close

Вход

Забыли?

вход по аккаунту

?

Генетика стресса

код для вставкиСкачать
Генетика стресса
Светлана Александровна
Боринская
Институт общей генетики им. Н.И.Вавилова РАН
В письме 1768 года к некому, судя по всему юному,
адресату Вольтер замечает: «Если Вы, сударь, желаете
серьёзно предаться изучению природы, то позвольте
сказать Вам, что следует поступать так, как поступали
Галилей, Ньютон: рассматривать, взвешивать, считать и
измерять, но никогда не отгадывать…»
(Державин К.Н., Вольтер, М., Изд-во АН СССР, 1946 г., с. 89).
ЭВОЛЮЦИЯ ЧЕЛОВЕКА. МОЗГОВОЙ ШТУРМ
http://mozgovoyshturm.ru/#1
- Мы обсуждаем с одной стороны природу, то есть научный подход к природе, а
с другой стороны, мы говорим, что нам, человечеству, даны от Бога некоторые
знания.
- Мы экспериментальным образом исследуем, выдвигаем гипотезы, проверяем
гипотезы, ставим эксперименты, анализируем ДНК… Но каким образом
возникает то знание, о котором Вы сказали? Вы же эксперименты не ставите?
- Есть познание рациональное, эмпирическое и есть познание религиозное,
которое является божественным откровением.
В лекции представлены данные, полученные
исключительно эмпирическим путем - в
результате лабораторных экспериментов,
эпидемиологических обследований,
обобщения результатов различных
исследований, с применением оценок
статистической значимости результатов.
http://psychosoma.narod.ru/persons/selye.html
http://www.stresscanada.org/
János Selye
1907, Вена – 1982, Монреаль
>300 000 цитирований работ Селье по стрессу
Ганс Селье
Синдром, вызываемый различными вредными
агентами
Nature 138, 32-32
4 июля 1936
Гипоталамо-гипофизарно-надпочечниковая система
Гипоталамус
Гиппокамп
глюкокортикоиды
Кортикотропинрелизинг фактор
Гипофиз
АКТГ
Надпочечники
адреналин
глюкокортикоиды
Клетки иммунной системы
В момент опасности
адреналин и норадреналин
способствуют немедленным
физическим реакциям, связанным
с подготовкой организма
к повышенной активности
http://ru.wikipedia.org/wiki/%D0%9C%D0%B8%D0%B4%D1%80%D0%B8%D0%B0%D0%B7
Увеличение сердцебиения, частоты дыхания
Повышенное потоотделение
Подавление эрекции
Аудиторная избирательность или потеря слуха
Туннельное зрение (утрата периферического зрения)
Расширение зрачков
адреналин
Тремор
Ослабление поверхностного кровообращения (бледность кожных покровов), повышение
свертываемости крови предотвращают потерю крови при возможных повреждениях
поверхностных тканей
Сужение кровеносных сосудов во многих частях тела
Повышение кровяного давления, в сочетании с расширением кровеносных сосудов в мышцах
Повышение уровня сахара и мобилизация жиров (ресурс для предполагаемой работы мышц)
Замедление или прекращение пищеварения, ослабление перистальтики кишечника
Остановка слюноотделения и выработки слезной жидкости
Ускорение спинальных рефлексов
Сужение сознания - концентрация на источнике опасности, что позволяет частично или полностью
игнорировать не относящиеся к нему сигналы: посторонние звуки, движения на периферии зрения
и т.п.
