. Ils
peuvent rester totalement inactifs pendant six
mois, sans effets néfastes. Leur souffle tombe à
deux respirations par minute. Leur température
chute de �� � (ce qui serait une hypothermie
chez l’humain). Ils perdent plus de la moitié de
leur graisse corporelle, mais pas une once de
masse musculaire. Leur cœur peut cesser de
PAU L I A I Z ZO A D O R E L E S O U R S .
86
N AT I O N A L G E O G R A P H I C
battre pendant vingt secondes sans que leur
sang coagule. Mais, si un prédateur approche,
l’ours se réveille pour défendre ses petits. « Et
son cœur ne subit aucune lésion », précise Iaizzo.
La première mention de la bile d’ours dans
la littérature chinoise se trouve dans le Wai tai
mi yao (ou Secrets médicaux d’un fonctionnaire),
un traité en quarante volumes du ����e siècle.
Elle y est notamment prescrite pour les problèmes de foie, la fièvre et les hémorroïdes.
En ����, un chercheur suédois en a isolé l’un
des composants. L’acide ursodésoxycholique
entre aujourd’hui dans des médicaments contre
les hépatopathies et les calculs biliaires. Iaizzo
et d’autres pensent que la bile d’ours (produite
par le foie, stockée dans la vésicule biliaire et
CHAMPIGNON DE LABO
L’équipe de Yung-Chi
Cheng (université Yale)
cultive le champignon
Ganoderma tsugae, qui
réduit les tumeurs colorectales chez l’animal.
« Les Chinois utilisent
les plantes depuis des
siècles, observe Cheng.
Pour les scientifiques,
le défi est de trouver
sur quelles formules
travailler, et pourquoi. »
sécrétée sous forme d’hormone dans le sang)
recèle bien d’autres secrets. Ils espèrent s’en
servir contre les dystrophies musculaires et pour
les patients alités, qui peuvent perdre la moitié
de leur masse musculaire en trois semaines.
Iaizzo a identifié trois types de composants de
la bile d’ours susceptibles de déclencher l’hibernation, et d’aider les malades cardiaques : les
acides gras, les acides biliaires et les opioïdes de
type delta. Quand il a opéré le porc, il a injecté
un mélange synthétique de ces trois composants
dans la membrane protectrice du cœur, afin de
l’en enrober pendant une heure avant le prélèvement. Au fil de centaines d’expériences, il a vu
des cœurs de porcs (très semblables aux cœurs
humains) tenir jusqu’à deux fois plus longtemps
qu’ils ne font d’ordinaire hors du corps.
Les applications pour les humains sont nombreuses. En premier lieu, les cœurs des donneurs
pourraient rester viables plus longtemps et redémarrer plus vite au sein d’un récipient. Jusqu’à
présent, une transplantation cardiaque doit survenir six heures au maximum après l’extraction
du cœur. Des dizaines de patients en attente
d’un cœur décèdent chaque année en France.
« Si nous réussissions à préserver un cœur
[humain] vingt-quatre heures, nous pourrions
en obtenir n’importe où dans le monde, affirme
Paul Iaizzo. Le nombre d’organes disponibles
augmenterait de façon considérable. »
Je lui demande si boire de la bile d’ours est
vraiment bon pour la santé. « C’est possible »,
répond-il, car les constituants de la bile passent
dans le sang et se déplacent vers les organes.
Iaizzo n’approuve pas l’élevage des ours pour
leur bile. Il souligne que la synthèse des substances chimiques est possible. Mais la science
est la science. Et si les anciens Chinois ne comprenaient pas comment la bile d’ours aidait les
humains, ils observaient qu’elle agissait.
Le cœur du porc repose dans mes mains. Je
sens ses battements ralentir, puis s’interrompre
– des heures après la mort de l’animal. Sa couleur
semble se ternir. Alors je repense à cet instant :
je suis à l’hôpital, je tiens la main de mon père,
et je sens que son pouls a cessé de battre. Cela
me fait prendre conscience des contractions
de mon propre cœur dans ma cage thoracique
– un cœur toujours plein de mystères. c
Peter Gwin a écrit l’article sur la fauconnerie du
numéro d’octobre 2018. Fritz Hoffmann effectue des
reportages photo en Chine depuis vingt-cinq ans.
MÉDECINE CHINOISE
87
SANTÉ
LA MÉDECINE CHINOISE
S’INVITE À L’HÔPITAL
AC UP UNCT URE , Q I G O NG, M A S SAGE T U I NA … E N FR A N C E , D E P LU S E N P LU S
D’ÉTABLIS SEMEN T S P RO P O S E N T C E S S O I N S P O U R D E S I N D I C AT I O N S D I V E R S E S,
NO TAM M EN T LE S E FFET S SEC O N DA I R E S D E L A C H IMIO T H É R A P IE .
Au CHU de Lyon-Sud,
la Dr Marie Freichet
pratique l’acupuncture chez des
patients atteints de
cancer. Ici, Claude
vient pour réduire
la sécheresse
buccale consécutive
à son traitement.
Par Corinne Soulay • Photographies d’Emanuela Ascoli
U
ne, deux, trois… Bientôt, quinze
aiguilles de �� mm de long viennent
hérisser le pied droit de Christian,
�� ans. Puis, sa colonne vertébrale,
son buste, ses oreilles et même son
visage. Christian est atteint d’un
myélome, un cancer de la moelle osseuse, qui le
contraint à porter un corset. Il suit un traitement
d’acupuncture pour soigner les neuropathies
dues à sa chimiothérapie.
« Cela prend la forme de fourmillements douloureux sur les doigts et les pieds, explique le
Lyonnais. Taper à l’ordinateur était devenu une
souffrance et j’avais beaucoup de mal à dormir.
Je prenais un médicament six fois par jour, sans
succès. Et puis, j’ai essayé l’acupuncture et, au
bout de trois séances, ces sensations désagréables ont quasiment disparu. »
Pour trouver un praticien, Christian n’a pas
eu besoin d’aller très loin : depuis mars ����,
le CHU de Lyon-Sud (Hospices civils de Lyon),
où il est suivi, propose, un jour par semaine, des
consultations d’acupuncture pour les patients
atteints de cancer. C’est la Dr Marie Freichet qui
s’en occupe. Le reste du temps, elle travaille
comme médecin urgentiste au service de réanimation. En ����, elle a suivi une formation à la
faculté de médecine du Kremlin-Bicêtre et a
obtenu un diplôme interuniversitaire d’acupuncture scientifique.
« La médecine allopathique traite les symptômes et réduit le patient à son corps fait de
cellules, d’os et d’eau. J’avais besoin d’une
approche plus globale de la santé, confie-t-elle.
La médecine chinoise, à laquelle appartient
l’acupuncture, prend en compte l’individu dans
son intégralité. » Cette méthode part notamment
du principe que les organes sont reliés les uns
aux autres par une énergie – le qi – qui circule
à travers des canaux – les méridiens. « Lorsque
je pique à un endroit, il y a un effet antalgique
local, mais cela peut aussi agir à distance sur
d’autres organes », précise la docteure.
En ce vendredi de novembre, les patients
défilent pour se faire piquer. Dix-sept rendezvous sont prévus entre � heures et �� heures.
Axelle, grande brune de �� ans à qui on a
90 N A T I O N A L G E O G R A P H I C
diagnostiqué un lymphome à la fin de ����, vient
pour de fortes céphalées. Claude, �� ans, atteinte
d’un cancer ORL et d’un cancer du poumon,
consulte pour une sécheresse buccale extrême,
qui l’oblige à avoir en permanence une bouteille
d’eau à la main. Quant à Véronique, �� ans,
traitée pour deux cancers successifs de l’œil, elle
a dû s’alimenter de repas liquides pendant
six mois à la suite de vomissements violents.
Quelques séances d’acupuncture lui ont permis
de se réalimenter normalement. Elle vient
aujourd’hui pour accélérer la repousse de ses
cheveux et retrouver de l’énergie.
« L’acupuncture n’est pas utilisée comme une
médecine alternative, qui remplacerait les thérapies classiques du cancer, insiste la docteure.
C’est une médecine complémentaire, qui cible
les effets secondaires des traitements anticancéreux. » Les indications sont multiples : nausées, fatigue, douleurs… dues à la chimiothérapie.
L’acupuncture aiderait aussi à limiter les brûlures des radiothérapies et, dans le cas de
l’hormonothérapie utilisée pour les cancers
gynécologiques, à réduire sueurs nocturnes et
insomnies. « L’objectif est d’abord que les
patients se sentent mieux, indique la Dr Freichet.
En outre, si ces derniers supportent davantage
leur chimiothérapie ou leur radiothérapie, on
ne sera pas obligé d’en réduire les doses, ce qui
permettra d’optimiser leur efficacité. »
de plus en plus d’hôpitaux se piquent de médecine chinoise. On
retrouve de l’acupuncture au CHU de Nantes,
pour la prise en charge de la douleur ; du qi gong,
une pratique fondée sur des mouvements lents
visant à harmoniser l’énergie vitale, à l’Institut
Gustave-Roussy de Villejuif ; et un service entier
dédié à la médecine chinoise au centre hospitalier Alès-Cévennes.
« Ce type de consultations se développent,
mais il est compliqué d’en dresser une liste
exhaustive, car elles ne relèvent pas d’une politique de santé organisée : la plupart du temps,
il s’agit d’initiatives individuelles au sein des services », souligne le Pr Alain Baumelou, nephrologue à l’hôpital de la Pitié-Salpêtrière AP-HP.
DA N S T O U T E L A F R A N C E ,
L’acupuncture est
utilisée pour traiter
les neuropathies
entraînées par la
chimiothérapie. Elles
se caractérisent par
des fourmillements
ou tiraillements
douloureux, souvent
localisés dans les
doigts et les pieds.
Bercé à la médecine allopathique, le professeur
a pourtant pris la tête du Centre intégré de médecine traditionnelle chinoise, créé en ���� au sein
de l’établissement parisien.
« La médecine chinoise est un système de santé
global, qui comprend l’acupuncture, des techniques corps-esprit comme le qi gong ou le taichi-chuan, de la nutrition, de la phytothérapie,
des massages énergétiques, énumère-t-il. Notre
objectif est de valider scientifiquement ces pratiques. Pour notre médecine conventionnelle,
il est difficile de comprendre le fonctionnement
de ces thérapies. Mais de plus en plus de patients,
souvent parce qu’ils développent une défiance
par rapport aux médicaments, se tournent vers
cette médecine et sont satisfaits : c’est une raison
suffisante pour s’y intéresser. »
À l’hôpital de la Pitié-Salpêtrière, ces thérapies complémentaires sont utilisées dans de
nombreux domaines. « C’est intéressant pour les
femmes enceintes, qui ne peuvent pas prendre
beaucoup de médicaments, pointe Stéphanie
Nicolian, une sage-femme qui pratique l’acupuncture dans le service de gynécologie obstétrique. Notre étude, menée sur ��� patientes,
doit bientôt être publiée. Non seulement celles
qui ont reçu de l’acupuncture en plus des soins
classiques (conseils d’étirement, paracétamol…)
ont vu leurs douleurs lombo-pelviennes diminuer de moitié par rapport aux autres, mais les
résultats ont aussi montré que cela coûtait
moins cher à la société, car ces femmes posaient
moins d’arrêts de travail. »
Outre les douleurs, l’acupuncture est indiquée
dans les troubles du transit, les insomnies, les
nausées, l’anxiété, l’arrêt du tabac... « Il nous faut
désormais comprendre quelle est la part de
l’effet placebo dans son efficacité, confie la sagefemme. Pour ce faire, nous avons lancé une
étude en lien avec des hôpitaux de Strasbourg,
de Caen et de Colombes. » Le principe : soumettre
un groupe de femmes à un protocole d’acupuncture classique et un autre à une « fausse » acupuncture, en piquant des zones a priori inactives
avec des aiguilles rétractables.
