close

Вход

Забыли?

вход по аккаунту

?

Инструменты и методы системной биологии (Н.А

код для вставкиСкачать
Инструменты и методы системной
биологии
Н. А. Колчанов
kol@bionet.nsc.ru
РЕВОЛЮЦИЯ В МОЛЕКУЛЯРНОЙ БИОЛОГИИ И ГЕНЕТИКЕ
Расшифровка структуры двойной спирали ДНК
•
1953
Рентгено-структурные методы расшифровка пространственной
структуры белков
• Методы расшифровки аминокислотных последовательностей
• Методы расшифровки нуклеотидных последовательностей
• Генетическая инженерия
• Генодиагностика
• Трансгенез
• Клонирования
• Молекулярные биотехнологии
• ДНК-микрочипы
• Массове секвенирование геномов
Расшифровка генома человека
Протеомика
Транскриптомика
Молекулярная медицина, генотерапия
Конструирование молекулярно-генетических систем с заданными свойствами
2001
Современная биология стала производителем
беспрецедентно огромных объемов
экспериментальных данных. Их осмысливание
невозможно без привлечения современных
информационных технологий, эффективных методов
анализа данных и моделирования биологических
систем и процессов на различных уровнях
организации живой материи: от молекулярногенетического, включая организменный и заканчивая
экосистемным и биосферным.
В ответ на этот вызов возникает наука,
называемая информационной биологией.
АНАЛИТИЧЕСКИЕ МЕТОДЫ СОВРЕМЕННОЙ БИОЛОГИИ:
ИНФОРМАЦИОННЫЙ ВЗРЫВ
.
.
......
......
......
......
.
.
ATGCCCGGGTTTAATGCGTCAGTGACTGCACA…..
.
.
.
.
.
.
.
.
.
.
.
.
.
СИСТЕМНАЯ БИОЛОГИЯ - ОТ АНАЛИЗА
К СИНТЕЗУ
ЦЕЛЬ:
Реконструкция знаний о системах и процессах, обеспечивающих
воспроизведение КЛЕТОК и ОРГАНИЗМОВ, их функционирование и
взаимодействие с окружающей средой на основе информации,
закодированной в геномах.
МЕТОДЫ:
ИНТЕГРАТИВНЫЕ ЭКСПЕРИМЕНТАЛЬНЫЕ ПОДХОДЫ: системная
транскриптомика, протеомика, метаболомика, клеточная
биология.
БИОИНФОРМАТИКА: компьютерная интеграция
экспериментальных данных, получаемых аналитическими
методами молекулярной биологии, математическое
моделирование молекулярно-генетических систем и процессов.
ГЕННАЯ СЕТЬ – центральный
объект системной биологии
Генная сеть - группа координировано
функционирующих генов, обеспечивающих
формирование определенного фенотипического
признака организма (молекулярного,
биохимического, физиологического,
морфологического, поведенческого и т.д.)
Обязательные компоненты генной сети:
гены, кодируемые ими РНК и белки, метаболиты,
пути передачи сигналов, метаболические пути,
регуляторные контуры с положительными и
отрицательными обратными связями.
ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ.
ИНТЕГРАТИВНЫЕ ЭКСПЕРИМЕНТАЛЬНЫЕ ПОДХОДЫ:
экспрессионные ДНК-чипы.
Граф взаимодействий
между генами
Время 11 21 ··· M
1
XN x M :=
12 22
.. ..
. 1 .2
N N
··· M
.. . 2
. ..
··· M
N
x ij
концентрация i-го гена
в j-й временной точке
Время Гены (mRNA)
Экспериментальные данные:
ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ.
ИНТЕГРАТИВНЫЕ ЭКСПЕРИМЕНТАЛЬНЫЕ ПОДХОДЫ: Граф белокбелковых взаимодействий Drosophila melanogaster (7048 белков и 4780 высоко
достоверных взаимодействий)
(Science, 302(5651):1727-1736)
Белки дрозофилы, ортологичные
белкам человека, имеющим важное
значение при возникновении
заболеваний, выделены кружками с
зазубренным краем.
Принадлежность белков человека к
тому или иному функциональному
классу, обеспечивает возможность
поиска новых стратегий для терапии
таких болезней как рак, сердечнососудистые заболевания или
диабеты различной природы.
Такие белки пригодны в качестве
мишеней действия лекарственных
препаратов.
ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ
Современная биология стала источником огромных объемов экспериментальных
данных, осмысливание которых невозможно без использования эффективных
информационных технологий и методов компьютерного анализа и
математического моделирования
ИНТЕГРАЦИЯ КОМПЬЮТЕРНЫХ БАЗ ДАННЫХ И МОДЕЛИРОВАНИЕ
МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ СИСТЕМ И ПРОЦЕССОВ
Интеграция
баз данных по
метаболическим
путям и их
генетической
регуляции
ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ. TRRD - база данных
регуляторных районов генов эукариот: регуляторные районы гена аполипопротеина В
человека.