При чрезмерной силе или длительности
стрессового ответа нарушаются функции
организма и самих адаптационных
систем
Развитие соматической и психологической
декомпенсации происходит по механизму
«слабого звена», когда не выдерживает нагрузки
одна из стресс зависимых систем
http://ru.wikipedia.org/wiki/%D0%9C%D0%B8%D0%B4%D1%80%D0%B8%D0%B0%D0%B7
Увеличение сердцебиения,
повышение кровяного давления
повышение свертываемости крови
Гипертония, повреждения сердечнососудистой системы, инфаркты,
инсульты
Мобилизация жиров
Гиперлипидемия, риск
атеросклеротических изменений
Повышение уровня сахара
Изменение гемодинамики и тонуса
мускулатуры кишечника
Сужение сознания - концентрация
на источнике опасности, что
позволяет частично или полностью
игнорировать не относящиеся к
нему сигналы
Гипергликемия, диабет II
Повреждение слизистой ЖКТ, язвенная
болезнь
ПТСР, панические атаки, иные
психические расстройства
Минералокортикоиды
альдостерон
дезоксикортикостерон
кортизол
•Глюконеогенез,
повышение уровня
сахара в крови
•Иммуносупрессия
•Регуляция
метаболизма белков,
липидов и углеводов
•Длительная
гиперсекреция
кортизола вызывает
различные
метаболические
нарушения:
•снижение массы
мышечной ткани,
•резистентность клеток
к действию инсулина,
•гипергликемию,
•снижение иммунитета
Стрессовый
ответ
Кортикостерон
Глюкокортикоиды
кортизол
Кортикостерон
Восстановление
Адаптация
Стрессор
Время (час.)
Возбудимость,
эмоциональное
возбуждение,
бдительность,
поведенческий ответ
Снижение возбуждения,
возвращение систем к
обычному режиму
функционирования,
кодирование информации
Консолидация в памяти
полученного опыта для
обеспечения адаптивного
поведения в будущем
Brain development under stress: hypotheses of glucocorticoid actions revisited.
Oitzl et al., Neurosci Biobehav Rev. 2010 34(6):853-66.
Почему при стрессе
настроение падает?
Почему при стрессе настроение падает
(и при простуде тоже):
кортизол и иммунная стимуляция «отвлекают» ресурсы
от синтеза «гормона счастья» серотонина
кортизол
триптофан
Серотонин
NMDA-рецептор
мелатонин
TDO - tryptophan 2,3 dioxygenase
IDO - indoleamine 2,3 dioxygenase
Dantzer et al., Nat Rev Neurosci.; 9(1): 46–56
Больной человек или больная крыса
имеют сниженную физическую
активность, откзываются от еды, питья и
социальных контактов. Это может быть
ответом на повышение уровня
интерлейкинов – медиаторов воспаления
Депрессия, вызванная
воспалительными
процессами
Поведение,
типичное
для болезни
Поведение,
похожее на
депрессию
2-6 часов
24 часа
Время после введения ЛПС
ЛПС
Провоспалительные
цитокины
Dantzer et al., Nat Rev Neurosci.; 9(1): 46–56
Поведение, типичное для болезни
Поведение,
похожее на
депрессию
Реакция на ментальный стресс у молодых мужчин является
предиктором гипертонии в более старшем возрасте
Систолическое давление в покое у
тех же испытуемых через 18 лет
Исходное обследование 1986-1989.
Показатели (N=87)
Исходно
MST
CPT
Систолическое (mmHg)
125.0
148.5
145.1
Диастолическое (mmHg)
65.2
79.5
80.5
Частота сердцебиения
60.7
80.8
69.4
45.22
119.3
78.3
110.70
198.0
158.5
Адреналин (pg/mL)
Норадреналин (pg/mL)
CPT – руку испытуемого погружали на 1
мин в ледяную воду
MST – испытуемого просили производить
устно арифметические действия (вычитать
по 13 из 1079 в течени 5 мин), при работе
метронома (2 Hz).
Тертили по концентрации
норадреналина у призывников при MST
(19-летние норвежцы)
Arnljot Flaa, Ivar K. Eide, Sverre E. Kjeldsen and Morten Rostrup Sympathoadrenal Stress Reactivity Is a Predictor of Future Blood Pressure
: An 18-Year Follow-Up Study // Hypertension 2008, 52:336-341: Norway
ФАКТОРЫ,
ВЛИЯЮЩИЕ НА СТРЕССОВЫЙ ОТВЕТ
Тип и сила стрессора
Особенности личности
Жизненный опыт, наличные стратегий
совладания со стрессом
Гены
Гены и стресс
Изменения уровня экспрессии генов
у соискателей степени PhD до и после защиты диссертации
Показаны изменения уровня экспрессии 519 генов. Нормировано на уровень
экспрессии за 4 недели до защиты. Выявлено 70 генов, экспрессия которых
меняется сходным образом у всех испытуемых - в основном гены цитокинов и
их рецепторов, белков, участвующих в апоптозе и ответе на тепловой шок.