Toujours à la Pitié-Salpêtrière, dans l’unité
d’addictologie, c’est le qi gong qui est évalué.
« Au moment du sevrage, et ce, durant douze
semaines, les patients suivent des séances régulières pour réduire le craving, c’est-à-dire l’envie
impérieuse de consommer le produit, détaille
le Pr Baumelou. C’est un essai multicentrique,
que nous menons avec des hôpitaux à Strasbourg,
à Nice, à Montpellier et à Bordeaux. »
Au service de neurologie, les patients atteints
de la maladie de Parkinson à un stade modéré
peuvent tester le tai-chi-chuan pour améliorer
leur équilibre et limiter les chutes, tandis qu’en
pédopsychiatrie, les adolescents bénéficient
de tui na, des massages énergétiques, pour
réduire leur stress et leur anxiété.
« Je mise beaucoup sur les avancées en neurosciences pour lever le voile sur les processus à
l’œuvre dans la médecine chinoise, indique le
Pr Baumelou. Cela permettrait à ces pratiques
d’intégrer plus largement nos hôpitaux. » c
MÉDECINE CHINOISE
91
DÉCOUVERTE
The Shard (« le tesson »),
le plus haut immeuble de
Londres, domine la ville et
éclipse d’anciens emblèmes
tels que Tower Bridge. Plus
de soixante-dix gratte-ciel
sont en construction et
vont redessiner davantage
encore le paysage urbain.
LONDRES
DANS LE FLOU
ENTRE UNE DÉMOGRAPHIE
G A L O P A N T E E T L ’A P P R O C H E
D U B R E X I T, L A V I L L E - M O N D E
P O U R R A -T- E L L E R E S T E R A U T O P ?
RÉNOVATION URBAINE
King’s Cross, un ancien
quartier d’entrepôts
sordide, est devenu un
modèle de rénovation.
À Granary Square, les
bords du canal invitent
à la flânerie et une
université apporte un
souffle de jeunesse.
PROJET DE LUXE
Clé de voûte d’un projet
de rénovation de 200 ha,
le long de la Tamise,
l’ex-centrale électrique
de Battersea abritera
des bureaux et des
appartements. Mais des
détracteurs estiment
que le projet est trop axé
sur le luxe, dans une ville
où les logements à prix
abordables manquent.
PA R L AU RA PA R K E R
P H O T O G R A P H I E S D E LU C A LO C AT E L L I
Les jardins
botaniques royaux
de Kew sont lovés
dans une boucle de
la Tamise, à 11 km
en amont du centre
de Londres.
Les milliers de plantes prélevées aux confins de
l’Empire britannique offrent un répit bucolique,
loin de l’asphalte et des pots d’échappement.
Pourtant, même à Kew, on n’échappe pas totalement au tumulte de la vie moderne : les jardins
se trouvent juste en dessous des couloirs aériens
de l’aéroport d’Heathrow. Tandis que j’admire
un vieux chêne imposant, transplanté du massif
de l’Elbourz, en Iran, sous le règne de la reine
Victoria, un flux d’avions alignés dans le ciel descendent l’un après l’autre vers l’aéroport à deux
pistes le plus fréquenté de la planète.
À certaines heures de la journée, « c’est comme
des abeilles autour d’un pot de miel », selon la
formule d’un pilote de ligne. Des abeilles autour
d’un pot de miel : Londres est plus grande et plus
98
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
SERRES ROYALES
Les jardins botaniques
royaux de Kew ont plus de
250 ans. Ils possèdent parmi
les plus belles serres du
monde. La Temperate
House, de style victorien,
abrite 1 500 espèces, dont
la cycalade E. woodii, un
arbre originaire d’Afrique
du Sud éteint dans la nature.
riche que jamais, avec plus de �,� millions
d’habitants, auxquels devraient s’ajouter � millions d’âmes à l’horizon ����.
Trente ans de hausse démographique ont bouleversé Londres. La grande dame sur le déclin
est devenue une éminente ville mondiale et une
place financière de premier plan, dont l’économie est l’une des plus vigoureuses de la planète.
Cette croissance a engendré une vague de
construction, avec certains des plus vastes projets de réhabilitation d’Europe. La Tamise bénéficiera d’un nouveau « super-égout », qui passera
sous son lit, empêchant les eaux usées non traitées de se mêler aux marais intertidaux. La silhouette de Londres sera redessinée, avec l’ajout
de plus de ��� hauts immeubles, dans une ville
qui s’est longtemps défiée des gratte-ciel. Le
métro à grande vitesse Crossrail, qui a coûté près
de �� milliards d’euros, a été conçu pour désengorger le métro de Londres (le plus ancien du
monde), surchargé. Il doit ouvrir l’Elizabeth Line
à la fin de ����, avec �� stations, dont �� nouvelles.
Cette ligne doit améliorer la liaison entre l’Ouest
londonien et l’Est, en plein développement, et
diviser par deux certains temps de trajet.
Des parties de la ville sont de nouveau reliées
entre elles, à mesure que des friches industrielles
se muent en quartiers privilégiant les piétons et
l’espace public, et favorisant les entreprises
locales plutôt que les chaînes de magasins.
King’s Cross, un ancien entrepôt ferroviaire de
stockage de charbon et de
(suite page 103)
LONDRES
99
L’OMBRE D’UN GÉANT
Dans la City, le quartier
des affaires, au pied du
gratte-ciel 30 St Mary
Axe, l’église St Andrew
Undershaft est un édifice
médiéval exceptionnel,
qui a survécu
à l’incendie de 1666
et à la guerre.
ÉQUILIBRER LA CROISSANCE
ROYAUMEUNI
La capitale, dynamique, poursuit son essor, à la fois en nombre
d’habitants et en construction de tours. Les urbanistes
s’efforcent de préserver le caractère historique de la ville,
tout en cherchant à répondre aux besoins du futur.
Une démographie en hausse
Londres
La ceinture verte
Après la Seconde Guerre mondiale, des milliers
d’habitants ont fui la capitale pour la banlieue.
La population de Londres a finalement dépassé
son niveau d’avant-guerre en 2015. Désormais,
la ville gagne 70 000 habitants par an.
La bande de terrains non bâtis instaurée en 1935
autour de la ville afin d’empêcher l’étalement
urbain s’est agrandie depuis. Faut-il en aménager
certaines parties pour construire de nouveaux
logements ? Le débat se poursuit.
����
��� millions
����
��� millions
8 millions d’habitants
Ceinture verte
Parcs
8
20 km
0
6
����
��� millions
GRAND
LONDRES
4
Tamise
1 572 km2
ZONE AGRANDIE
CI-DESSOUS
2
IRE GUERRE 2DE GUERRE
MONDIALE MONDIALE
GRANDE FAMINE
���� EN IRLANDE
� million
����
����
����
EXPANSION
DE L’UE
����
CEINTURE VERTE
près de 5 180 km2
����
Le respect de l’histoire
À Londres, 510 immeubles hauts d’au
moins 20 étages sont en projet, dont
70 gratte-ciel. Les règles d’urbanisme
préservent certains monuments
historiques en empêchant les édifices
nouveaux d’en boucher leur vue.
Alexandra
Palace
(Perspective protégée)
Haute vallée
de la Lee
Axe
Achevé en 2017
En construction
Permis accordé
vue
Étape de construction
Les habitants de Richmond affirment
que les constructions à Stratford
dégradent la vue sur la cathédrale
Saint-Paul depuis King Henry’s Mound.
de la
Kenwood
House
Parliament Hill
Héritage
olympique
En attente de permis
Les gratte-ciel de Londres
STRATFORD
King’s CrossSt Pancras
Primrose Hill
City
Fringe
� The Shard—310 m
� One Canada Square—235 m
Paddington
� Heron Tower—236 m
Cathédrale
Saint-Paul
� 122 Leadenhall Street—225 m
Serpentine
Bridge
� 8 Canada Square—200 m
� 25 Canada Square—200 m
� The Scalpel—190 m
�
�
30 St Mary Axe—180 m
T
RICHMOND
King Henry’s
Mound
RICHMOND
PARK
�
��
City
Hall
Ile aux
Palais de Westminster
Tower 42—183 m
� St George Wharf Tower—181 m
10
�
� 10
� �
Tour de Londres
e
amis
Westminster
Pier
Vauxhall, Nine Elms
et Battersea
chiens
Péninsule de
Greenwich
�
Blackheath Point
Greenwich Park
Zones comportant des
friches industrielles visées
par le réaménagement.
0
1 km
JAMES CHESHIRE ET OLIVER UBERTI
SOURCES : MINISTÈRE DU LOGEMENT, DES COMMUNAUTÉS ET DU GOUVERNEMENT LOCAL DU ROYAUME-UNI ; BUREAU DES STATISTIQUES NATIONALES ;
LONDON VIEW MANAGEMENT FRAMEWORK ; AUTORITÉ DU GRAND LONDRES ; NEW LONDON ARCHITECTURE ; AGENCE SPATIALE EUROPÉENNE
(suite de la page 99)
céréales, plus connu ces
derniers temps pour la prostitution et les stupéfiants, termine ainsi sa mue qui aura duré vingt
ans. Le quartier englobe les nouvelles gares de
King’s Cross et de Saint-Pancras (le terminus de
l’Eurostar), un nouveau campus pour une école
des beaux-arts et de design, des salles de concert,
des fontaines, ainsi que des appartements – haut
de gamme ou abordables.
À l’automne dernier, Google a posé la première pierre d’un « gratte-terre » (gratte-ciel
horizontal) de onze étages. Plus long que les
��� m de haut du Shard (l’immeuble le plus élevé
de Londres), il pourra accueillir � ��� employés
environ. Et Facebook prévoit de s’installer à côté,
dans des locaux pour � ��� personnes.
À � km de là, Apple occupera la chaufferie de
l’ancienne centrale électrique de Battersea.
Repensé, ce bâtiment historique sera la pièce
maîtresse du quartier huppé de Nine Elms. Le
secteur sera agrémenté d’un parc inspiré de la
High Line new-yorkaise et, avec le New Covent
Garden Market (le plus grand marché de gros de
fruits, légumes et fleurs), il ambitionne d’être le
futur « quartier des restaurants » de la ville.
L’investissement de Google et d’Apple dans
des sites aussi vastes et caractéristiques est jugé
comme un vote de confiance dans la stature de
Londres en tant que pôle technologique.
britannique s’est
accompagnée du lot habituel de maux urbains
et, ceux-ci empirant, beaucoup se demandent
si leur belle ville n’est pas en train de perdre une
partie de son attrait. La circulation automobile
est calamiteuse. La pollution de l’air est rendue
responsable de la nette hausse des décès dus à
l’asthme chez les enfants et les personnes âgées.
Le coût du logement a suivi l’augmentation
des prix du foncier et devient inaccessible au
Londonien moyen. Même des cadres bien rémunérés doivent quitter la ville avec leurs enfants,
en quête d’endroits à la portée des familles.
Enfin, dans ce qui pourrait se révéler un revers
de fortune, la confusion liée au Brexit a donné
lieu à de sombres diagnostics, selon lesquels
la phase de prospérité est terminée.
« Le Brexit, qui coïncide avec une forte instabilité mondiale, a jeté une certaine incertitude
sur ce qui semblait être une trajectoire de croissance régulière », note Richard Brown, directeur
de recherche au Centre for London, un groupe
de réflexion progressiste. La vague de prospérité
L A P R O S P É R I T É D E L A C A P I TA L E
finira-t-elle en récession ? Londres peut-elle relever ses défis tout en restant un centre financier
majeur et un lieu attrayant où vivre ?
On peine à imaginer que la ville soit au bord
de la débandade. Les grues continuent de tournoyer au-dessus de la cité et les arrivants affluent
quotidiennement. En outre, ce pronostic sousestime les atouts historiques ancrés dans l’ADN
de Londres et qui ont permis à ce conglomérat
de villages de traverser � ��� ans d’histoire.
Les Londoniens aiment évoquer la résistance
de leur ville. Ils rappellent naturellement qu’elle
a survécu à la peste, au grand incendie de ����
et aux bombardements allemands durant la
Seconde Guerre mondiale – autant de preuves,
selon eux, qu’elle surmontera les difficultés
actuelles, y compris le divorce d’avec l’Europe.
« Londres occupe une situation privilégiée,
elle est quasi intouchable, assure Peter Griffiths,
de la London School of Economics. Elle est
tellement en avance sur d’autres métropoles
qu’elle peut s’autoriser des choses que ces
dernières ne peuvent pas se permettre. »
L’anglais est la langue universelle. Des relations tissées lorsque l’Empire britannique était
la capitale d’un quart de la planète ont perduré.
Et ne sous-estimons pas le fait que ce sont les
Britanniques qui ont découvert comment mesurer la longitude, permettant ainsi aux marins de
calculer les fuseaux horaires de la planète.
Londres se trouve au centre du monde parce
qu’elle s’y est placée quand elle a tracé le méridien origine, là où l’est rencontre l’ouest.
a été aussi
importante remonte à ����. Sa population atteignait alors �,� millions d’habitants. Et, pendant
l’essentiel du ���e siècle, à l’ère industrielle,
elle fut la ville la plus peuplée du monde.
Mais la Seconde Guerre mondiale l’a laissée
en ruines. Ceux qui n’avaient pas fui le Blitz
(�� ��� civils tués, �� ��� bâtiments détruits)
ont fui plus tard le chaos de la reconstruction.
Ils se sont réinstallés dans des « villes-jardins »,
qui sont devenues les banlieues actuelles.
Puis, l’industrie manufacturière a volé en
éclats. Les docks de ce qui avait été le plus grand
port du monde, victimes de la modernisation
du transport maritime, ont dû fermer. La mort
de l’ex-Premier ministre Winston Churchill,
en ����, a marqué « la dernière fois que Londres
serait la capitale du monde », selon l’hebdomadaire The Observer. La population londonienne
LA DERNIÈRE FOIS QUE LONDRE S
LONDRES
103
a poursuivi son déclin, atteignant son point le Londoniens n’utilisent même pas le mot « gratteplus bas en ����, avec �,� millions d’habitants. ciel ». Ils préfèrent le terme technique « tall
Mais le destin de la capitale britannique avait buildings �hauts bâtiments] », c’est-à-dire des
basculé deux ans auparavant, avec la dérégle- immeubles d’au moins vingt étages.
mentation des services financiers et le passage
The Cheesegrater (officiellement, Leadenhall
aux échanges interbancaires électroniques. Ces Building) doit son surnom de râpe à fromage à
deux facteurs ont permis à Londres de rivaliser son sommet en forme de coin. La tour respecte
avec Tokyo et New York. Canary Wharf, un nou- ainsi les « vues protégées » de Londres – un arrêté
veau quartier financier, s’est élevé sur les ruines interdit de boucher la perspective sur certains
des West India Docks, sur l’Île aux chiens, une monuments historiques. Avec cinquante-deux
excroissance marécageuse de la Tamise. Il est étages, c’est le deuxième plus haut immeuble
devenu le premier projet de rénovation moderne du Square Mile, alias la City, le premier quartier
à grande échelle de la ville.
financier de Londres.
Les immigrants et les investissements étranNous contemplons le Gherkin (« cornichon »),
gers ont afflué, et Londres s’est distinguée par le Walkie-Talkie et, juste à côté, la cathédrale
trois décennies de croissance. La capitale s’est Saint-Paul qui, haute de ��� m, a dominé la capimise à attirer de jeunes et
tale pendant plus de deux
brillants travailleurs
siècles. Environ ��� des
Près de 40 % des
intellectuels du monde
��� grands immeubles en
habitants de Londres
entier, qui ont modifié la
projet sont déjà en chansont nés à l’étranger,
physionomie de la ville.
tier. D’ici à ����, la liste de
dont 500 000 Indiens,
Près de �� � des habitants
tours à surnoms s’allonde Londres sont nés à
Pakistanais et Bangladais, gera, avec notamment la
l’étranger, et on y parle
Fleur, le Vase et le Jambon
et de nombreux Français.
��� langues.
en boîte.
La capitale du RoyaumeNous regardons la ville
Uni compte quelque ��� ��� Indiens, plus de s’étendre à perte de vue, entrecoupée par les
��� ��� Pakistanais et autant de Bangladais. méandres de la Tamise. Peter Murray désigne
Avec l’élargissement de l’Union européenne, des l’Est : c’est là que sont bâtis ��� des nouveaux
centaines de milliers de personnes y ont immeubles, le deuxième ensemble le plus dense
convergé. Quelque ��� ��� Polonais y vivent. se trouvant dans le centre. Mais seuls quelquesQuant aux restrictions visant les travailleurs uns seront de véritables gratte-ciel. La plupart
issus de Roumanie et de Bulgarie (les pays les compteront entre vingt et trente étages. L’avenir,
plus pauvres de l’Union), elles ont été levées en dit l’architecte, repoussera l’aménagement
����, et ceux-ci sont désormais près de ��� ���. urbain vers les arrondissements extérieurs,
Officiellement, �� ��� Français vivent aussi à organisés autour des gares et des stations de
Londres, bien que d’autres estimations avancent métro. Cela créera de multiples centres où les
le chiffre de ��� ���. Résultat, Londres a officiel- gens pourront vivre, travailler et faire leurs
lement battu son record de ���� au début de ����, courses – et dire adieu aux longs trajets jusqu’au
en enregistrant son � ��� ���e habitant.
centre de Londres.
Mais, du haut de notre perchoir, nous ne
P O U R O B T E N I R U N E V U E d’ensemble de la ligne
distinguons pas la Green Belt, juste au-delà de
d’horizon changeante de la ville, je suis montée l’horizon. Cette immense ceinture verte fut créée
en haut du Cheesegrater (« râpe à fromage ») – les dans les années ���� pour limiter l’expansion de
Londoniens aiment à donner un surnom à leurs Londres. Elle est aujourd’hui trois fois plus vaste
gratte-ciel. Peter Murray, un architecte qui dirige que la ville qu’elle encercle. Mais elle a contraint
New London Architecture, un forum consacré les promoteurs à passer par-dessus.
au design, m’accompagne. Encore constituée
Certains y voient aujourd’hui un étau qui se
pour l’essentiel de bâtiments peu élevés, Londres resserre toujours davantage autour de la taille
affiche l’une des densités urbaines les plus de Londres. Cette ceinture comprend des
faibles d’Europe. Lorsque les métropoles ont espaces verts, mais aussi des terrains de golf,
commencé à ériger des gratte-ciel, dans les des fermes, et même des friches industrielles et
années ����, Londres ne s’est pas extasiée. Les des chantiers abandonnés.
(suite page 106)
104
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
MESURES DE PROTECTION Deux mesures des années 1930 destinées à limiter la croissance urbaine restent
en vigueur. Une ceinture verte (ci-dessous, à Redbridge) a été instaurée, que certains voudraient exploiter
pour des projets immobiliers. Et un arrêté sur les « vues protégées » veille à ce que des perspectives sur des
monuments (dont celle depuis Greenwich Park, ci-dessus) ne soient pas bouchées par de nouveaux édifices.
(suite de la page 104)
On estime qu’environ
� � seulement de ce territoire sont accessibles
au public. Pourtant, l’idée que la Green Belt est
la solution aux problèmes de logement londoniens se répand. Mais la construction y est très
restreinte. Seules certaines infrastructures,
telles que des routes, ont été autorisées dans la
ceinture verte. Déclarer qu’on souhaite l’ouvrir
aux promoteurs constitue un suicide politique.
Peter Murray préfère ce qu’il appelle la « planification intelligente » autour de la ceinture.
« Mais cela ne veut pas dire se lâcher complètement », précise-t-il.
loyers et des impôts sur les sociétés, en plus du
changement des habitudes de consommation
en matière d’alcool.
Le maire a aussi apporté son soutien à la campagne en vue de désigner Londres comme la première « ville parc national » du monde. Elle abrite
�,� millions d’arbres et plusieurs grands parcs.
Daniel Raven-Ellison, géographe et « explorateur
National Geographic », est à l’origine du projet.
L’idée, dit-il, n’est pas d’encombrer la ville avec
de nouvelles réglementations, mais d’encourager les Londoniens à s’intéresser davantage à
l’environnement de la capitale, qui abrite, précise-t-il, �� ��� espèces d’animaux et de plantes :
F I L S D ’ U N C H A U F F E U R D E B U S pakistanais,
« Un enfant sur sept ne s’est pas rendu dans un
Sadiq Khan a été élu maire de Londres en ����. espace vert au cours de la dernière année. Il faut
La croissance y était alors
un changement culturel
deux fois plus rapide que
et une remise en question
Londres a besoin de
dans le reste du pays.
de la façon dont les gens
66 000 nouveaux
conçoivent leur rapport
Le Brexit a été voté un
logements par an pour
mois plus tard. Une écraà la nature. »
sante majorité des élecLa tâche la plus redousuivre le rythme de
table
qui attend Sadiq
teurs londoniens avaient
la croissance, selon
souhaité demeurer
Khan est le logement. Il a
le maire Sadiq Khan.
dans l’UE. Ailleurs en
brigué la mairie en penAngleterre et au pays de
sant que l’élection serait
Galles, le vote a reflété une réaction violente face aussi un référendum sur le logement abordable.
à l’immigration et un ressentiment envers la À sa prise de fonction, il a annoncé que Londres
prospérité de la capitale, qui ne s’était pas diffu- avait besoin de �� ��� nouveaux logements par
sée dans le reste du pays.
an rien que pour suivre le rythme de la croisLondres n’est sans doute pas en mesure de sance. Il a promis que �� � de ceux-ci seraient
rivaliser avec le taux de croissance des mégalo- « réellement abordables ». En réalité, la plupart
poles d’Asie et d’Afrique. Selon une étude, Lagos, des arrondissements ne visent que �� �.
Le maire a obtenu plus de � milliards d’euros
au Nigeria, gagne en ce moment �� nouveaux
habitants par heure, contre � pour Londres. Mais du gouvernement pour construire ��� ��� logecela représente encore environ �� ��� per- ments à prix abordable d’ici à ����. Beaucoup
sonnes par an. Une croissance démographique admirent les ambitions de Sadiq Khan sur ce
qui, selon le « plan pour Londres » de Sadiq Khan, plan, mais pointent les limites de son mandat :
devrait se poursuivre jusqu’au milieu du siècle. s’il fixe des objectifs stratégiques pour la ville,
Le maire s’attaque à tout ce qui menace l’habi- c’est aux trente-trois conseils d’arrondissements
tabilité de Londres. Son cabinet produit des nou- d’approuver les propositions d’aménagement
veaux programmes en série. Pour atteindre son concernant leur territoire.
objectif climatique (que Londres devienne « zéro
« Malgré une succession de projets visant à
carbone » d’ici à ����), il imagine une ville avec construire davantage de logements, le rythme
moins d’automobiles, davantage de vélos et de de construction est loin de suivre la croissance
piétons. Il veut convertir les bus à l’électricité et démographique », observe Tony Travers, de la
interdire la vente de nouvelles voitures diesel.
London School of Economics.
Ses initiatives vont jusqu’à chercher comment
Mais il faut essayer, martèle Jules Pipe, l’un
améliorer la sécurité des enfants sur le chemin des dix adjoints de Sadiq Khan : « Si nous privons
de l’école ainsi que celle des femmes, la nuit. des pans de la société de la possibilité de vivre
Sadiq Khan a même un projet pour sauver les et de faire la navette à prix abordable dans la
pubs historiques de Londres, qui ferment à un capitale, alors la capitale tout entière commen(suite page 110)
rythme inquiétant à cause de la hausse des cera à échouer en tout,
106
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
LE RENOUVEAU DE KING’S CROSS Le projet de rénovation de King’s Cross comprenait la restauration
de vingt édifices historiques, ainsi que l’ajout de nouvelles constructions sur le site de 27 ha. Une touche
de modernité orne la façade originelle de la gare de King’s Cross, où passent 47 millions de voyageurs par an.
L’arrivée de Google et de Facebook devrait consolider le statut de centre technologique du quartier.
LOGER SUR LES CANAUX
Grâce à un réseau de
canaux de 150 km (ici,
Regent’s Canal), les
péniches sont devenues
une réponse au coût des
loyers à terre. Mais les
possesseurs de bateaux
font face à la hausse
des taxes d’amarrage,
ainsi qu’à de nouvelles
restrictions limitant
l’accès aux canaux.
L’extension des transports publics
Mis en service en 2007, le réseau ferroviaire Overground s’est étendu jusqu’à
des zones au sous-sol sableux où les tunneliers du métro ne pouvaient pas passer.
L’Elizabeth Line (Crossrail), longue de 117 km, va relier l’Est à l’Ouest, via le centre
de Londres. Son ouverture, prévue en 2019, devrait désengorger le métro.
Une ligne Crossrail 2, sur l’axe Nord-Sud, est également envisagée. De nouvelles
stations de métro sont prévues dans des quartiers en plein essor, tel Battersea.
EXTENSION DE
L’OVERGROUND
EN 2015
Shenfield
MÉTRO DE
LONDRES
O
V
ER
GR
UN
O
D
ISLINGTON
HACKNEY
Highbury & Islington
Vers
Reading
E L I Z ABE
( C RO
S SRA
IL)
SOUTHWARK
Battersea
Le prix des logements près des
nouvelles stations Crossrail a grimpé
de 22 % entre 2014 et 2016, contre
13 % de hausse pour le Grand Londres.
Abbey
Wood
LEWISHAM
0
CROSSRAIL 2
(Proposed)
(en
projet)
Prix médian et nombre de logements vendus
à moins de 1 km d’une gare
4 km
EXTENSION DE
����
OVERGROUND
L’OVERGROUND
EXTENSION
EN
2010
>750 ventes
500–749
250–499
Prix médian en milliers de $
350 450 550 650 750
Highbury
and Islington
New Cross Gate
EXTENSION
���� DE
L’OVERGROUND
OVERGROUND
EN
2012
LINK
Aéroport
d’Heathrow
Le rail stimule l’immobilier
Tamise
TOWER
HAMLETS
INE
TH L
Dalston
Junction
Shoreditch
Hoxton High St.
Shadwell
Rotherhithe
Surrey
Quays
New Cross
Gate
2006
Canonbury
Haggerston
Whitechapel
Wapping
Canada Water
2016
ISLINGTON
HACKNEY
(suite de la page 106)
qu’il s’agisse du maintien de la propreté ou d’avoir un nombre suffisant de médecins à l’hôpital. »
est de plus en plus considéré comme un îlot pour les touristes internationaux, les oligarques russes et les princes
saoudiens, qui semblent ne passer que quelques
semaines par an dans leurs propriétés valant
plusieurs millions d’euros. Simon Jenkins, journaliste et ex-président du National Trust, voit
le centre de Londres devenir un marché où
investir plutôt qu’un lieu où les gens résident
vraiment : « Ils veulent juste placer leur argent
et partir, comme si la ville était devenue une
banque. Ces tours d’appartements de luxe ne
sont que des lingots d’or. »
L E C E N T R E D E LO N D R E S
JAMES CHESHIRE ET OLIVER UBERTI
SOURCES : TRANSPORT FOR LONDON ; HM LAND REGISTRY (CADASTRE)
TOWER HAMLETS
SOUTHWARK
LEWISHAM
L’un des effets secondaires du statut de villemonde est d’attirer la richesse, affirme Trevor
Abrahmsohn, agent d’immobilier de luxe. La
famille royale du Qatar possède plus de biens à
Londres que la famille royale britannique, dont
le grand magasin Harrods, la majorité du Shard,
l’immeuble de l’ex-ambassade américaine à
Grosvenor Square (bientôt converti en hôtel de
luxe), �� � de l’aéroport d’Heathrow et une
partie de Canary Wharf. « Quand le chah d’Iran
a été chassé, rappelle Abrahmsohn, sa première
escale a été Londres. Quand les Nigérians se sont
enrichis grâce au pétrole, ils ont acheté à Londres.
Quand les Indiens ont fait des affaires avec les
Nigérians, ils ont acheté à Londres. Quand le
mur de Berlin est tombé, les Russes ont acheté
et, maintenant, c’est au tour des Chinois. »
Le projet d’aménagement de Battersea-Nine
Elms s’étend sur plus de ��� ha, le long de la rive
sud de la Tamise. À tort ou à raison, il est considéré comme un lieu où s’amassent les comptes
en banque. On l’a surnommé Dubai-on-Thames
(« Dubai-sur-Tamise »), car la première série
d’appartements a été vendue essentiellement à
des étrangers. Mais ce projet illustre aussi pourquoi les objectifs du maire en matière de logement seront peut-être si difficiles à atteindre.
La centrale électrique de Battersea, l’un des
plus grands bâtiments en brique du monde, a
longtemps été l’un des monuments marquants
de la silhouette de Londres – aussi apprécié, à sa
façon, que le Gherkin. « Un Saint-Paul industriel »,
résume Simon Jenkins, et d’ailleurs peut-être
assez grand pour contenir la cathédrale. L’usine
figure sur une pochette d’album de Pink Floyd.
Elle a servi de décor à plusieurs films.
La centrale à charbon a fermé en ����. Mais
sa renommée a empêché sa démolition, dont
le coût s’annonçait faramineux. De multiples
promoteurs se sont succédé. Puis, en ����, un
consortium malaisien a racheté le projet pour
plus de �� milliards d’euros.
Le plan comprend la transformation de la centrale en espace commercial et résidentiel, et la
restauration de ses quatre cheminées. Les promoteurs ont participé à hauteur de ��� millions
d’euros (sur �,� milliard) à la construction de
deux nouvelles stations de métro pour améliorer l’accès aux lieux. Du fait de ces dépenses, les
promoteurs ont obtenu que la proportion de
logements abordables tombe à moins de �� �.
Les nouvelles infrastructures et la rénovation
compensent largement cette diminution, estime
Ravi Govindia, à la tête du conseil municipal de
Wandsworth, dont dépend Nine Elms : « Chaque
aménagement ne contribue que de façon limitée à l’amélioration des services publics. Le logement abordable n’est qu’un des éléments. »
Le projet de rénovation comporte aussi un
nouveau parc, deux jetées, deux écoles primaires,
deux centres médicaux et de meilleurs itinéraires cyclables. « Le plus grand défi, dans tout
environnement urbain, c’est : comment rénover
un quartier et apporter ce qui rend la vie citadine
supportable et désirable ?, selon Govindia. On
ne peut pas y parvenir en se concentrant sur une
seule chose. Il faut faire plein de petites choses. »
À la pénurie de logements s’ajoutent les problèmes du parc de logements existant. Un cinquième des maisons britanniques surchauffent
dangereusement dès que le thermomètre grimpe,
selon un récent rapport parlementaire. La plupart des habitations ne sont pas climatisées.
Beaucoup ont été conçues pour conserver la
chaleur plutôt que pour la rejeter à l’extérieur
(ce qui n’est guère étonnant, vu les hivers moites
outre-Manche). La canicule de l’été dernier, l’un
des plus chauds jamais enregistrés, a fait plus
de ��� morts dans le pays. Les décès dus à la
chaleur devraient tripler à l’horizon ����, pour
atteindre plus de � ��� personnes.
Les courbes de la croissance et du réchauffement climatique vont bientôt se croiser, redoute
Julie Hirigoyen, qui dirige le Green Building
Council (« conseil pour des bâtiments verts »)
du Royaume-Uni. Or les bâtiments représentent
en général les deux tiers de la consommation
énergétique d’une ville.
« Il faut que les habitations soient aussi économes en énergie et aussi saines que possible,
souligne Hirigoyen. Le plus grand défi est de
bien s’y prendre, et vite. Si nous nous trompons,
���� étant proche, ce sont mes enfants qui en
subiront les conséquences. Le temps presse. »
offre
d’autres possibilités. Ces terrains publics appartiennent à une société de développement placée
sous le contrôle de la mairie. L’ensemble, rebaptisé Queen Elizabeth Olympic Park, est très fréquenté. Il englobe le complexe aquatique, le
vélodrome et le stade.
Le village olympique, qui a logé �� ��� personnes, a été converti en près de � ��� appartements, dont la moitié loués au prix du marché.
D’autres loyers ont été baissés pour être considérés comme des logements abordables, souvent
avec assez de chambres pour loger une famille.
En juin dernier, le maire a exposé les grandes
lignes d’un projet d’expansion à �,� milliard
d’euros. Celui-ci comprend d’autres logements
(répondant à l’objectif d’accessibilité des prix),
une salle de danse, de nouveaux campus pour
le London College of Fashion et l’University
College London (UCL), ainsi qu’une antenne du
Victoria and Albert Museum.
À l’approche des Jeux olympiques, le maire
d’alors, Ken Livingstone, avait souligné que, s’il
avait voulu accueillir les JO, ce n’était pas tant
pour la manifestation en elle-même que pour
l’occasion de lancer la réhabilitation de certaines
parties de l’Est londonien, délaissées et démunies. Ricky Burdett, chargé
(suite page 116)
L E S I T E D E S J E U X O LYM P I Q U E S D E 2 0 1 2
LONDRES
111
UNE VILLE VERTE
Les parcs et les espaces
verts représentent un
tiers de Londres. Des
habitants font des barbecues à London Fields,
à Hackney, un quartier
de l’est de la capitale de
plus en plus recherché
par les jeunes habitants.
Le prix des logements
y a grimpé plus vite
qu’ailleurs dans la ville.
PROTÉGÉE DES EAUX
À environ 16 km en aval
de Londres, la barrière
de la Tamise, avec ses dix
portails en acier, protège
le centre de Londres des
inondations dues aux
marées, des ondes de
tempête et de la hausse
du niveau de la mer.
(suite de la page 111)
du programme Villes à où l’incertitude quant aux conséquences du
la London School of Economics et l’un des prin- Brexit se fait particulièrement sentir. Certains
cipaux conseillers des Jeux, affirme que tout est chantiers de construction se sont interrompus.
en place pour une rénovation sur plusieurs Selon de nombreuses rumeurs, des emplois bandécennies, comme celle de King’s Cross.
caires partiraient à Paris ou Francfort.
« La première fois que nous avons inspecté le
En juillet, des responsables de l’arrondissesite, se souvient Burdett, nous nous sommes dit ment ont mis en place une commission sur le
que c’était de la folie. Des pneus brûlaient au Brexit, pour faire face aux conséquences si des
milieu, là où le stade olympique a été construit. » emplois venaient à disparaître et si des limites
Nous faisons le tour de l’ancien village olym- à l’immigration étaient instaurées. Pour John
pique, devenu l’East Village. L’une des pre- Biggs, le maire de Tower Hamlets (l’un des quatre
mières tâches a été de relier le site à la zone arrondissements pourvus de son propre maire),
environnante en construisant une trentaine de le Brexit est « le changement le plus important
ponts, des viaducs, des sentiers pédestres et des à frapper notre pays en vingt ans ».
pistes cyclables. « Rien de tout cela n’aurait été
Un euphémisme ? Lorsque le Royaume-Uni
construit sans les JO, affirme Burdett. Mais c’est quittera l’Union européenne, analyse Richard
Brown, du Centre for
un projet qui s’étale sur
London, ce sera la pretrente-cinq ans. »
Malgré la perspective
mière fois depuis des
Notre visite s’achève
du Brexit, les nouveaux
siècles que Londres se
près de Tower Hamlets,
venus continuent
l’un des cinq arrondisseretrouvera isolée du reste
du monde.
ments qui jouxtent le site
d’affluer. Et le secteur
olympique – et celui qui
« L’Angleterre est passée
du bâtiment
illustre peut-être le mieux
du statut de puissance
n’est pas à l’arrêt.
impériale, à la longue
les changements et les
histoire d’empire comcontradictions de la ville.
L’arrondissement est minuscule : �� km�, dont mercial, à celui de ville prépondérante au sein
une grande partie constituée par l’ancien quar- de l’UE, dit le chercheur. La transition vers ce
tier industriel des docks. Mais c’est l’arrondis- nouveau statut, que ce soit celui d’une ville monsement de Londres qui connaît la plus forte diale indépendante ou quelque chose de moins
croissance. Il compte ��� ��� habitants et abrite puissant, est un bouleversement. »
certaines des enclaves les plus pauvres de la
Mais les nouveaux venus continuent d’affluer.
ville, comme certaines des plus riches.
Et le secteur du bâtiment n’est pas à l’arrêt. La
Depuis trois siècles, le quartier sert de tête de station de la nouvelle Elizabeth Line, l’une des
pont aux nouveaux immigrés. L’immeuble le dernières nouveautés du Wharf, au pied de
plus célèbre de Tower Hamlets résume ces l’immeuble HSBC, est appelée à durer. Ses
strates d’histoire : après avoir été un temple pour sept étages regorgent de magasins et de cafés,
les huguenots français au �����e siècle, puis une en plus d’un cinéma et d’une salle de sport.
synagogue pour les juifs fuyant l’Europe de l’Est, En haut, un « jardin méridien » s’étend sur près
c’est à présent une mosquée. Les rues avoisi- de ��� m. Des « jardins d’hémisphère », à l’est et
nantes ont été rebaptisées Banga Town, en à l’ouest, sont plantés d’espèces issues de pays
l’honneur des Bangladais qui représentent visités par les navires des West India Docks.
actuellement la plus importante communauté
Je m’arrête au milieu, à la frontière entre les
immigrée de la circonscription.
hémisphères. De là, il suffit d’un court trajet
L’arrondissement comprend également en bateau pour rejoindre l’Observatoire royal
Canary Wharf, le troisième contributeur à l’éco- de Greenwich, qui abrite la longitude �. Une
nomie britannique. Parmi les hauts immeubles réplique du méridien origine y est conservée :
qui se construisent dans tout Londres, quatre- une autre façon de rappeler que, quoi qu’il lui
vingt-cinq le sont à Tower Hamlets – plus que arrive, Londres reste au centre du monde. c
dans n’importe quel autre arrondissement.
Beaucoup font partie d’un projet de rénovation Laura Parker a écrit l’article sur la pollution
au plastique (numéro de juin 2018). Luca Locatelli
visant à transformer Canary Wharf d’un lieu de a réalisé des reportages photo sur Dubai et sur le
travail à un quartier habitable. C’est d’ailleurs là système agricole néerlandais pour le magazine.
116
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
MÉTAMORPHOSES URBAINES Dans le sud de Londres, deux entreprises incarnent l’ingéniosité et la durabilité
urbaines. Dans un abri antiaérien de la Seconde Guerre mondiale, Growing Underground a installé une ferme
hydroponique, où les plantes poussent sous des lampes à LED (ci-dessus). Édifié en 2002, BedZED (ci-dessous)
est un pionnier du concept d’« écovillage ». Ses cent logements affichent des besoins réduits en énergie.
VENTE RECORD
Des visiteurs contemplent
le panorama, du haut du
20 Fenchurch Street.
Malgré sa conception
controversée, il a été
vendu l’an dernier à un
groupe de Hongkong
pour 1,5 milliard d’euros
– un record pour un
immeuble britannique.
ENVIRONNEMENT
PUMAS
DE
PATAGONIE
C E S FÉ L I N S FO N T D E S D É GÂT S C H E Z L E S
É L E V E U R S . L’ É C O T O U R I S M E O F F R E � T � I L U N
MOYEN DE CONCILIER LEURS INTÉRÊTS ?
PA R ELIZABETH ROYTE
PHOTOGRAPHIES D’INGO ARNDT
121
122
N AT I O N A L G E O G R A P H I C
PA G E P R É C É D E N T E
La broussaille d’épineux
et les éclats de roche
ne gênent pas la mère
nommée Sarmiento
(au centre) et ses petits
de 11 mois, blottis à la
fin de l’hiver au-dessus
du lac du même nom,
près du parc national
Torres del Paine,
au Chili. Cette femelle
a déjà eu plusieurs
portées. Elle passe
l’essentiel de son temps
à chasser et à faire la
sieste sur ce rivage.
CI� CONTRE
Insensible à la violence
du vent, Sarmiento
semble apprécier les
joutes avec ses petits
sur les roches calcaires,
qui retiennent la
chaleur du soleil. Avec
ses nombreuses grottes
et abris circulaires,
l’endroit offre un parfait
refuge aux pumas du
Chili, même si l’homme
est leur seul prédateur.
Le reportage photo pour
cet article a été en partie
financé par la marque Puma.
P U M A S D E PATAG O N I E
123
Ma première rencontre avec un puma
a eu lieu dans l’Utah. Une créature
à la musculature massive grondait,
terrorisée, dans les branches
d’un pin. L’animal s’était réfugié
à 7 m de hauteur pour échapper
à des chiens. Puis un agent fédéral
chargé de protéger les moutons d’un
ranch l’avait abattu. Une violence
digne d’un �ilm de Sam Peckinpah.
Mais, la deuxième fois que je vois ce
félin furtif, la scène me paraît sortir
tout droit d’un conte de fées.
Je suis tapie au milieu des buissons, sur une
pente battue par le vent, à la lisière sud du parc
national Torres del Paine, au Chili. Là, j’observe
trois jeunes fauves se culbuter et se courser
sur la rive d’un lac turquoise, évaluant leurs
forces, leurs dents et leur statut social. Parfois,
leur mère, nommée Sarmiento, s’immobilise et
jauge la situation. Ses yeux verts entourés de
noir sont calmes, sa queue épaisse est baissée.
Le quatuor atteint une presqu’île. Soudain,
la mère et les petits viennent se lover dans une
roche formant un abri arrondi, et s’adonnent à
l’activité féline par excellence : la sieste.
124
Puma concolor vit du sud de l’Alaska au sud
du Chili. C’est le mammifère terrestre de l’hémisphère occidental qui a l’habitat le plus vaste. Et
les environs du parc Torres del Paine en abritent
la plus grande concentration, estiment les spécialistes. Explication : les pumas y trouvent
abondance de proies, jouissent de la protection
du parc et échappent à la concurrence d’autres
mammifères carnivores, tels les loups.
Pour voir ce superprédateur dans son milieu
naturel, Torres del Paine est l’endroit rêvé, avec
plus de � ��� km� de pics granitiques, de prairies, de forêts subarctiques et de lacs battus par
N AT I O N A L G E O G R A P H I C Abonnez-vous sur ngmag.club
Champ
UN APPÉTIT
CROISSANT
P. N. DE
LOS GLACIARES
Des domaines comme le
Refugio Laguna Amarga se
lancent dans l’écotourisme.
Des visites guidées
peuvent permettre
de voir un puma dans
son environnement.
de glace
d e Pa t a g o n i e
N
du Sud
P. N.
D
CHILI
B E RN A R D O
O'HI GG I N S
Paine Grande
2 884 m
PA R C N AT I O N A L
o
ent
rmi
L ac Sa
La population de pumas dans le
parc national Torres del Paine (Chili)
est en plein essor. Mais les félins
s’écartent du parc, où ils sont
protégés, et s’attaquent aux
troupeaux. Leurs déplacements
semblent aléatoires. La plupart
des éleveurs proches du parc ont
repéré des pumas sur leurs terres,
mais certains n’en ont jamais vu.
ARGENTINE
A
Mt Pietrobelli
2 850 m
Observations de pumas*
dans les ranches chiliens
(juin 2017–juin 2018)
T O R R E S D E L PA I N E
E
Plus de 10
6 à 10
Aucune
1à5
r
o
Lac
To
De l
Cerro Castillo
Cancha
Carrera
S
Aire de
répartition
du puma
(Puma concolor)
AMÉRIQUE
Actuelle
La zone rocheuse
protégée à l’ouest du
parc est un médiocre
terrain de chasse : elle
n’abrite pas d’élevages
et est hors de portée
des guanacos, qui sont
les proies naturelles
des pumas. Les félins
restent plus à l’est.
Veintiocho de
Noviembre
Incertaine
Puerto Natales
AMÉRIQUE
DU SUD
A
ZONE
AGRANDIE
DES ALACALUFES
Patagonie
lmir
ante M
ontt
NE
TI
I
IL
eA
EN
o lf
CH
G
G
Détr
RÉ S E R V E F O R E S T I È R E
Puerto Prat
Historique
R
Mt Sarmiento
1 925 m
DU NORD
Río Turbio
oit
d’
Un
0
10 km
ió
n
les vents. Le paysage s’ouvre à l’infini et, avec
l’explosion du tourisme, beaucoup de pumas se
sont habitués aux humains. Comme les petits
de Sarmiento au bord du lac, on les voit vagabonder, chasser, faire leur toilette, s’accoupler
et jouer, apparemment indifférents aux visiteurs
qui les observent avec de larges sourires.
Avec mon guide, Jorge Cardenas, nous avons
traqué les pumas pendant plusieurs jours, attentifs aux cris d’alarme perçants des guanacos – un
indice que les félins sont en chasse. Nous n’avons
vu aucun cadavre. Plus tard, lors d’une réunion
organisée par le groupe de protection Panthera,
dans un hôtel du hameau de Cerro Castillo,
j’ai toutefois pu me faire une idée plus précise
des dégâts causés par la population croissante
de pumas dans la région. Étaient présents des
représentants du gouvernement, des biologistes, des guides touristiques et des éleveurs.
Arturo Kroeger Vidal, éleveur de moutons et
fils d’éleveur, dirige une estancia située au sudest de Torres del Paine. « Au début du mois, j’ai
négocié la vente de ��� moutons, lance-t-il
d’une voix calme. Cinq jours plus tard, je n’en
avais plus que ��� pour l’acheteur. Un puma
m’en a pris �� en une seule nuit. »
* LES DONNÉES SUR LES OBSERVATIONS DE PUMAS SE FONDENT SUR DES ENTRETIENS MENÉS PAR PANTHERA AVEC 45 ÉLEVEURS CHILIENS.
SOREN WALLJASPER, ÉQUIPE DU NGM. SOURCES : MARK ELBROCH, PROGRAMME PUMA, PANTHERA ; UICN ; ORGANISATION DE DONNÉES GÉOSPATIALES DU CHILI ;
SYSTÈME D’INFORMATION SUR LA BIODIVIERSITÉ DE L’ARGENTINE ; © LES CONTRIBUTEURS D’OPENSTREETMAP, DONNÉES DISPONIBLES SOUS LA LICENCE ODBL ; GLIMS
Pendant plus d’un siècle, les éleveurs ont
contrôlé la population des pumas, en chevauchant armés, et aidés de chiens. Mais, quand
le gouvernement chilien a créé le parc Torres
del Paine, dans les années ����, il y a interdit
la chasse au puma et au guanaco. Depuis, leur
nombre a fortement augmenté. Le prédateur
comme sa proie ont débordé du parc, sur les
terres privées, en quête de nourriture.
« La création du parc a été terrible pour nous »,
explique Arturo Kroeger Vidal. En s’éloignant
du parc, les pumas se sont mis à attaquer les
ovins. Les éleveurs estiment que les pumas ont
dévoré environ �� ��� moutons depuis l’ouverture du parc, entraînant une perte substantielle
sur les revenus tirés de la laine et de la viande.
Des guides et des gardes expérimentés évaluent le nombre de pumas au sein du parc entre
�� et ���. À l’extérieur du parc, où la population
de félins n’a pas encore été établie avec précision, l’ensemble des éleveurs affirment que, à
eux tous, ils en abattent une centaine par an.
126
N AT I O N A L G E O G R A P H I C
« Nous vivons de l’élevage, s’exclame Victor
Manuel Sharp, lors de la réunion à l’hôtel.
Qu’allons-nous faire ? »
consiste à renoncer aux ovins au
profit des bovins, trop gros pour que les pumas
s’y attaquent. Mais l’élevage de moutons est une
tradition locale, et tout le monde n’a pas de bons
fourrages pour nourrir le gros bétail.
On peut aussi recourir aux chiens pour protéger les moutons, propose Jose Antonio Kusanovic,
un ranchero qui chassait les pumas, avant de
se lancer dans l’élevage canin. Mais un chien
de garde coûte environ � ��� euros, nourriture
et soins vétérinaires non compris. Or plusieurs
d’entre eux sont nécessaires pour surveiller des
troupeaux de � ��� à � ��� têtes. Pour les éleveurs, louer les services d’un leonero (un chasseur de « lion de montagne ») revient moins cher.
Charles Munn, un Américain qui dirige
plusieurs entreprises d’écotourisme, se lève
pour prendre la parole. « J’ai créé une activité
UNE OPTION
L’ASSAUT DU PUMA
Après une heure
de guet derrière des
buissons, puis une
demi-heure de traque
de sa proie sur une
centaine de mètres
de prairie aride,
Sarmiento bondit
sur un guanaco mâle
adulte. Robuste,
celui-ci bondit de
côté pour échapper
aux griffes acérées
de son assaillant.
touristique à partir du jaguar, dans le Pantanal
brésilien. Les pumas peuvent vous rapporter
beaucoup d’argent. »
Les éleveurs maugréent. Ils savent qu’ils ne
peuvent pas à la fois faire payer les touristes pour
observer les pumas sur leurs terres et continuer
de tuer les félins (le gouvernement autorise un
éleveur à abattre un prédateur s’il peut prouver
que celui-ci a tué un mouton ; la plupart des éleveurs n’essaient même pas d’obtenir ce permis).
« Vous êtes en train de dire que nous devons
nourrir les pumas pour que vous en ayez plus
pour le tourisme, lance un autre éleveur, sèchement. Je suis trop âgé pour virer touristique. »
Munn désigne les frères Tomislav et Juan Goic,
assis au fond de la salle. De leurs � ��� moutons
qui paissaient le long de la limite orientale du
parc, il n’en reste plus qu’une centaine. Tous les
autres ont été victimes d’une épouvantable tempête de neige et de la prédation des pumas au fil
des ans. Mais, aujourd’hui, environ ��� touristes
par an paient une somme rondelette aux Goic
pour traverser les �� km� de leur propriété, en
voiture ou à pied, avec un guide et un pisteur
munis de jumelles et de talkies-walkies.
Chez les Goic, les visiteurs sont quasi sûrs de
voir Sarmiento et ses petits. Les frères ont ouvert
leur domaine à l’observation des pumas en ����,
lorsque le règlement du parc a imposé aux touristes et aux guides de suivre des sentiers précis,
réduisant les chances d’apercevoir des pumas.
« Nous nous inquiétions pour la sécurité des
gens », justifie Michael Arcos, le directeur du parc.
Pressés par les clients voulant voir des pumas,
des guides indépendants s’étaient mis à traquer
ceux-ci de nuit, en utilisant des lampes torches
et en rampant trop près des félins. Jusqu’à présent, on ne déplore qu’une seule rencontre fatale
à Torres del Paine (le parc le plus visité du Chili),
et les autorités souhaitent en rester là.
Cette prudence du parc vis-à-vis du tourisme
ne changera pas de sitôt. Les chercheurs doivent
avant tout établir le nombre de pumas qui y
vivent, l’étendue de leur territoire, leurs habitudes alimentaires et leurs comportements
sociaux. Ces études, menées dans le parc et en
dehors, prendront plusieurs années.
Les données aideront à concevoir des plans
de protection et, si possible, un tourisme aussi
sûr pour les félins que pour les humains. Ses
retombées pourraient même aider à compenser
les pertes liées aux moutons tués par les pumas.
L’idée est que ces prédateurs-clés deviennent
aussi précieux à l’économie de la région qu’ils le
sont à son intégrité environnementale.
Les pumas du secteur mangent sans doute
plus de guanacos que de moutons. Piètre consolation pour les éleveurs. Lors de la réunion, Jorge
Portales assure que les pumas lui ont pris �� �
de son troupeau en une saison, soit ��� animaux.
Il s’est tourné vers l’élevage bovin, puis a réintroduit des moutons et des chiens de garde. Sans
dissuader les pumas. « C’est le prix à payer pour
vivre près de Torres del Paine, soupire-t-il.
Aujourd’hui, nous n’avons plus de moutons. »
Il gère désormais son estancia comme un
centre d’accueil offrant des promenades à cheval
et de l’agneau rôti. La prochaine étape, dit-il,
sera le tourisme pour le puma. Ses collèges éleveurs restent silencieux. Ils résisteront avec
fierté aussi longtemps que possible. c
Elizabeth Royte a écrit l’article sur l’impact des
microplastiques sur la santé humaine (juin 2018).
Spécialiste de l’environnement, Ingo Arndt publie
ici son premier reportage photo dans le magazine.
P U M A S D E PATAG O N I E
127
FLIRT DANS
LES HAUTEURS
Charqueado (à gauche),
4 ans, un fils de Sarmiento,
pourchasse une femelle
pendant une journée
de parade, grognant et
grinçant des dents. Le
photographe Ingo Arndt
les verra s’accoupler
cinq fois en une heure, sur
un espace relativement
exposé. Le couple flânera
ensuite sur ce promontoire,
dans un ranch privé
situé près du parc national
Torres del Paine.
128
N AT I O N A L G E O G R A P H I C
P U M A S D E PATAG O N I E
129
Découvrez la richesse de
NOUVELLE
FO R M U L E
12 numéros
National Geographic
+ 6 Hors-Séries
6
€25
par mois
seulement !
BON D’ABONNEMENT
National Geographic
Avec National Geographic,
sillonnez la planète, plongez
au cœur des océans,
découvrez les mystères de
la science et comprenez les
enjeux d’aujourd’hui !
À compléter et à retourner sous enveloppe non affranchie à :
NATIONAL GEOGRAPHIC - Libre réponse 91149 - Service abonnements 62069 ARRAS CEDEX 9
;
OUI, Je m’abonne à National Geographic et ses Hors-Séries
•
JE CHOISIS MON OFFRE
OFFRE LIBERTÉ
National Geographic + ses 6 Hors-Séries
pour
6
€25
(18 nos/an)
/mois au lieu de 8€ *.
95
MEILLEURE
Je recevrai l’autorisation de prélèvement à remplir par courrier.
OFFRE
• N’avancez pas d’argent
• Payez en petites mensualités
• Arrêtez votre abonnement quand vous voulez
EXPLOREZ
LES TERRES DU
BOUT DU MONDE
OFFRE COMPTANT
National Geographic + ses 6 Hors-Séries (1 an / 18 nos)
pour
DÉCOUVREZ
LES MYSTÈRES DE
•
LA SCIENCE
12 numéros par an
COMPRENEZ
LE MONDE
79
€
Soit plus de
25
%
de réduction*
au lieu de 107€40*. Je règle mon abonnement ci-dessous.
JE M’ABONNE :
EN LIGNE SUR PRISMASHOP.FR
1
2
Rendez-vous
directement
sur le site
www.prismashop.fr
Cliquez sur
3
Saisissez la clé Prismashop indiquée
ci-dessous
Clé Prismashop
Clé Prismashop
NGE232D
Clé Prismashop :
D’AUJOURD’HUI
Paiement sécurisé en ligne
PAR TÉLÉPHONE
Découvrez
les Hors-Séries
PAR COURIER EN COMPLÉTANT LES INFORMATIONS CI-DESSOUS :
Je renseigne mes coordonnées** : F Mme F M
Nom : _________________________________________________________________________
Prénom : _______________________________________________________________________
Adresse : _______________________________________________________________________
Code Postal :
■■ ■■■ Ville : ________________________________________________
FJe souhaite être informé(e) des offres commerciales du groupe PRISMA MEDIA.
FJe souhaite être informé(e) des offres commerciales des partenaires du groupe PRISMA MEDIA.
6 numéros par an
La National Geographic Society a pour mission
d’inspirer «le désir de protéger la planète».
L’abonnement au magazine contribue à financer
des explorations dédiées ainsi que des programmes
d’éducation ou de recherches spécifiques...
Service 0,20 € / min
+ prix appel
PAR SMS en envoyant NGE 232D au 32321 (sms non surtaxé)
Sciences, destinations
secrètes, mythologie…
6 fois par an,, explorez une
thématique différente grâce
aux hors-séries. Retrouvez
les qualités graphiques
et photographiques
de National Geographic à
travers des reportages
journalistiques uniques.
Ô EN PLUS EN SOUSCRIVANT UN ABONNEMENT, VOUS SOUTENEZ LES PROJETS
DE LA NATIONAL GEOGRAPHIC SOCIETY
0 826 963 964
•
JE RÈGLE MON ABONNEMENT
■Chèque bancaire à l’ordre de NATIONAL GEOGRAPHIC
VOTRE CLÉ PRISMASHOP ➜ NGE 232D
*Prix de vente au numéro. Pour l’option liberté, pour un minimum de 12 prélèvements. **A défaut, votre abonnement ne pourra être
mis en place. Photos non contractuelles. Offre réservée aux nouveaux abonnés de France Métropolitaine. Délai de livraison du premier
numéro: 4 semaines. Les informations recueillies font l’objet d’un traitement informatique à des fins d’abonnement à nos services
de presse, de fidélisation et de prospection commerciale. Conformément à la loi Informatique et Libertés du 6 janvier 1978 modifiée,
vous disposez d’un droit d’accès, de modification, de rectification, de suppression et d’opposition au traitement des informations
vous concernant. Pour exercer ces droits, il vous suffit de nous écrire en envoyant un e-mail ou un courrier à dpo@prismamedia.
com ou Le Groupe PRISMA MEDIA, le Data Privacy Officer, 13, rue Henri Barbusse – 92230 Gennevilliers. Si vous acceptez que ces
informations soient transmises à des partenaires du Groupe PRISMA MEDIA, ceux-ci peuvent être situés hors de l’Union Européenne.
À
S U I V R E
L A
S É L E C T I O N
LIVRES, FILMS, EXPOS, DVD...
PAR MARIE-AMÉLIE CARPIO-BERNARDEAU
NOTE DE DOUCEUR EN TCHÉTCHÉNIE
« Dans toutes les guerres, il y a des scènes surréalistes liées
à la musique, comme à la chute du mur de Berlin, avec
Rostropovitch », rappelle le photographe Alain Keler.
La guerre de Tchétchénie n’a pas échappé à la règle. En
janvier 1995, pour rejoindre Grozny, le Français a embarqué
avec les Russes, sur un vol en hélicoptère à basse altitude,
« dans une ambiance digne d’Apocalypse Now ». « En arrivant
au QG de l’armée, à la tombée de la nuit, j’ai vu ce soldat
jouer du piano dans un parc dévasté. À droite, il y avait une
mine. J’ai pris deux clichés avant de finir ma pellicule. Le
temps d’en changer, il n’y avait plus assez de lumière. » Alain
Keler est rentré peu satisfait de son travail, effectué « la peur
aux tripes ». Ce n’est qu’en développant ses films qu’il a réalisé la force de cette image. « C’était ça, la magie de l’argentique : on découvrait ses photos sur les planches-contacts. »
Le cliché est devenu l’un des plus iconiques de sa carrière.
À DÉCOUVRIR DANS l’ouvrage Journal d’un photographe, d’Alain Keler, aux Éditions de Juillet,
et à la galerie Fermé le lundi (Marseille), jusqu’au 19 janvier 2019.
DEUX SŒURS POUR LA PAIX
Dans leur village du Ladakh, une région de l’Himalaya indien, Padma,
12 ans, et sa sœur cadette, Khaskit, sont les plus jeunes participantes
au gotchak. Cette procession bouddhique est une véritable épreuve
physique : durant trois jours et deux nuits, il faut chanter des prières
en s’allongeant face contre terre à chaque pas, sur des sentiers
montagneux et des rivières glacées, jusqu’à atteindre un monastère
haut perché. Le but, explique Padma, est d’« apporter la paix et
l’harmonie au monde, aux animaux, aux humains et même aux arbres ».
À VOIR dans le documentaire Grandir au Ladakh, de Christiane
Mordelet et Stanzin Dorjai Gya, au festival Objectif Aventure,
au Centquatre (Paris), du 25 au 27 janvier 2019.
PHOTOS : ALAIN KELER, MYOP (TCHÉTCHÉNIE) ; CHRISTIANE MORDELET (SŒURS AU LADAKH) ; K. GAVRILOV (PHOTOMONTAGE D’UNE SÉPULTURE DE SUNGIR) ;
MOHAMED OSAMA, ALAMY (AVICENNE) ; GUILLAUME CANNAT (CIEL DES CÉVENNES) ; WILLIAM DANIELS
13 400
C’est le nombre de perles d’ivoire trouvées dans deux
sépultures de Sungir, en Russie, datant d’environ 34 000 ans.
L’une contenait les restes d’un adulte ; l’autre, de deux
enfants (photo). Cet étonnant mobilier funéraire fait de ces
tombes préhistoriques les plus riches jamais retrouvées.
LU DANS Pré-histoires, sous la direction de Nicolas Teyssandier
et de Stéphanie Thiébault, éd. CNRS/Cherche midi.
Paradis céleste
En août 2018, le parc national des
Cévennes a été désigné « Réserve internationale de ciel étoilé ». Ce label, que
se partagent treize sites dans le monde,
distingue les régions où la pureté du
ciel et l’absence de pollution lumineuse
permettent une observation exceptionnelle des étoiles. Sur cette photo
sont visibles les constellations du
Scorpion, du Sagittaire et d’Ophiuchus,
ainsi que Mars, le point le plus brillant
à droite, et Saturne, au centre.
LU DANS Nuits des Cévennes,
collectif, éditions du Rouergue.
L’Islam au chevet
de la folie
Dès le Moyen Âge, les grands
savants arabo-musulmans,
dont Averroès et Avicenne,
se sont penchés sur les
causes et les traitements
des maladies mentales. Des
politiques de santé innovantes
ont été mises en œuvre, avec
la création des bimaristan.
Ces maisons pour infirmes,
ouvertes à tous – riches ou
pauvres, hommes ou femmes,
musulmans ou non –,
proposaient des soins
d’avant-garde, mêlant
musicothérapie, balnéothérapie et ergothérapie.
LU DANS Handicap :
quand l’archéologie nous
éclaire, de Valérie Delattre,
éditions Le Pommier.
Les Rohingyas, un si vieil exode…
La question des Rohingyas, cette minorité musulmane qui fuit
actuellement les persécutions au Myanmar pour se réfugier
au Bangladesh, relève de l’histoire ancienne. Alors qu’il couvrait
le sujet pour le numéro d’octobre 2017 de National Geographic,
William Daniels s’est intéressé aux Rohingyas présents dans
ce pays depuis quarante ans. « À Shamlapour (photo), beaucoup
travaillaient comme pêcheurs, explique le photographe français.
Ce sont d’excellents marins et une main-d’œuvre bon marché.
Neuf mois plus tard, j’étais au même endroit, lors de la grande
vague très médiatisée des réfugiés. Ils arrivaient sur des bateaux
semblables ; il y avait des morts sur la plage. » Aujourd’hui, le
Bangladesh abriterait près de 1 million d’exilés rohingyas.
À DÉCOUVRIR à l’exposition Wilting Point, de William Daniels,
à Paris, du 24 janvier au 11 avril 2019, et à Mérignac, du 18 avril
au 11 juin 2019, ainsi que dans le livre éponyme (éd. Imogène).
JANVIER 2019
133
ENVIES
ACTUALITÉS COMMERCIALES
L’élégante
poésie
de Joïkka
Joïkka est une maison de joaillerie accessible, à l’univers poétique
et intemporel, qui se traduit par la finesse de ses créations. Joïkka
travaille avec les matières nobles et précieuses de la joaillerie et
utilise des pierres précieuses et semi précieuses en jouant sur les
couleurs. Joïkka propose des bijoux aux lignes classiques, épurées,
géométriques, des pièces à mixer ou à collectionner.
Les collections Joïkka respectent les codes du luxe tout
en offrant des bijoux accessibles à partir de 100 €
sur www.joikka.com
Alpina
Equipée d’une lunette bidirectionnelle,
l’Alpiner 4 Shadow présente un boîtier
de 44 mm de diamètre en acier inoxydable recouvert de PVD noir. Jouant le
ton sur ton, le cadran soleillé noir met
en scène des index luminescents noirs,
à l’identique des aiguilles des heures
et des minutes. Etanche à 100 mètres,
cette sportive tout terrain, finalisée d’un
e-strap connecté, est dotée de fonctions
intelligentes. Mouvement automatique.
1 395 €. Points de vente :
01.48.87.23.23.
www.alpinawatches.com
Ergyphilus Plus,
l’incontournable
de la saison
Aidez vos défenses naturelles pendant
l’hiver. Pour soutenir l’organisme, il
faut chouchouter notre microbiote
protecteur. Ergyphilus Plus offre un
spectre d’action élargi par la synergie
unique de 4 souches de lactobacilles
et bifidobactéries. Une formule inchangée depuis 20 ans, gage de qualité.
Complément alimentaire sans dioxyde
de titane, ni silice, ni gluten.
Ergyphilus Plus du Laboratoire Nutergia est disponible
en pharmacies et parapharmacies aux prix indicatifs
de 13 € (30 gélules) et 21,50 € (60 gélules).
Suzuki Swift Sport :
une personnalité hors
du commun
La nouvelle Swift Sport a été conçue pour
vivre au quotidien les sensations du sport
automobile. Elle combine le caractère
polyvalent de la Swift et les lignes plus
audacieuses d’un véhicule hautes performances. Les sièges baquets sport spécifiques, le volant à méplat gainé de cuir
avec des surpiqures rouges, le pédalier
aluminium, les ornements rouges sur la
planche de bord, la console centrale et les
contre-portes sont autant d’attributs qui
révèlent toute la sportivité de la nouvelle
Swift Sport.
www.suzuki.fr
Lafuma
Lafuma présente l’Altiplano, le sac à dos
conçu pour les baroudeurs. Ce sac multipoche, complet, fiable et pratique accompagne toutes les aventures proches ou
lointaines. L’Altiplano existe en modèle
45 litres, avec une déclinaison Femme
(dos spécifique), ainsi qu’en 30 litres. Il
possède de vastes compartiments et ses
nombreuses poches permettent une organisation simple et efficace du matériel.
www.lafuma.com
�NOUS CROYONS AU
P OUVOIR DE LA SCIENCE,
D E L’ E X P L O R A T I O N E T
DU ST ORY TELLING P OUR
CHANGER LE MONDE.�
EDITOR IN CHIEF
Susan Goldberg
NATIONAL GEOGRAPHIC FRANCE
FABRICATION
MANAGING EDITOR, LONG FORM: David Brindley
SENIOR DIRECTOR, SHORT FORM: Patty Edmonds
DIRECTOR OF PHOTOGRAPHY: Sarah Leen
EDITOR LONG FORM: David Lindsey
CREATIVE DIRECTOR: Emmet Smith
MANAGING EDITOR, SHORT FORM: Alissa Swango
SENIOR DIRECTOR, MAJOR PROJECTS: Michael Tribble
13, rue Henri-Barbusse - 92624 Gennevilliers Cedex
Standard 01 73 05 60 96
Stéphane Roussiès, Mélanie Moitié
INTERNATIONAL EDITIONS
SERVICE PHOTO Emanuela Ascoli
MAQUETTISTE Hélène Verger
RÉDACTEUR EN CHEF Gabriel Joseph-Dezaize
RÉDACTRICE EN CHEF ADJOINTE Catherine Ritchie
DIRECTRICE ARTISTIQUE Elsa Bonhomme
CHEF DE SERVICE Corinne Soulay
SECRÉTAIRES DE RÉDACTION Fabien Maréchal,
Sophie Hervier
EDITORIAL DIRECTOR: Amy Kolczak
DEPUTY EDITORIAL DIRECTOR: Darren
Smith
TRANSLATION MANAGER: Beata Kovacs Nas
EDITORIAL SPECIALIST: Leigh Mitnick
EDITORS: ARABIC: Alsaad Omar Almenhaly. BRAZIL:
Ronaldo Ribeiro. BULGARIA: Krassimir Drumev.
CHINA: Tianrang Mai. CROATIA: Hrvoje Prćić. CZECHIA:
Tomáš Tureček. ESTONIA: Erkki Peetsalu.
FARSI: Babak Nikkhah Bahrami. FRANCE: Gabriel
Joseph-Dezaize. GEORGIA: Natia Khuluzauri.
GERMANY: Jens Schroeder. HUNGARY: Tamás Vitray.
INDIA: Lakshmi Sankaran. INDONESIA: Didi Kaspi
Kasim. ISRAEL: Daphne Raz. ITALY: Marco Cattaneo.
JAPAN: Shigeo Otsuka. KAZAKHSTAN: Yerkin
Zhakipov. KOREA: Junemo Kim. LATIN AMERICA:
Claudia Muzzi Turullols. LITHUANIA: Frederikas
Jansonas. NETHERLANDS/BELGIUM: Arno Kantelberg.
NORDIC COUNTRIES: Lotte Juul Nielsen.
POLAND: Agnieszka Franus. PORTUGAL: Gonçalo
Pereira. ROMANIA: Catalin Gruia.
RUSSIA: Andrei Palamarchuk. SERBIA: Igor Rill.
SLOVENIA: Marija Javornik. SPAIN: Josep Cabello.
TAIWAN: Yungshih Lee. THAILAND: Kowit
Phadungruangkij. TURKEY: Nesibe Bat
NATIONAL GEOGRAPHIC PARTNERS
CEO
Gary E. Knell
SENIOR MANAGEMENT
CHIEF MARKETING OFFICER: Jill Cress
EDITORIAL DIRECTOR: Susan Goldberg
CHIEF ADMINISTRATIVE OFFICER: Marcela Martin
GENERAL MANAGER NG MEDIA: David E. Miller
GLOBAL NETWORKS CEO: Courteney Monroe
CHIEF COMMUNICATIONS OFFICER: Laura Nichols
EVP SALES AND PARTNERSHIPS: Brendan Ripp
EVP BUSINESS AND LEGAL AFFAIRS: Jeff Schneider
HEAD OF TRAVEL AND TOUR OPERATIONS: Nancy
ASSISTANTE DE LA RÉDACTION
SITE INTERNET Julie Lacaze
Nadège Lucas
Philippe Bouchet, systématique, Jean Chaline,
paléontologie, Françoise Claro, zoologie,
Bernard Dézert, géographie, Jean-Yves Empereur,
archéologie, Jean-Claude Gall, géologie,
Jean Guilaine, préhistoire,André Langaney,
anthropologie, Pierre Lasserre, océanographie,
Hervé Le Guyader, biologie, Hervé Le Treut,
climatologie, Anny-Chantal Levasseur-Regourd,
astronomie, Jean Malaurie, ethnologie,
François Ramade, écologie, Alain Zivie, égyptologie
ONT COLLABORÉ À CE NUMÉRO :
Philippe Babo, Béatrice Bocard, Philippe Bonnet,
Jean-François Chaix, Bernard Cucchi,
Joëlle Hauzeur, Hélène Inayetian,
Marie-Pascale Lescot, Hugues Piolet
DIRECTRICE EXÉCUTIVE ÉDITORIALE
Gwendoline Michaelis
DIRECTRICE MARKETING ET BUSINESS DÉVELOPPEMENT
Dorothée Fluckiger
DIRECTRICE ÉVÉNEMENTS ET LICENCES
Julie Le Floch-Dordain
CHEF DE GROUPE Hélène Coin
DIFFUSION
Sylvaine Cortada : DIRECTRICE DE LA FABRICATION
ET DE LA VENTE AU NUMÉRO (01 73 05 64 71)
Bruno Recurt : DIRECTEUR DES VENTES (01 73 05 56 76)
Laurent Grolée : DIRECTEUR MARKETING CLIENT
(01 73 05 60 25)
Charles Jouvin : DIRECTEUR MARKETING,
ÉTUDES ET COMMUNICATION (01 73 05 53 28)
DIRECTEUR EXÉCUTIF PMS : Philipp Schmidt
DIRECTRICE EXÉCUTIVE ADJOINTE PMS :
SENIOR VICE-PRESIDENT: Yulia Petrossian Boyle
Ariel Deiaco-Lohr, Gordon Fournier, Ross Goldberg,
Kelly Hoover, Jennifer Johns, Jennifer Liu,
Rossana Stella
SERVICE ABONNEMENTS
62066 Arras Cedex 09
Par téléphone depuis la France
0 808 809 063
Abonnement au magazine
France :
1 an - 12 numéros : 66 €
1 an - 12 numéros + hors-séries : 87 €
Thierry Dauré (01 73 05 64 49)
DIRECTRICE DÉLÉGUÉE CREATIVE ROOM :
Viviane Rouvier (01 73 05 51 10)
BRAND SOLUTIONS DIRECTOR : Arnaud Maillard
(01 73 05 49 81)
AUTOMOBILE ET LUXE BRAND SOLUTIONS DIRECTOR :
Dominique Bellanger (01 73 05 45 28)
SENIOR ACCOUNT MANAGERS :
Charles Jouvin (01 73 05 53 28)
CHIEF SCIENTIST AND SVP: Jonathan Baillie
CHIEF ADMINISTRATIVE OFFICER: Tara Bunch
CHIEF MARKETING OFFICER: Emma Carrasco
GENERAL COUNSEL AND SECRETARY: Angelo Grima
VP GLOBAL EDUCATION BUSINESS STRATEGY: Lina Gomez
SVP PARTNERSHIPS: Leora Hanser
VP EDUCATION PROGRAMS: Kim Ulse
VP MEDIA INNOVATION: Kaitlin Yarnall
Pour tout renseignement
sur votre abonnement ou pour
l’achat d’anciens numéros
DIRECTEUR DÉLÉGUÉ PMS PREMIUM :
PRESIDENT AND CEO
SENIOR MANAGEMENT
ngmag.club
(01 73 05 51 88)
Evelyne Allain Tholy (01 73 05 64 24)
Amandine Lemaignen (01 73 05 56 94)
Florence Pirault (01 73 05 64 63)
TRADING MANAGERS : Tom Mesnil (01 73 05 48 81)
Virginie Viot (01 73 05 45 29)
PLANNING MANAGER : Julie Vanweydeveldt
(01 73 05 64 94)
ASSISTANTE COMMERCIALE : Catherine Pintus
(01 73 05 64 61)
Tracy R. Wolstencroft
Pour vous abonner,
c’est simple et facile sur
Anouk Kool (01 73 05 49 49)
The National Geographic Society is a
global nonprofit organization that pushes
the boundaries of exploration, furthering
understanding of our planet to empower
us all to generate solutions for a healthier
and more sustainable future.
NATIONAL GEOGRAPHIC SOCIETY
NATIONAL GEOGRAPHIC
PUBLICITÉ
BOARD OF DIRECTORS
INTERNATIONAL PUBLISHING
Date de création : octobre 1999
Dépôt légal : janvier 2019
Diffusion : Presstalis. ISSN 1297-1715
Commission paritaire : 1123 K 79161
CONSULTANTS SCIENTIFIQUES
Schumacher
Jean M. Case, Kevin J. Maroni, James Murdoch,
Lachlan Murdoch, Frederick J. Ryan, Jr. ,
Brian F. Sullivan
Imprimé en Pologne : LSC Communications Europe,
ul. Obr. Modlina 11, 30-733 Kraków, Poland
Provenance du papier : Finlande
Taux de fibres recyclées : 0 %
Eutrophisation : Ptot 0 Kg/To de papier
DIRECTEUR DÉLÉGUÉ INSIGHT ROOM :
Licence de
NATIONAL GEOGRAPHIC PARTNERS
Magazine mensuel édité par :
Siège social : 13, rue Henri-Barbusse,
92624 Gennevilliers Cedex
Société en Nom Collectif au capital de
3 000 000 € d’une durée de 99 ans, ayant
pour gérant Gruner + Jahr Communication GmbH.
Ses principaux associés sont
Média Communication S.A.S.
et G + J Communication GmbH.
Directeur de la publication :
ROLF HEINZ
La rédaction du magazine n’est pas responsable
de la perte ou détérioration des textes ou
photographies qui lui sont adressés pour
appréciation. La reproduction, même partielle,
de tout matériel publié dans le magazine est
interdite. Tous les prix indiqués dans les pages
sont donnés à titre indicatif.
Copyright © 2018
National Geographic Partners, LLC
All rights reserved. National Geographic and Yellow
Border: Registered Trademarks ® Marcas
Registradas. National Geographic assumes no
responsibility for unsolicited materials.
Devenez un expert de l’économie numérique
Business Insider Intelligence, le service d’études
indispensable pour tous les acteurs de
laɭtransformation digitale.
www.businessinsider.fr/intelligence
+ 500
Études
7
Catégories
d’études
À
S U I V R E
|
LE MOIS PROCHAIN
Des enfants
pour les dieux
Les ravages
du kangourou
La ruée vers
l’or blanc
La Silicon Valley
en question
Il y a 500 ans, au Pérou,
les Chimú ont sacrifié
269 filles et garçons.
Pourquoi ? Le mystère
reste entier.
L’emblème chéri
de l’Australie sème
le chaos. Le pays doit
désormais décider
du sort de cet animal.
La demande de lithium
explose. Présente dans
les déserts de Bolivie,
cette manne profiterat-elle aux habitants ?
Le berceau mondial
de l’innovation
technologique doit
regarder en face le coût
social de son succès.
EN
3+272ȗ67()$12817(57+,1(5
KIOSQUE
LE
30
JANVIER
À
S U I V R E
|
LE MAKING OF
DOUBLE TRAQUE
PA R MARIE-AMÉLIE CARPIO-BERNARDEAU
extraordinaire,
Ingo Arndt n’est pas peu fier de l’avoir
immortalisée au Chili (voir son reportage, pages ��� à ���).
« Je n’arrivais pas à croire ce qui
s’était produit devant mon objectif.
Lorsque j’ai regardé les images sur
l’écran de mon appareil, j’ai sauté de
joie », se rappelle le photographe. Alors
qu’il avait repéré le puma en embuscade près d’un guanaco isolé, il s’est
organisé pour saisir l’attaque sur le vif.
« Je me suis positionné à environ
�� m du guanaco. Puis, j’ai demandé
aux deux pisteurs qui m’accompagnaient de garder le puma dans leur
champ de vision. Le guanaco mangeait
en avançant vers moi. J’étais obligé de
reculer régulièrement pour conserver
la distance nécessaire à mon téléobjectif. Le manège a duré presque
CETTE SCÈNE DE CHASSE
138 N A T I O N A L G E O G R A P H I C
une demi-heure, sur environ ��� m.
Soudain, j’ai entendu le message radio :
« �� m. » Le puma allait attaquer ! Je ne
pouvais pas le voir. En gardant l’œil
dans le viseur de mon appareil, j’ai
réglé la mise au point sur le cou du
guanaco. Et le puma a surgi de nulle
part. Sa première attaque a été esquivée
par le camélidé, mais il est reparti à
l’assaut, parvenant à planter ses crocs
dans la gorge de la victime. »
Même si les jeux semblent faits sur
ce cliché, les guanacos ont du répondant. Dans un ultime rebondissement,
celui-ci s’est laissé tombé de tout son
poids sur le félin, qui, sonné, a lâché
son étreinte. Sa proie a disparu en un
éclair. Pour Ingo Arndt, ce fut le déclic :
« J’ai compris pourquoi seule une
attaque de puma sur cinq en moyenne
est victorieuse. »
Ingo Arndt, 51 ans, est
un photographe
allemand spécialisé
dans la vie sauvage.
Il a remporté plusieurs
prix au concours
Wildlife Photographer
of the Year.
PHOTOS : INGO ARNDT (EN HAUT) ; SILKE ARNDT
Nouvelles
s à jour
éditions mise LERS
des BEST-SEL
Une collection e
d
vendue à près
150 000 ex !*
Histoire, fabrication,
notes de dégustation, recettes de cocktails...
www.editions-prisma.com
Découvrez dans ces livres
l’univers de ces boissons qui ont tant à révéler,
et poussez la porte des meilleures brasseries et distilleries du monde.
DISPONIBLES EN LIBRAIRIE ET AU RAYON LIVRES À PARTIR DE 19.95€
L’ABUS D’ALCOOL EST DANGEREUX POUR LA SANTÉ. À CONSOMMER AVEC MODÉRATION.
*sources : données GFK juillet 2018
e
r
t
î
a
n
n
o
c
x
u
e
i
M
r
e
t
s
u
g
é
d
x
u
e
i
m
pour
Документ
Категория
Журналы и газеты
Просмотров
0
Размер файла
101 150 Кб
Теги
National Geographic
1/--страниц
Пожаловаться на содержимое документа