Энхансер в интроне 1
Регуляторная область в экзоне 1
Негативный регуляторный элемент
Энхансер в интроне 2
промотор
ARP-1
HNF-1
-898
-1802
-3678
Негативный регуляторный
элемент
-898
-129
-639
+1 +12
0
+346 +521 +621
+1064
+1
HNF-4
HNF-3
-125
COUP
C/EBP
TATA
-50
-100
COUP
AGGCCCGGGA GGCGCCCTTT GGACCTTTTG CAATCCTGGC GCTCT
-60
-70
-50
-90
-80
C/EBP
HNF-4
Композиционный элемент
ИЦиГ СО РАН, http://www.bionet.nsc.ru/trrd/
+1
ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ: базы данных по
межклеточным коммуникациям и путям передачи сигналов.
МАР-киназный путь передачи сигнала в ядро
клетки, активируемый ростовыми факторами,
контролирующий процесс КЛЕТОЧНОГО
ДЕЛЕНИЯ
Турнаев И. И., ИЦиГ СО РАН, http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
ИСТОЧНИКИ ИНФОРМАЦИИ ДЛЯ
РЕКОНСТРУКЦИИ ГЕННЫХ СЕТЕЙ
ИНФОРМАЦИЯ ИЗ КОМПЬЮТЕРНЫХ БАЗ ДАННЫХ
(ЭКСТРАКЦИЯ С ИСПОЛЬЗОВАНИЕМ
СПЕЦИАЛЬНЫХ ПРОГРАММ – КОНВЕРТОРОВ)
ЭКСПЕРИМЕНТАЛЬНЫЕ ДАННЫЕ,
ПРЕДСТАВЛЕННЫЕ В НАУЧНЫХ ПУБЛИКАЦИЯХ
(КОМПЬЮТЕРНАЯ АННОТАЦИЯ)
Компьютерная технология реконструкции
генных сетей: иерархия классов
Gene network
components
Elementary events
(Relationships
between the Entities )
Elementary
structures
(Entities)
Genes
RNAs
Proteins
Substances
Reactions
Regulatory
events
ГЕННАЯ СЕТЬ
Примеры элементарных структур и событий, значимых для
функционирования генных сетей
OAS mRNA
p48
NPY
Fe++
ISGF3alpha
ProtoIX
cytoplasm
FCH
NPY mRNA
OAS
ISGF3
Heme
nucleus
Транскрипция
nucleus
cytoplasm
Трансляция
Мультимеризация
cytoplasm
Энзиматический синтез
Объекты:
IFN-beta
IRF-2
IFNR-II
IRF-2
IRF-1
Inactive protein
Active protein
Jak1
mRNA
Gene
Reaction
Jak1-p
cytoplasm
Фосфорилирование
nucleus
IRF-2
Активация
транскрипции
nucleus
IFN-beta
Подавление
транскрипции
Switch on
Increase
- switch off
- decrease
Компьютерная технология формализованного описания,
конструирования и визуализации генных сетей:
редактор генных сетей GenNetEd.
Edit component
properties
Формализованное описание, конструирование и
визуализация генных сетей: скрытые слои
Gene network
“Macrophage activation”
Click
Subscheme“Jak-Stat signal
transduction payhway”
Основные типы генных сетей, описанных в базе данных
GeneNet: http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
X
Генные сети
стрессового ответа
X
Генные сети
гомеостаза
X0
X0 0
t
t
Генные сети,
контролирующие
процессы роста,
развития,
дифференцировки,
морфогенеза
X
X
Генные сети
циклических
процессов
X0 0
t
u(X-X0 )
Processes determining
the value of the output
system parameter
x0
-
NEGATIVE FEEDBACK
t
x
u(X)
Processes determining
the value of the output
system parameter
x0
+
POSITIVE FEEDBACK
x
База данных GENENET: центральный
фрагмент генной сети биосинтеза
холестерина в клетке
(регуляция по механизму отрицательной
обратной связи)
farnesyldip
hosphate
.…
squalene
.…
SS
FDFS
mevalonate
cholesterol
FDPS gene
-
SS gene
HMGCoA -R
+
HMG-CoA-R gene
+
+
X
SRP
X0
+
HMG-CoA
Принципиальная схема
регуляторного контура с
отрицательной обратной
связью
SREBP
HMG-CoA-S gene
HMGCoA -S
+
preSREBP
+
+
X0
-
LDLR gene
Acetyl CoA
t
u(X-X0)
+
Acetoacetyl CoA
Процессы, определяющие
величину выходного
параметра системы
Отрицательная обратная связь
cholesterol
LDLR
Игнатьева Е.В., ИЦиГ СО РАН, http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
X
ФРАГМЕНТ ГЕННОЙ СЕТИ
ДИФФЕРЕНЦИРОВКИ И СОЗРЕВАНИЯ
ЭРИТРОЦИТОВ (База данных GENENET)
+
+
+
+ +
+
Принципиальная схема
регуляторного контура с
положительной обратной
связью
X
X 0
t
u(X)
X0
Процессы, определяющие
величину выходного
параметра системы
+
Положительная обратная связь
Подколодная О.А., ИЦиГ СО РАН, http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
X
ИЕРАРХИЧЕСКАЯ ОРГАНИЗАЦИЯ
ГЕННЫХ СЕТЕЙ
Альтернативная репрессия и активация кассеты генов
с участием транскрипционного фактора E2F-1
на стадиях G1 S перехода
pRB
DP-1
E2F-1
-
сайт связывания E2F-1/DP-1
Подавление транскрипции
DP-1
E2F-1
+
сайт связывания E2F-1/DP-1
Усиление транскрипции
Подколодная
О.А.,Турнаев И.И.,
ИЦиГ СО РАН
http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
Транскрипционный фактор SF1 - центральный
регулятор генных сетей стероидогенеза
надпочечники, гонады
гипофиз
гипоталамус
РЕЦЕПТОРЫ
SF1
FSHR m
DAXm, h
LHR r
ACTHR m,h
SF1
SF1r
DAXm, h
LHR r
LHR r
GTHIIchs
холестерин
HO
GHAm, h
PRLR r
SF1r
GHRm, r
Lhbetar,b,ho,s
StaRm, h, b
альдостерон
Кортикостерон
HO HCO
OH
O
SF1r
O
Дезоксикортикостерон
Прогестерон
Aльдостерон
P450arom h, r
SF1
17-гидроксипрогестерон
HO
DAXm, h
P450c17 h, b, r
кортизол
Дегидроэпиандростерон
эстрон
андростендион
LeyILm
P450c11 m, b, r
OH
OH
MISm, h
OH
O
5-андростен-3
11-дезоксикортизол
OH
O
OH
O
17гидроксипрегнонолон
эстрадиол
тестостерон
http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
P450c21m
ALD1m
P450sccm, h, b, r
Игнатьева Е.В., ИЦиГ СО РАН
3betaHSD h
ФЕРМЕНТЫ
Генные сети – интеграторы:
генная сеть регуляции уровня свободных радикалов и активация
связанных с нею генных сетей в ходе противовоспалительного ответа
организма
Активные формы кислорода
Цитокины
Ответ на
тепловой шок
Антиоксида
нтная
защита
Метаболизм
железа
Арест клеточного
цикла
Апоптоз
Воспаление
http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/, Степаненко И. Л.,
ИЦиГ СО РАН
В зависимости от функционального
состояния организма одна и та же
генная сеть – интегратор
обеспечивает комбинаторную
активацию различных кассет генных
сетей.
Структура центрального
осциллятора генной сети
циркадного ритма
REV-ERBa
Reva-Erba
PER/CRY
E-box
Per 1,2
E-box
Cry 1,2
E-box
Rora
RORa
CLK/BMAL1
E-box
Bmal1
RRE
Коровая петля
Стабилизирующая петля
J.D.Richter, 2004, Neuron
ХАРАКТЕРИСТИКИ ЦЕНТРАЛЬНОГО И ПЕРЕФЕРИЧЕСКИХ
ОСЦИЛЛЯТОРОВ, ПОЛУЧЕННЫЕ НА ОСНОВЕ
ЭКСПРЕССИОННЫХ ДНК-ЧИПОВ: КОЛИЧЕСТВО ЦИКЛИРУЮЩИХ
ГЕНОВ И ФАЗОВЫЕ СДВИГИ
Супрахиазматическое
ядро
80-337
(0.6-2.7%)
Т ~ 4-8 часов
Печень
187-575
(2.7-9%)
F. Delaunay, TRENDS in Genetics, 2002
Сердце
462
(4.7%)
Эпифиз
38
(3.2%)
Ритмические биологические процессы
ФУНКЦИОНАЛЬНЫЕ КЛАССЫ ЦИКЛИРУЮЩИХ
ТРАНСКРИПТОВ В ФИБРОБЛАСТАХ,
ВЫЯВЛЕННЫЕ С ИСПОЛЬЗОВАНИЕМ
ЭКСПРЕССИОННЫХ ДНК-ЧИПОВ
трансляция
транскриционные 1%
факторы
неизвестная функция
транспортер
7%
1%
КЛЕТОЧНЫЙ ЦИКЛ
8%
7%
транскрипция
каналы
4%
4%
транспорт/перенос
6%
Clock белки
структура/цитоскелет
2%
6%
передача сигнала
ферменты
6%
13%
протеосомы
misc
6%
1%
EST's
прогормоны
22%
1%
белки теплового
шока/шапероны
4%
рецепторы сопряженные
с G-белком
1%
Grundschober C., 2001, J. Biol.
Chem.
ИНТЕГРАЦИЯ
ГЕННЫХ
СЕТЕЙ
ГОМЕОСТАЗА
ГЛЮКОЗНЫЙ СЕНСОР
База данных
GeneNet:
компьютерная
реконструкция
генной сети
регуляции
продукции
инсулина бета
клеткой
поджелудочной
железы
ПУТЬ СИГНАЛЬНОЙ ТРАНСДУКЦИИ ОТ
РЕЦЕПТОРА ИНСУЛИНА
Ядро
СЕКРЕЦИЯ
ИНСУЛИНА
РЕГУЛЯЦИЯ
ЭКСПРЕССИИ
ИНСУЛИНА
МЕТАБОЛИЧЕСКИЕ
РЕАКЦИИ
Игнатьева Е.В., Воронич Е.С. ,ИЦиГ СО РАН
Митохондрия
Цитоплазма
Клеточная мембрана
Межклеточное пространство
РЕГУЛЯТОРНЫЕ КОНТУРЫ С ПОЛОЖИТЕЛЬНЫМИ ОБРАТНЫМИ
СВЯЗЯМИ, ФУНКЦИОНИРУЮЩИЕ НА УРОВНЕ БЕТА-КЛЕТОК,
КОНТРОЛИРУЮТСЯ ОТРИЦАТЕЛЬНЫМИ ОБРАТНЫМИ СВЯЗЯМИ
ИЕРАРХИЧЕСКИ ВЫСОКОГО УРОВНЯ, ФУНКЦИОНИРУЮЩИМИ НА
УРОВНЕ ОРГАНИЗМА
Поступление
глюкозы
+
Уровень
глюкозы
в крови
_
+
Бета клетка
+
Транспорт глюкозы
в ткани о органы
+
Адипоцит
+
инсулин
+
+
БАЗА ДАННЫХ GENENET: ГЕННАЯ СЕТЬ АДИРОЦИТА
(РЕГУЛЯЦИЯ БИОСИНТЕЗА, ЗАПАСАНИЯ И МЕТАБОЛИЗМА
ЖИРОВ)
Внешниние
факторы
Настройка
функционирования
адипоцита
Секреция
сигнальных
веществ
Биосинтез
жирных
кислот
Глюкоза
Лептин
Компоненты
ренинангиотензиновой системы
ГОРМОНЫ:
•Глюкокортикоиды
•Инсулин
•и т.д.
ГЛАВНАЯ
ФУНКЦИЯ
H2C - OH
АДИПОЦИТА:
OH - C - H
ЗАПАСАНИЕ
H2C - O - P
ЭНЕРГИИ В ФОРМЕ
ЖИРОВ
(ТРИГЛИЦЕРИДОВ) ГЛИЦЕРОЛ-3-ФОСФАТ
O
H2C - O - C - R`
+
3 (R - COOH)
O
R-C-O-C-H
H2C - O - C - R``
O
ЖИРНЫЕ КИСЛОТЫ
ТРИАЦИЛГЛИЦЕРИД
Адипоцит: индукция экспрессии генов инсулином
(база данных GENENET)
ИНСУЛИН стимулирует
экспрессию:
FAS -синтетаза жирных кислот,
осуществляет биосинтез
насыщенных жирных кислот
SCD1 - стеароил-КоА-десатураза,
участвует в синтезе
ненасыщенных жирных жирных
кислот
SCD1
Ob (лептин), гормон,
регулирующий пищевое
поведение
FAS
ИНСУЛИН
Проскура А.Л., Игнатьева Е.В. ИЦиГ СО РАН,
http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
OB
AGT
Leptin
AGT
ПУТИ ПЕРЕДАЧИ СИГНАЛА ГОРМОНА ЛЕПТИНА И МУТАЦИИ,
ВЫЗЫВАЮЩИЕ НАКОПЛЕНИЕ ИЗБЫТОЧНОЙ МАССЫ ТЕЛА
+
Лептин
РЕЦЕПТОР
ЛЕПТИНА
-
POMC
+
NPY
+
PROHORMONE
CONVERTASE 1
MSH
РЕЦЕПТОР MSH
ГИПОТАЛАМУС
+
+
ЖИРОВАЯ КЛЕТКА
+
ПОТРЕБЛЕНИЕ ПИЩИ
МУТАЦИИ
NPY - НЕЙРОПЕПТИД Y
MSH - МЕЛАНОКОРТИН
POMC - ПРООПИОМЕЛАНОКОРТИН
Barsh G. et al., Genetics of body-weight regulation, Nature, 2000, N6778
Адипоцит: индукция экспрессии генов
глюкокортикоидами (база данных GENENET)
ГЛЮКОКОРТИКОИДЫ
стимулируют экспрессию:
SCD1 - стеароил-КоАдесатураза, участвует в
синтезе ненасыщенных
жирных жирных кисло
ГЛЮКОКОРТИКОИДЫ
Ob (лептин), гормон,
регулирующий пищевое
поведение
SCD1
AGT – (ангиотензиноген),
предшественник
ингиотензина II,
регулирующего давление
крови
FAS
OB
Проскура А.Л., Игнатьева Е.В. ИЦиГ СО
РАН, http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
AGT
Leptin
AGT
Фрагмент генной сети адипоцита: глюкокортикоиды
активируют экспрессию генов ренин-ангиотензиной
системы (база данных GENENET))
ДЕКСАМЕТАЗОН
OB
CTSD
AGT
REN
ACE
Глюкокортикоиды
активируют
транскрипцию гена
AGT, кодирующего
ангиотензиноген предшественник
ингиотензина II,
повышающего
артериальное
давление.
CTSG
ЦИКЛИН Д1
ПРОЛИФЕРАЦИЯ
Leptin
АПФ
РЕНИН
Leptin
АНГИОТЕНЗИН II
АНГИОТЕНЗИН I
КАТЕПСИН Ж
АНГИОТЕНЗИНОГЕН
КАТЕПСИН Д
ИЦиГ СО РАН, Проскура А.Л., Игнатьева Е.В. , http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
СЕТИ РНК-РНК ВЗАИМОДЕЙСТВИЙ: микро-РНК
[Calin
G. et all., PNAS (2003)]
H. sapiens - эффекты миРНК
Головной мозг
Щитовидная
железа
Легкие
Печень
Кишечник
Костный
мозг
регуляция гемопоэза;
•регуляция развития мозга.
Список
патологий,
возникающих при нарушении
функционирования миРНК:
•лейкемия;
•нейробластома;
•фолликулярная лимфома;
•пролимфоцитарная лейкемия;
•миелодиспластический
синдром;
•рак:
кожи;
легких;
носоглотки; шейки матки;
молочной железы; толстого
кишечника;
эпителия
мочевыводящих путей.
D. melanogaster [Chen C. et al., Science
303, 83 (2004)]:
широкий спектр действия миРНК
•стимулирует пролиферации клеток
(miR-bantam);
•предотвращает апоптоз (miR-14, miRbantam);
•влияет на жировой метаболизм (miR14).
lin-4
let-7
C. elegans:
•миРНК контролируют переход
между личиночными стадиями
[Chen C. et al., Science 303, 83
(2004)];
•асимметричное расположение
нейронов (Isy-6) [Miska E. et all.,
Genome biology (2004)].
Минимальные оценки: в геномах
млекопитающих имеется до 200
микро-РНК. Каждая микро-РНК
может иметь до 100 геновмишеней. В целом сеть микроРНКвзаимодействий может включать
до 20 000 генов.
КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ ДИНАМИКИ
ГЕННЫХ СЕТЕЙ: ХИМИКО-КИНЕТИЧЕСКИЙ ПОДХОД
Примеры формального описания элементарных процессов
Генные сети: решение обратной задачи
• Математическая модель генной сети характеризуется набором констант c1, …,ck
в системе дифференциальных уравнений.
• Как правило, экспериментально измеренные значения известны только
для ограниченного числа констант.
• Значения остальных констант определяются численно.
• Ищутся такие значения констант c1, …,ck, которые обеспечивают максимальное
соответствие между рассчитанной и экспериментально наблюдаемой динамикой
генной сети по множеству переменных и множеству экспериментов одновременно.
Здесь i – это номер эксперимента и j(i) – номер j-го наблюдения i-го эксперимента. Xijexp – это значение
переменной генной сети, измеренной в j-ом наблюдении i-го эксперимента. Xijtheor (c1,…,ck) - это же
значение, вычисленное с фиксированными значениями коэффициентов c1,…,ck
Эксперимент 1
Эксперимент N
2.50
250
X1 2.00
Xn 200
1.50
150
1.00
100
0.50
50
0
0.00
0
50
100
150
0
модель
min
F c1 ....ck
X
i , j (i )
0.5
1.0
1.5
эксперимент
ij
exp
X
ij
theor
(c1 ,..., ck )
2
РЕШЕНИЕ ОБРАТНОЙ ЗАДАЧИ ДЛЯ ГЕННОЙ СЕТИ:
генетический алгоритм
МУТАЦИОННЫЙ ПРОЦЕСС
РЕКОМБИНАЦИИ
Отбор
Начальная
популяция генных
сетей: не все
константы c1,…, ck
известны
Целевой функционал: W=1/F, где
Генная сеть с
оптимальными
значениями
коэффициентов
c1,…,ck
W – приспособленность организма в определенных условиях;
F – среднеквадратическое отклонение вычисленных характеристик от
соответствующих им экспериментальных
База данных для решения обратной задачи:
экспериментальная динамика генных сетей
General information
Type
Name_brief
Name_full
Organism
Cells
StageCellDifferentiation
OrganismStatus
ExpressionDetectionDevice
Reference
Comments
Data on dynamics
Protein
IL-12
Interleukin-12
Mouse – mus musculus
Peritoneal macrophages
Terminally differentiated
Norm
Relative protein level
Nomura F. et al., 2000
C57BL/6J mice
Peritoneal macrophages were preincubated with LPS for
the indicated periods, then washed with HBSS twice, and
then stimulated with LPS.
T im e
P o in tO f
ID
1
LPS
2
LPS
2
LPS
3
…
C o n c e n tra tio
n%
0
1
2
3
4
5
6
7
8
0
6
7
9
12
18
30
30
30
h o u rs
h o u rs
h o u rs
h o u rs
h o u rs
h o u rs
h o u rs
h o u rs
h o u rs
0 .0
3 0 .6
4 .6
4 .0
2 .8
2 .7
0 .2
0 .3
1 .9
S ta n d a rt
E rro r
Extracellular space
T im e
ID
U n its
M e a su re m e n t
Experimental conditions
E x te rn a l
F a c to r
P ro d u c t
C o n c e n tra tio n
LPS
IL-12
S p e c ific a tio n
E sche rich ia
co li O 55 :B 5
E sche rich ia
co li O 55 :B 5
E sche rich ia
co li O 55 :B 5
…
(in itia l
p o int)
(e xp o su re
tim e )
U n its
V a lue
U n its
0
6
h ou rs
10
n g /m l
0
1
h ou rs
1 00
n g /m l
1
7
h ou rs
10
n g /m l
…
…
…
…
…
Сytoplasm
IL-12p40
IL-12p35
Nucleus
Генная сеть активации макрофагов
при действии липополисахаридов
(LPS) и интерферона-γ (IFN-γ)
Обратная задача генных сетей:
динамика концентрации
транскрипционного фактора АР-1
Сравнение экспериментальных данных
(Hambleton J., et al, 1996) и результатов
расчетов модели после адаптации
параметров.
http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
ОПТИМАЛЬНОЕ ФАРМАКОЛОГИЧЕСКОЕ УПРАВЛЕНИЕ
ФУНКЦИЕЙ ГЕННЫХ СЕТЕЙ
Поиск оптимального управления, нормализующего динамику генной сети
биосинтеза NO при мутации, приводящей к избытку рецептора CD14).
35
NO (10^8 unit/cell)
30
25
20
15
10
5
0
0
5
10
15
t (hours)
Mutation
Norm
Compensatory effect (after delivering the substance)
20
25
30
Моделирование влияния мутаций на функцию генной сети
регуляции биосинтеза холестерина в клетке
Моделирование отклика генной сети на увеличенное в 2 раза поступления ЛНП в плазму крови при
мутации, уменьшающей скорость экспрессии гена ЛНП рецепторов в 2 раза
3.2E+04
норма
мутация
4.0E+05
3.0E+05
2.0E+05
1.0E+05
часы
0.0E+00
норма
мутация
3.1E+04
3.0E+04
2.9E+04
2.8E+04
2.7E+04
2.6E+04
часы
2.5E+04
0
[св. ЛНП рецепторы], шт/клетку
[св. холестерин], шт/клетку
[ЛНП], шт/объем клетки
5.0E+05
5
10
15
20
25
30
0
Рецепторы
ЛНП
1.0E+03
5
10
НОРМА
15
20
25
МУТАЦИЯ
норма
мутация
8.0E+02
6.0E+02
4.0E+02
2.0E+02
часы
0.0E+00
0
5
10
15
20
25
30
мРНК ЛНП
рецепторов
30
Анализ мутационного портрета генной сети
регуляции биосинтеза холестерина в клетке
Изменение содержания свободного холестерина в клетке в зависимости от мутационного
изменения констант элементарных процессов в генной сети биосинтеза холестерина
free cholesterol
cholesterol content,
free
content,
relative to the norm
%%relative
norm
210
180
150
120
90
60
30
0
2
4
15-20%
65-70%
200%
3
1
-4
-4
-3
-3
-2
-2
-1
-1
00
11
22
33
44
norm)
thenorm)
ln(Ki
ln(Kiunder
under aa mutation/Ki
mutation/Ki inin the
(1) Константа оборота фермента SRP;
(2) Константа обратной реакции димеризации SREBP1;
(3) Константа Михаэлиса-Ментен фермента ацетоацетил КоА тиолазы;
(4) Константа оборота фермента АХАТ (ацил-КoA: холестерин ацилтрансфераза)
Анализ мутационного портрета генной сети
регуляции биосинтеза холестерина в клетке
ГЕННАЯ СЕТЬ С УКАЗАНИЕМ ЧУВСТВИТЕЛЬНОСТИ СТАЦИОНАРНОГО
СОДЕРЖАНИЯ СВОБОДНОГО ХОЛЕСТЕРИНА В КЛЕТКЕ К МУТАЦИОННЫМ
ИЗМЕНЕНИЯМ ПАРАМЕТРОВ
- изменение скоростей
данных процессов в
значительной степени
сказывается на
стационарной концентрации
холестерина, которая может
меняться от 0 до более чем
200% относительно нормы;
- стационарная
концентрация холестерина
меняется не более чем на
35% от нормы;
- стационарная
концентрация холестерина
меняется не более чем на
25% от нормы.
ЦЕНТРАЛЬНЫЙ ФРАГМЕНТ ГЕННОЙ СЕТИ
БИОСИНТЕЗА ХОЛЕСТЕРИНА В КЛЕТКЕ
farnesyldiphos
phate
.…
squalene
.…
SS
FDFS
mevalonate
cholesterol
-
FDPS gene
SS gene
HMGCoA -R
HMG-CoA-R gene
+
+
SRP
+
HMG-CoA
+
SREBP
HMG-CoA-S gene
+
HMGCoA -S
preSREBP
LDLR gene
+
Acetyl CoA
+
+
cholesterol
Acetoacetyl CoA
LDLR
Игнатьева Е.В., ИЦиГ СО РАН, http://wwwmgs.bionet.nsc.ru/mgs/gnw/genenet/
ОПТИМАЛЬНОЕ ФАРМАКОЛОГИЧЕСКОЕ УПРАВЛЕНИЕ
ФУНКЦИЕЙ ГЕННЫХ СЕТЕЙ
Мишенями оптимального фармакологического
управления могут быть только лимитирующие звенья
генной сети. Их не так много. Построение мутационного
портрета генной сети – обязательный этап поиска
оптимального фармакологического управления.
Оптимальное управление, нормализующее критическую
переменную генной сети, не должно выводить генную
сеть за границы нормы по другим значимым
переменным.
dV = (V, a)
dt
Оптимальное
фармакологическое
управление функцией генных
сетей
N - NORM
V – вектор переменных;
a – вектор параметров
(a1,…,ak,…, ar);
N- стационарное состояние,
соответствующее норме.
U – оптимальный контроль,
нормализующий функцию
генной сети за счет сдвига
стационарного состояния
мутантной генной сети в
окрестность нормы.
ak
a*k
U - класс кусочно-линейных
управляющих функций,
описывающих изменение
вектора параметров a в
процессе фармакологического
контроля)
dV = (V, a*)
dt
V – вектор переменных;
a – вектор параметров
(a1,…,a*
* k,…, ar);
N- стационарное состояние,
соответствующее патологии.
dV = (V, a*, U)
dt
P - PATHOLOGY
Оптимальное управление, нормализующее критическую переменную генной сети, не должно
выводить генную сеть за границы нормы по другим значимым переменным.
Automatically generated computer model of cell metabolism
of Escherichia coli K-12
Bipartite graph of computer
dynamic model of cell
metabolism, with specification
to the organism
Escherichia coli K-12
-
4036
dynamic
variables (substrates)
-
3973
processes
(enzyme reactions)
- participation in the process
with nonzero stehiometry
- participation in the process
with zero stehiometry
ИСКУССТВЕННЫЕ ГЕННЫЕ СЕТИ:
КОМПЬЮТЕРНЫЙ ДИЗАЙН И
ЭКСПЕРИМЕНТАЛЬНОЕ
КОНСТРУИРОВАНИЕ
белковый
мультимер
Генетический элемент (g) – элементарная структурная
белок
единица ГГС
Функционирование генетического элемента - синтез белка
Активность генетического элемента – скорость синтеза
белка
Продукт (p) – белок, кодируемый g
p
мРНК
ген
g
Регуляторная связь () - элементарная единица
искусственной генной сети, посредством которой
устанавливается регулирование активности одного
генетического элемента (g2), другим генетическим
элементом (g1)
g1
g2
ИСКУССТВЕННЫЕ ГЕННЫЕ СЕТИ: КОМПЬЮТЕРНЫЙ ДИЗАЙН И
ЭКСПЕРИМЕНТАЛЬНОЕ КОНСТРУИРОВАНИЕ
14
34
24
23
12
В зависимости от начальных данных эта генная сеть
имеет два качественно различных режима
функционирования.
41
УСТОЙЧИВЫЙ ЦИКЛ:
43
31
p3
g3
g4
концентрации
g2
p1
3
42
g1
Устойчивый циклический режим
p2
2
1
p4
время
0
0
5
10
74.8
79.8
84.8
Устойчивое стационарное состояние
УСТОЙЧИВОЕ
СТАЦИОНАРНОЕ
СОСТОЯНИЕ:
концентрации
6
p4
4
p1
2
р2,р3
0
0
5
время
10
ГЕНЕТИЧЕСКИЕ КОМПЬЮТЕРЫ:
искусственная генная сеть, суммирующая
четырех-разрядные двоичные числа
1010
+
110
_____
10000
1+0+1=10
1+1+0=10
0+0=00
0+1+1=10
ИНФОРМАЦИОННЫЙ ВЗРЫВ В МОЛЕКУЛЯРНОЙ БИОЛОГИИ И ГЕНЕТИКЕ
Расшифрованы геномы десятков тысяч вирусов, тысяч
бактерий, геном дрожжей, геномы ряда растений и животных
Расшифрованы
аминокислотные
последовательности
сотен тысяч белков
Расшифрованы
пространственные
структуры десятков
тысяч белков
PDBSite: A Database on Protein Active Sites and
Their Environment
PDB
PDBSite
Site environment
Active site
Содержание базы данных
PDBSite
Фармакологические
препараты (50)
Каталитические
центры (1300)
Белок+ДНК (2700)
Сайты связывания
Белок+РНК (2000)
~15000 сайтов
Посттрансляционная
модификация (100)
Органические
лиганды (2100)
Металлы (1000)
Белок+белок (1000)
Неорганические
лиганды (400)
ИНСТИТУТ ЦИТОЛОГИИ
И ГЕНЕТИКИ
Программа поиска активных сайтов
в структурах белков: PDBSiteScan
Поиск сайта связывания меди в молекуле пластоцианина (PDB ID 1BXU).
Структура
пластоцианина
Шаблоны сайтов
(PDBSite)
Зеленым цветом изображены остатки распознанного сайта в
пластоцианине, синим цветом изображены остатки сайта-шаблона из
базы PDBSite (ID 1B3ICU). Ион меди показан оранжевым шариком.
ИНСТИТУТ ЦИТОЛОГИИ
И ГЕНЕТИКИ
МОЛЕКУЛЯРНЫЕ МЕХАНИЗМЫ НАРУШЕНИЯ ФУНКЦИИ
МУТАНТНОГО БЕЛКА P53, ПРИВОДЯЩИЕ К РАЗВИТИЮ РАКА
SubstitutionGly245->Cys
Cys242
Cys176
Zn2+
Cys238
His179
Zn-binding site
Normal DNA-binding
Адаптивная эволюция : мутационное ускользание вируса от иммунной
системы
Сайты связывания ионов в пространственной структуре гемагглютинина вируса гриппа А
человека совпадают с участками адаптивной эволюции
PO4-связывающий
SO4-связывающий
Ca-связывающий
Cl-связывающий
Области адаптивной
эволюции выделены
овалами
Предложен новый механизм
эволюционной защиты
оболочечных белков вируса
гриппа от действия антител
– формирование ионных
«шуб» в области антигенных
детерминант, обусловленное
возникновением сайтов
связывания различных
ионов.
ИНСТИТУТ ЦИТОЛОГИИ
И ГЕНЕТИКИ
WebProAnalyst: программа для количественного анализа взаимосвязи
структура-активность в семействах гомологичных белков
http://wwwmgs.bionet.nsc.ru/mgs/programs/panalyst/
Множественное выравнивание последовательностей белков
Активности
подвижная рамка
y1
y2
y3
y4
y5
белок 1
белок 2
белок 3
белок 4
белок 5
сайт
От аминокислот к их
физико-химическим свойствам
x1
x2
x3
x4
x5
Поиск статистической
зависимости Y = F(X)
Физико-химическая
характеристика сайтов
ИНСТИТУТ ЦИТОЛОГИИ
И ГЕНЕТИКИ
Количественные зависимости структура-активность в белковых
семействах
Зависимость между ингибирующей слипание тромбоцитов активностью дезинтегринов и
зарядом и альфаспиральным моментом гидрофильности сайта 26-30
2.7
Предсказанная
2.5
2.3
2.1
1.9
1.7
1.5
1.5
2
2.5
3
Измеренная активность
Зависимость между антимикробной активностью пептидов и альфаспиральным моментом
гидрофобности сайта 3-18
6
Предсказанная
5
4
3
2
1
0
0
2
4
6
Измеренная активность
ИНСТИТУТ ЦИТОЛОГИИ
И ГЕНЕТИКИ
8
Предсказание видимого спектра для зрения археозавра
(λmax предкового родопсина археозавра)
Рисунок взят из работы Chang et al., Mol. Biol. Evol. 19(9):1483–1489. 2002
ИНСТИТУТ ЦИТОЛОГИИ
И ГЕНЕТИКИ
Предсказание λmax для родопсина археозавра
508
R=0.97
505
Предсказанные λmax
Остатки влияющие на сдвиг
длины волны, результаты
согласуются с данными других
авторов Briscoe, Mol. Biol.
Evol. (2001).
502
499
496
493
490
490
493
496
499
502
505
508
Экспериментальные λmax
Уравнение регрессии:
Y=15.784*X1-467.266*X2-37.661
X1 – Среднее значение для изоэлектрической точки (Bogard)
X2 – Момент гидрофобности (Eisenberg)
λmax предсказанное : Y= 506.7
λmax измеренное:
Y= 508
ИНСТИТУТ ЦИТОЛОГИИ
И ГЕНЕТИКИ
ИНСТИТУТ ЦИТОЛОГИИ
И ГЕНЕТИКИ
Документ
Категория
Презентации по химии
Просмотров
22
Размер файла
11 041 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа