


вход по аккаунту


Гены, стрессы, демография

код для вставкиСкачать
Гены, стрессы, демография
Светлана Александровна Боринская, ведущий научный сотрудник
Института общей генетики им Н.И. Вавилова РАН
22 марта 2012
Геномные технологии:
Узнать как устроено,
(идентификация, диагноз)
Управлять молекулярными
процессами (лечение)
ДНК как текст
Генетики могут читать нуклеотидные тексты (10-40 тыс руб за ген) или
разглядывать отдельных буквы в этом тексте (150 руб за букву)
Сочетание букв или полосочек на геле – генетический
идентификатор, «имя» организма, сорта или вида
Смертность в странах Балтии была близка к российской по
уровню и по тенденциям до середины 1990-х, а затем резко
приняла «европейские» тенденции. Данные приведены для
мужчин, аналогичная картина для женщин
Анатолий ВИШНЕВСКИЙ Сбережение народа на фоне депопуляции Демоскоп Weekly № 417 – 418 5 - 18
апреля 2010
Продолжительность жизни и смертность – показатели,
характеризующие благополучие страны.
Как показано в многочисленных российских и зарубежных
исследованиях, основной причиной низкой продолжительности жизни
россиян является злоупотребление алкоголем
Амартия Сен - Лауреат
Нобелевской премии 1998
«За вклад в экономическую
теорию благосостояния».
снизилось во время антиалкогольной компании, и было связано со
снижением смертности и ростом продожительности жизни
Экспертная оценка
А.В. Немцов
смертность в
Госкомстат РФ
Оценка реального потребления алкоголя в России в 1970-1999
1 - V.Treml для 1970-1980; 2 - средняя оценка данных Госкомстата РФ, В. Тремла и А. Немцова для 1980-1994; 3 - А. Немцов для 1998-1999; 4 - Госкомстат РФ. Регистрируемое потребление
алкоголя; 5 - начало антиалкогольной кампании, 6 - начало рыночных реформ.
А.В. Немцов
смертность в
1980-1990-е годы
Ижевское семейное исследование 2003-2010
Ижевское исследование семей представляет популяционное исследование
(по схеме случай-контроль) потребления алкоголя и смертности мужчин в
типичном российском городе. “Случаи” были представлены мужчинами,
скончавшимися от любых причин в период 2003-2005 гг. Почти половина
смертей этих мужчин была связана с злоупотреблением алкоголем.
Контрольная группа мужчин была отобрана случайным образом из
городского населения с учетом выравнивания по возрасту изученным
случаям смерти. Исследование проведено проф. Дэвидом Леоном в 2006 г.
совместно с российскими медиками
Leon D.A. et al. Hazardous alcohol drinking and premature mortality in Russia: a population
based case-control study. // Lancet 2007;369(9578):2001-9
Андреев Е.М. Злоупотребление алкоголем и преждевременная смертность в России на
примере Ижевска.// Наркология 2008
Материал исследования
(предоставлен проф. Д.Леоном):
образцы крови 1000 мужчин в возрасте 28-59
лет, для которых установлен характер
потребления алкоголя по данным опроса
85% употребляли алкоголь за предшествующий опросу год,
из них
79% употребляют водку и другие крепкие напитки,
23% имеют похмелье один или более раз в месяц;
11% потребляют алкоголь более 5 раз в неделю;
10% имели один или более запоев за предшествующий год;
6% употребляют непитьевой алкоголь (суррогаты);
4% состоят на учете в наркологическом диспансере.
D.Leon et al., Hazardous Alcohol Drinking and Premature Mortality in
Russia: a Population Based Case-Contro Study // Lancet, 2007.
Этническая структура изученной группы мужчин
Потребление алкоголя в изученной группе
50% мужчин
потребляют 90% всего
выпиваемого в России алкоголя
50% мужчин
потребляют 10% всего алкоголя
Leon D.A. et al. Hazardous alcohol drinking and premature mortality in Russia: a population
based case-control study. // Lancet 2007;369(9578):2001-9
Гены влияют
и на риск злоупотребления алкоголем,
и на выпиваемое количество алкоголя
Выявлены две группы генов,
ассоциированные с риском развития
- Гены, контролирующие метаболизм алкоголя
- Гены, контролирующие функции мозга
Алкоголь и альдегид разрушается ферментами.
У разных людей они работают с разной скоростью.
предковый аллель
предковый аллель
Ацетальдегида много, окисляется медленно
Географическое распределение эволюционно молодых вариантов генов
быстро превращающих алкоголь в яд и медленно этот яд разрушающих
Borinskaya et al. Distribution of
the Alcohol Dehydrogenase
ADH1B*47His Allele in Eurasia.
American Journal of Human
Genetics. 2009, 84:89-92.
Li, Borinskaya et al. Refined
Geographic Distribution of the
Oriental ALDH2*504Lys Variant //
Annals of Human Genetics. 2009,
Географическое распределение частот аллелей
ADH1B* «быстрый»
ALDH2 «медленный»
Гены влияют на количество и характер употребления алкоголя
Но социальные факторы влияют сильнее.
Эти факторы нужно совместно изучать
биологам медикам и социологам,
чтобы эти знания помогли снизить нагрузку
злоупотребления алкоголем
на индивида, семью и общество
Гены при введении «полусухого закона»
в 1985 г. не изменились,
а пить население стало меньше
А.В. Немцов
смертность в
1980-1990-е годы
Кто выпивает больше всех? Кто в группе риска?
Бедные пьют много. Но и богатые тоже пьют.
Структура потребления алкоголя в зависимости от дохода,
в пересчете на грамм этанола в день
Граммы этанола в день
в составе разных напитков
Уровень доходов (децили)
Потребление алкогольных напитков в зависимости от дохода, разделенного на 10 групп
(Андриенко и Немцов, 2005 ,
Образованные люди пьют меньше
Доля индивидов с опасными стилями потребления алкоголя в
группах мужчин с разным уровнем образования
Доля мужчин в группе, %
- Неполное
- Среднее
- Высшее
Леон Д. и соавт. Демоскоп Weekly. 2006. № 265-266
Ожидаемая продолжительность
Образованные россияне пьют меньше, а живут дольше.
Падение продолжительности жизни в России произошло у людей со
средним и неполным средним образованием, не затронув людей с высшим
образованием. Для сравнения -в Финляндии у всех категорий населения
продолжительность жизни выросла.
Ожидаемая продолжительность жизни 30-летних мужчин в России и Финляндии
(Shkolnikov et al., J Epidemiol Community Health 2006, 60:875–881).
Скорость роста продолжительности жизни у наиболее образованных людей
России почти такая же, как в Европе – примерно 0.2 года в год. Чем выше
уровень образования – тем больше продолжительность жизни.
Продолжительность жизни членов РАН на 13 лет больше, чем остальных
россиян (для мужчин, для женщин-академиков не подсчитано).
Члены и членкоры
Академии наук
Ожидаемая продолжительность жизни мужчин в возрасте 50 лет
Е.Андреев. Продолжительность жизни российских академиков Демоскоп, 2007.
Здоровые дети – будущее страны, главный «ресурс»
Возраст, лет
•Численность женщин репродуктивного
(15-49 лет) в перспективе будет
стабильно снижаться,
с 38,1 млн. человек в 2009, к 35,4 млн. в
2015 году , и 33,26 млн. в 2025 году
•Численность женщин 20-29 лет, на
которую приходится 65% всех
рождений, уменьшится с 12,2 млн. в
2010 году до 7 млн. в 2025 году.
•Росстат прогнозирует в 2025 году
значительное сокращение числа
Какая часть из них будет здорова?
Фетальный алкогольный синдром
Координационный Совет по профилактике
злоупотребления алкоголем и ФАС
от которых зависит способность к обучению (образованию новых нервных связей), память,
мотивация etc.
В формирование психических особенностей вовлечены гены
(рецепторы нейромедиаторов, траспортеры и др.),
контролирующие передачу нервного импульса в ЦНС
.... ctgcaccccccagcatcccccc
о наличии
reports of depression
symptoms, age 26
Stressful иLife
о депрессии
в возрасте
26 лет в зависимости
and self-reports
of depression
по гену транспортера
26, as a function
ген (гомозиготы)
высокоактивный ген
(гомозиготы )
5-HTT gene
SS, n = 146
SL, n = 435
LL, n = 264
groups of individuals
numbers of условия
life events, ages
Caspi et al., Science 2003
Однонуклеотидная замена T=>Ц в гене МАОА в семье с
частым агрессивным поведением мужчин
Х-сцепленное наследование
•Нападение с целью
нанесения повреждений
Низкая активность МАОА
n=163 чел.
Высокая активность МАОА
n=279 чел.
•Нападение на женщину
•Жестокость по
• к животным
Возможно Тяжелые
Caspi et al.
Гены и реакция на стресс
До 30% вклада в развитие гипертонии дают
различия реакций на психологический стресс
Острый и хронический стресс
повышают риск развития сердечно-сосудистых, онкологических и
некоторых психических заболеваний
Гены модулируют влияние стресса на уровень смертности
В случае высокого уровня социального стресса и депрессии у
индивидов определенной генетической конституции
(генотип IL6 GG-174) повышен риск смерти от причин, связанных с
воспалением (сердечно-сосудистых, онкологических, болезни
Альцгеймера). Без стресса этот генотип нейтрален [Cole et al., 2010].
The Nature of Stress
János Selye 1907, Вена – 1982, Монреаль
Nature 138, 32-32 (04 July 1936)
A Syndrome produced by Diverse Nocuous Agents
EXPERIMENTS on rats show that if the organism is severely damaged by
acute non-specific nocuous agents such as exposure to cold, surgical injury,
production of spinal shock (transcision of the cord), excessive muscular
exercise, or intoxications with sublethal doses of diverse drugs (adrenaline,
atropine, morphine, formaldehyde, etc.), a typical syndrome appears, the
symptoms of which are independent of the nature of the damaging agent or
the pharmacological type of the drug employed, and represent rather a
response to damage as such.
>300 000 цитирований работ Селье по стрессу
“the non-specific response of the body to any demand placed upon it.”
What stress is not
What stress is
1.Stress is not nervous tension.
At this point it will be helpful to discuss two apparent
2. Stress is not that which causes a secretion by the objections to accepting the concept of a single
adrenal cortex of its hormones (the corticoids). stereotyped response to stress:
ACTH, the adrenal-stimulating pituitary
1. Qualitatively different agents of equal toxicity or
hormone, can discharge these hormones
stressor potency do not necessarily elicit exactly the
without producing any evidence of stress.
same reactions in different people.
2. Even the same degree of stress, induced by the same
4. Stress is not the nonspecific result of damage only. agent, may produce different effects and even lesions in
Normal and even pleasant activities - a game of different individuals.
tennis or a passionate kiss - can produce
3. The effects specific to any given agent usually
considerable stress without causing
modify the effects and manifestations of the general
conspicuous damage.
stress syndrome. (thus, it took many years to recognize
5. Stress Is not the deviation from homeostasis...
and prove the existence of the latter.)
10. Stress is not necessarily undesirable. It all
4. The fact that the state of stress, even if due to the
depends on how you take it. The stress of
same agent, can cause different effects in different
failure, humiliation, or infection is detrimental; individuals, has been traced to "conditioning factors"
but that of exhilarating, creative, successful
that can selectively enhance or inhibit one or the other
work is beneficial. The stress reaction, like
stress effect. This conditioning may be endogenous
energy consumption, may have good or bad
(genetic predisposition, age or sex) or exogenous
(treatment with certain hormones, drugs, or dietary
11. Stress cannot and should not be avoided. However, stressors are not exclusively physical in
Nevertheless, stress has a very clear, tangible form. nature. Emotions, e.g., love, hate, joy, anger, challenge
have of
and fear, also call forth the changes characteristic of the
Dr. Hans
The Nature
Stresssuffered or
benefited from it
stress syndrome.
Неспецифическая реакция на любое неблагоприятное воздействие
Роберт Гук (XVII век) – использовал термин «стресс» для объектов,
испытывающих нагрузку и сопротивляющихся ей (мостов и др.)
Cannon (1926) – ввел терминd «гомеостаз», подчеркивал активность
симпатической нервной системы и гипофиза в восстановлении нарушений
гомеостаза, вызыванных внешними воздействиями (внешним «стрессом»).
Описал реакцию «бей или беги» ( fight-or-flight-or-freeze
response, hyperarousal, the acute stress response) — состояние при котором
организм мобилизируется для устранения угрозы
Selye – описал общий адаптационный синдром, определяя его как
неспецифический ответ, возникающей независимо от природы воздействия,
и исследовал роль гипоталамо-гипофизарно-адренальной системы, позже
применив термин «стресс» для его обозначения
Различные определения стресса:
Вредное (или просто сильное) воздействие (стрессор)
Физиологическая реакция на действие стрессора
Сильные психологические переживания
Проявление и мера неспецифической активации организма.
Стрессовая реакция может возникать как на неблагоприятные, так и на
позитивные события
В момент опасности
адреналин и норадреналин
способствуют немедленным
физическим реакциям, связанным
с подготовкой организма
к повышенной активности
Увеличение сердцебиения, частоты дыхания
Ослабление поверхностного кровообращения (бледность кожных покровов), повышение
свертываемости крови предотвращают потерю крови при возможных повреждениях
поверхностных тканей
Сужение кровеносных сосудов во многих частях тела
Повышение кровяного давления, в сочетании с расширение кровеносных сосудов в мышцах
Повышение уровня сахара и мобилизация жиров (ресурс для предполагаемой работы мышц)
Замедление или прекращение пищеварения, ослабление перистальтики кишечника
Остановка слюноотделения и выработки слезной жидкости
Ускорение спинальных рефлексов
Повышенное потоотделение
Подавление эрекции
Аудиторная избирательность или потеря слуха
Туннельное зрение (утрата периферического зрения)
Расширение зрачков
Сужение сознания - концентрация на источнике опасности, что позволяет частично или полностью
игнорировать не относящиеся к нему сигналы: посторонние звуки, движения на периферии зрения
и т.п.
При чрезмерной силе или длительности
стрессового ответа нарушаются функции
организма и самих адаптационных
Развитие соматической и психологической
декомпенсации происходит по механизму
«слабого звена», когда не выдерживает нагрузки
одна из стресс зависимых систем
Увеличение сердцебиения,
повышение кровяного давления
повышение свертываемости крови
Гипертония, повреждения сердечнососудистой системы, инфаркты,
Мобилизация жиров
Гиперлипидемия, риск
атеросклеротических изменений
Повышение уровня сахара
Изменение гемодинамики и тонуса
мускулатуры кишечника
Сужение сознания - концентрация
на источнике опасности, что
позволяет частично или полностью
игнорировать не относящиеся к
нему сигналы
Гипергликемия, диабет II
Повреждение слизистой ЖКТ, язвенная
ПТСР, панические атаки, иные
психические расстройства
Стадии развития стрессового ответа:
•мобилизация адаптационных возможностей
•стадия сопротивляемости
•стадия истощения
Иммунная система
Эндокринная система
Изменения уровня экспрессии генов
у соискателей степени PhD до и после защиты диссертации
Показаны изменения экспрессии 519 мРНК. Нормировано на уровень
экспрессии за 4 недели до защиты. Выявлено 70 генов, экспрессия которых
меняется сходным образом у всех испытуемых - в основном гены цитокинов и
их рецепторов, белков, участвующих в апоптозе и ответе на тепловой шок.
Rokutan et al. Gene expression profiling in peripheral blood leukocytes as a new approach for assesment of human stress response. J Med Invest
2005 52:137-144 Morita K, Saito T, Ohta M, Ohmori T, Kawai K, Teshima-Kondo S, Rokutan K.
Expression analysis of psychological stress-associated genes in peripheral blood leukocytes. // Neurosci Lett. 2005 Jun 10-17;381(1-2):57-62
Сродство MR к
кортикоидам х10, чем GR
повышение уровня
сахара в крови
Регуляция метаболизма
белков, липидов и
кортизола вызывает
нарушения: снижение
массы мышечной
ткани, резистентность
клеток к действию
снижение иммунитета
Время (час.)
поведенческий ответ
Снижение возбуждения,
возвращение систем к
обычному режиму
кодирование информации
Консолидация в памяти
полученного опыта для
обеспечения адаптивного
поведения в будущем
Brain development under stress: hypotheses of glucocorticoid actions revisited.
Melly S. Oitzl , Danielle L. Champagne, Rixt van der Veen, E. Ronald de Kloet (University of Leiden) Neurosci Biobehav Rev. 2010 34(6):853-66.
Тип и сила стрессора
Особенности личности
Жизненный опыт, наличные стратегии
совладания со стрессом
Влияние генотипа на уровень кортизола при стрессе
Ген транспортера серотонина HTTLPR
Испытуемые - 67 девочек, от 9 до 14 лет. После 30 мин отдыха – MST (вычитать из 400 по 7 в течение 3 мин.).
При ошибке экспериментатор останавливал и просил начать заново.
Gotlib IH, Joormann J, Minor KL, Hallmayer J. HPA axis reactivity: a mechanism underlying the associations among 5-HTTLPR, stress, and depression. // Biol Psychiatry. 2008 May 1;63(9):847-51
Стресс – измерение субъективных переживаний по опросникам.
PTSD - посттравматическое стрессовое расстройство (DSM-IV).
Возникает после тяжелого психотравмирующего события
- повторяющееся, навязчивое воспроизведение в сознании психотравмирующего
- избегание мыслей, чувств или разговоров, связанных с травмой
- постоянная бдительность, ожидание угрозы.
Риск PTSD 8-24% в зависимостси от типа травмы (преступления против
личности связаны с большим риском, чем катастрофы или ДТП)
Частые осложнения - сердечно-сосудистые, эндокринные, нервные заболевания
и нарушения пищеварения.
Близнецовые исследования: наследственность объясняет 30% риска PTSD
True WJ, Rice J, Eisen SA, Heath AC, Goldberg J, Lyons MJ, Nowak J: A twin study of genetic and environmental
contributions to liability for posttraumatic stress symptoms. Archives of General
Psychiatry 1993, 50:257-264.
5. Stein MB, Jang KJ, Taylor S, Vernon PA, Livesley WJ: Genetic and environmental influences on trauma exposure and
posttraumatic stress disorder: A twin study. American Journal of Psychiatry 2002, 159:1675-1681.
FK506-BINDING PROTEIN 5, белок семейства иммунофилинов,
ингибирует кальцинейрин (фосфатазу, участвующую в росте и дифференциации Т-клеток);
шаперон ГК-рецептора)
Влияние генотипа по полиморфизму HTTLPR
гена транспортера серотонина на частоту PTSD после урагана
в зависимости от социального окружения
Аллель L – высокая активность, аллель S – низкая активность
Нет абсолютно «плохих» и «хороших» генотипов – они «плохие» или «хорошие»
в зависимости от условий среды
Уровень безработицы
Уровень преступности
- генотипы -
Частота PTSD у носителей различных генотипов по 5-HTTLPR в зависимости от
социальных условий (2004 Florida Hurricane Study).
Koenen et al., Modification of the Association Between Serotonin Transporter Genotype and Risk of Posttraumatic Stress Disorder in Adults by County-Level Social
Environment // American Journal of Epidemiology 2009 Vol. 169, No. 6
Гены, вовлеченные в регуляцию поведения:
Ранее считалось, что есть «хорошие» и «плохие» (повышающие риск развития
депресси, алкоголизма и т.п.) варианты генов. Но в благоприятных условиях
воспитания «рисковые» варианты дают более высокий результа. Возможно, более
корректно рассматриват их не как «рисковые», а как более пластичные, т.е.
дающие результат в большей мере зависящий от среды
варианта гена
Доля индивдов
с депрессией
варианта гена
Благоприятная среда
Неблагоприятная среда
Belsky et al., Vulnerability genes or plasticity genes? Molecular Psychiatry, 2007
Концепция пластичности проявления генов под влиянием среды,
в влияющих на формирование
поведенческих признаков и личностных особенностей,
дает надежду на большую свободу в формировании этих признаков.
Только надо уделять внимание воспитанию детей и созданию
не-стрессовых условий в жизни своей, своих близких ... всего
человечества - что кому по силам
Но это все знали еще до появления генетики :)
Просто теперь мы понимаем молекулярные механизмы этих
закономерностей, и пытаемся достигнуть своих целей, используя не
только психологические знания, но и молекулярные
Размер файла
9 291 Кб
Пожаловаться на содержимое документа