Rokutan et al. Gene expression profiling in peripheral blood leukocytes as a new approach for assesment of human stress response. J Med Invest 2005 52:137-144 Morita et
al., Expression analysis of psychological stress-associated genes in peripheral blood leukocytes. // Neurosci Lett. 2005 Jun 10-17;381(1-2):57-62
“Зло – злом… Надобно было уничтожать
причины преступлений (среду). Но не в
одних причинах преступление: не в среде”
Неизданный Достоевский.
Запись в тетради 1876 – 1877 годов
М.: Наука, 1971
МОНОАМИНОКСИДАЗА
МАОА работает
дворником,
выметая «лишние»
нейромедиаторы
MAOA
Из Википедии: синапс
АГРЕССИЯ
замена одной буквы Т С в гене МАОА
«выключает» ген и ведет к агрессивныму поведению у мужчин
Х-сцепленное наследование
ВЛИЯНИЕ ВОСПИТАНИЯ
НА ПРОЯВЛЕНИЕ ГЕНОВ
ген-средовые
взаимодейстия
СРЕДА ВЛИЯЕТ НА ПРОЯВЛЕНИЕ ГЕНОВ
СВЯЗЬ АНТИСОЦИАЛЬНОГО ПОВЕДЕНИЯ, УСЛОВИЙ ВОСПИТАНИЯ И
ГЕНОТИПА ПО ГЕНУ МАОА
ИНДЕКС АСОЦИАЛЬНОГО
ПОВЕДЕНИЯ
Низкоактивная МАОА
n=163 чел.
Убийство
Изнасилование
Нападение с
целью нанесения
повреждений
Жестокость по
отношению
к животным
Высокоактивная МАОА
n=279 чел.
Нет
Возможно Тяжелые
ПЛОХИЕ УСЛОВИЯ
Уровень кортизола у мужчин, ухаживающих за родственниками с
психическим заболеваниями, в зависимости от генотипа MAOA
Низкоактивный аллель –при хроническом стрессе нарушена суточная
динамика уровня кортизола
Уровень кортизола
Низкоактиваная
стресс
контроль
Выоскоактивная
стресс
контроль
утро
день
вечер
Хронический стресс, связанный с уходом за тяжело
больными близкими людьми (онко, деменция), ведет
к повышенному риску сердечно-сосудистых ,
онкологических заболеваний, нарушений
иммунитета (астма, РА), нарушений сна, депрессии
и преждевременной смерти.
ТРАСНПОРТЕР СЕРОТОНИНА
Забирает серотонин
из синаптической
щели обратно в
выпустивший его
нейрон
Транспортер
серотонина
серотонин
рецепторы
Из Википедии: синапс
серотонин
VNTR-ПОЛИМОРФИЗМ ПРОМОТОРНОГО
УЧАСТКА ГЕНА ТРАНСПОРТЕРА СЕРОТОНИНА
8 повторов L-аллель
tgcagcccccccagcatctcccctgcacccccagcatcccccc
.... ctgcaccccccagcatcccccc
tgcagcccttccagcat....
6 повторов S-аллель
(низкий уровень экспрессии)
о наличии
Сообщают
reports of depression
Self
депрессии
symptoms, age 26
СвязьThe
между
перенесенными
сообщениями
association
betweenстрессами
Stressful иLife
Events
о депрессии
в возрасте
26 лет в зависимости
and self-reports
of depression
symptomsотatгенотипа
age
по гену транспортера
серотонина
HTTLPR
26, as a function
of SERT
genotype
12,50
низко-активный
ген (гомозиготы)
10,00
гетерозиготы
высокоактивный ген
(гомозиготы )
7,50
5,00
5-HTT gene
SS, n = 146
SL, n = 435
LL, n = 264
2,50
0,00
0
1
2
3
4+
Терпимыеhaving
Хорошие
Плохие
Five
groups of individuals
different
numbers of life
events, ages
21-26
условия
условия
условия
Caspi et al., Science 2003
Стресс – измерение субъективных переживаний по опросникам.
ПТСР - посттравматическое стрессовое расстройство (DSM-IV).
Возникает после тяжелого психотравмирующего события
- повторяющееся, навязчивое воспроизведение в сознании психотравмирующего
события
- избегание мыслей, чувств или разговоров, связанных с травмой
- постоянная бдительность, ожидание угрозы.
Риск ПТСР 8-24% в зависимостси от типа травмы (преступления против
личности связаны с большим риском, чем катастрофы или ДТП)
Частые осложнения - сердечно-сосудистые, эндокринные, нервные заболевания
и нарушения пищеварения.
Близнецовые исследования: наследственность объясняет 30% риска PTSD
True WJ, Rice J, Eisen SA, Heath AC, Goldberg J, Lyons MJ, Nowak J: A twin study of genetic and environmental contributions to liability for posttraumatic stress symptoms. Archives of General
Psychiatry 1993, 50:257-264.
5. Stein MB, Jang KJ, Taylor S, Vernon PA, Livesley WJ: Genetic and environmental influences on trauma exposure and posttraumatic stress disorder: A twin study. American Journal of Psychiatry 2002, 159:16751681.
ВЗАИМОДЕЙСТВИЕ ГЕНОВ И СРЕДЫ
Влияние генотипа по полиморфизму HTTLPR
гена транспортера серотонина
на частоту ПТСР после урагана
в зависимости от социального окружения
Аллель L – высокая активность, аллель S – низкая активность
Уровень безработицы
Уровень преступности
Высокий
Высокий
Низкий
L/L
S/L
S/S
- генотипы -
Низкий
L/L
S/L
S/S
Частота ПТСР у носителей различных генотипов по 5-HTTLPR в зависимости от
социальных условий (Исследование последствий урагана во Флориде-2004).
Koenen et al., Modification of the Association Between Serotonin Transporter Genotype and Risk of Posttraumatic Stress Disorder in Adults by County-Level Social Environment // American Journal of
Epidemiology 2009 Vol. 169, No. 6
ГЕНЫ, РАННИЙ И СТРЕСС
СПОСОБНОСТЬ К ОБУЧЕНИЮ
Крысята заботливых матерей имели более высокий уровень секреции
факторов роста, серотонина и гормонов щитовидной железы. Став
взрослыми, они демонстрировали меньший ответ на стресс (были
более бесстрашными, имели меньшую амплитуду проявлений
эмоциональных реакций, более слабые адрекнокортикальные
рекацкии в ответ на стресс). В зрелом возрасте они лучше решали
пространственные задачи на ориентировку в пространстве и
сохраняли лучшую память, чем животные, обделенные в детстве
материнским вниманием.
У крысят, переживших стресс в 3-дневном возрасте (изоляция от
матери на несколько часов), резко возрастал уровень гормона стресса
кортизола. Однако впоследствии уровень кортизола падал и у
взрослых животных был гораздо ниже, чем в контрольной группе. У
взрослых животных наблюдались нарушения обучения и запоминания,
но не было отличий в извлечении следов памяти. В стрессовых
ситуациях их действиях разрушались меньше, чем у животных, не
подвергавшихся в детстве стрессу.
Oitzk et al., Brain development under stress: hypotheses of glucocorticoid actions revisited. Neurosci Biobehav
Rev. 2010 May;34(6):853-66.
Условия воспитания в детстве влияют на
устойчивость к стрессу во взрослом возрасте
Замирания по
сравнению с
базовым
уровнем
В обычных условиях потомки Low LG крыс хуже решают задачи, связанные с
ориентированием в пространстве (функции гиппокампа) по сравнению с потомками High
LG самок. Однако в стрессовых условиях (удар током) у животных Low LG способнось к
обучению нарушается меньше, чем у High LG (регистрируется также по изменению LTP
при действии ГК). Предполагается, что в период развития это адаптивная предиктивная
настройка на условия среды.
Melly S. Oitzl , Danielle L. Champagne, Rixt van der Veen, E. Ronald de Kloet Brain development under stress: hypotheses of glucocorticoid actions revisited. // Neurosci Biobehav Rev. 2010
34(6):853-66; Champagne, D.L., Bagot, R.C., van Hasselt, F., Ramakers, G., Meaney, M.J., de Kloet, E.R., Joels, M., Krugers, H., 2008. Maternal care and hippocampal plasticity: evidence for
experience-dependent structural plasticity, altered synaptic functioning, and differential responsiveness to glucocorticoids and stress. // J. Neurosci. 28, 6037–6045.
Обучение и формирование долговременных воспоминаний
у животных основано на постоянном образовании новых и
отмирании старых связей между нейронами мозга.
Американским нейробиологам впервые удалось детально
проследить за этими процессами в ходе обучения у мышей.
Оказалось, что при обучении дендриты (ветвящиеся
«входные» отростки нейронов) образуют множество новых
веточек, количество которых коррелирует с эффективностью
обучения. После окончания тренировок большая часть новых
отростков постепенно атрофируется, но некоторые
сохраняются на всю жизнь, что обеспечивает длительное
хранение приобретенных воспоминаний и навыков.
www.elementy.ru
Схема эксперимента (а), участки моторной коры под разным увеличением (b, c) и формирование новых шипиков
на отдельном участке одного дендрита (d, e). На рисунке e красными стрелками показаны два дендритных
шипика, выросшие за два дня обучения бегу на крутящемся цилиндре
Новоприобретенные шипики, делятся на три группы: первая, самая многочисленная, исчезает в первые дни после
окончания тренировок; вторая, меньшая, сохраняется в среднем 1–2 месяца. Но есть и третья группа шипиков
(около 0,8% от общего числа), которая сохраняется на всю жизнь. Авторы рассчитали, что двухдневное обучение
бегу на вращающемся цилиндре приводит к формированию около двух миллионов межнейронных контактов,
сохраняющихся до самой смерти животного. Очевидно, этого вполне достаточно для сохранения двигательного
навыка.
Guang Yang, Feng Pan, Wen-Biao Gan. Stably maintained dendritic spines are associated with lifelong memories // Nature. 2009.
МОЛЕКУЛЯРНЫЕ МЕХАНИЗМЫ
ВЛИЯНИЯ ВОСПИТАНИЯ
НА РАБОТУ ГЕНОВ
Наследственность:
Тимин в промоторе гена рецептора глюкокортикоидов NR3C1
ассоциирован с депрессией
Структура гена NR3C1
Частоты аллелей NR3C1-1
rs10482605
p=0.02
1
0,8
0,6
0,4
0,2
0
изоформа
GR-alpha
–
активируемый лигандом
транскрипционный фактор
изоформа GR-beta может
ингибировать
транскрипционную
активность GR-alfa
1 T
Аллель
Депрессия
2 C
Аллель
Контроль
Эпигенетическая регуляция экспрессии гена рецептора
глюкокортикоидов NR3C1 :
Метилирование CpG в промоторе усилено при плохих условиях в детстве
(потеря родителя, плохие условия воспитания). Экспрессия гена снижена.
Аллель NR3C1-1 T –
”генокопия” плохого
воспитания?
Пониженнный уровень мРНК первого экзона
выявлен на постмортальных препаратах мозга
пациентов с депрессией.
Хронический стресс и лечение ГК, депрессия,
ПТСР, плохие условия воспитания в детстве ведут к
атрофии гиппокампа
Tyrka AR, Price LH, Marsit C, Walters OC, Carpenter LL. Childhood adversity and epigenetic modulation of the leukocyte glucocorticoid receptor: preliminary findings in
healthy adults./ PLoS One. 2012;7(1):e30148.
Гены, вовлеченные в регуляцию поведения:
MAOA, HTT, DRD4
ПРЕДРАСПОЛОЖЕНОСТЬ ИЛИ ПЛАСТИЧНОСТЬ?
Ранее считалось, что есть «хорошие» и «плохие» (повышающие риск развития
депресси, алкоголизма и т.п.) варианты генов. Но в благоприятных условиях
воспитания «рисковые» варианты дают более высокий результа. Возможно, более
корректно рассматриват их не как «рисковые», а как более пластичные, т.е.
дающие результат в большей мере зависящий от среды
Носители
«рискового»
варианта гена
Доля индивдов
с депрессией
Носители
«хорошего»
варианта гена
Благоприятная среда
Неблагоприятная среда
Belsky et al., Vulnerability genes or plasticity genes? Molecular Psychiatry, 2007
БЛАГОДАРЮ
ЗА ВНИМАНИЕ
Лекция по генетике стресса в программе «Медицина в
контексте» на «Первом медицинском канале»
http://www.youtube.com/watch?v=L4UpaMUvgKw
Документ
Категория
Презентации
Просмотров
143
Размер файла
6 270 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа