close

Вход

Забыли?

вход по аккаунту

?

Red\Green Colorblindness

код для вставкиСкачать
By: Brett Kratchman
Colorblindness is a defect of
vision affecting the ability to
distinguish colors, occurring
mostly in males. Color blindness
is caused by a defect in the
retina or in other nerve portions
of the eye. Also known as
dichromatism, this disease
consists of the inability to
differentiate between reds and
greens.
The signs and symptoms of colorblindness depend
on certain factors:
•Is the problem congenital,
acquired, partial, or
complete?
•Does the patient have
trouble distinguishing reds
and greens?
•Is the patient experiencing
reduced vision?
Color vision deficiency is
usually detected using colored
charts called the Ishihara Test
Plates. The plates consist of gray
and colored dots. The patient is
asked to identify the number in
the middle of the circle. After
the patient has identified what
they see, more testing may
commence.
Vision test examples.
Normal people should see 74.
Color deficient people may see
D=21.
•A random pattern of gray level dots is first put together.
•A digit pattern is then added which is defined by
yellow/blue variation only. Since most people with
red/green colorblindness can see yellow/blue they will
be able to see the digit 5 in this test pattern.
•Another digit pattern which is defined by
red/green variation is added. Here is the pattern
composed of the random brightness pattern and
the red/green pattern.
•Finally all three are added: People with red/green
deficiency will not be able to see the red/green pattern
and will see the 5. People with normal vision will see
both the patterns, but since the red/green is stronger
than the yellow/blue, the normal person will see the
digit 6.
Most color-blind people see
normally in all other aspects other
than the color of their weakened
cone. Color-blind people can usually
learn by experience to associate
certain colors with different
sensations of brightness. Many
victims of the defect are unaware
that they are color-blind.
Weak green cone
Weak red cone
Gene OPN1MW
GC0XP148439
•Start: 148,439,714 bp from
pter
•End: 148,453,078 bp from
pter
•Size:13,364 bases
•Orientation: plus strand
Gene OPN1LW
GC0XP147547
•Start: 147,547,307 bp from
pter
•End: 147,561,950 bp from
pter
•Size: 14,643 bases
•Orientation: plus strand
>ENST00000276348
ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGC
AGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACC
AACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACA
TCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTT
GTGGTCATTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCAC
CATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTG
AACCTGGCGGTCGCTGACCTGGCAGAGACCGTCATCGCCAGCACTA
TCAGCGTTGTGAACCAGGTCTATGGCTACTTCGTGCTGGGCCACCCT
ATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGG
TCTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCT
GCAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTG
GGCATTGCCTTCTCCTGGATCTGGGCTGCTGTGTGGACAGCCCCGCC
CATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCAT
GCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTC
TTACATGATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCAT
CATCGTGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGG
CAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAAGG
AAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGC
TGGGGACCATACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGG
CTACCCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAA
AAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGGCA
GTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGATG
GCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCC
TCGGTATCGCCTGCATGA
>ENST00000218195
ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGC
AGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACC
AACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACA
TCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTT
GTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCAC
CATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTG
AACCTGGCGGTCGCTGACCTAGCAGAGACCGTCATCGCCAGCACTAT
CAGCATTGTGAACCAGGTCTCTGGCTACTTCGTGCTGGGCCACCCTA
TGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT
CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGGTGGCTGGTGGTGTG
CAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTGG
GCATTGCCTTCTCCTGGATCTGGTCTGCTGTGTGGACAGCCCCGCCC
ATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCATG
CGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCA
GTCTTACATGATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGC
TATCATCATGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGT
GGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAA
GGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGCGTCT
GCTGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCT
GGTTACGCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTACTTTGCC
AAAAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGG
CAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACG
ATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTG
TCCTCGGTATCGCCTGCATGA
Nucleotide substitutions (missense / nonsense)
Accession
Number
Codon
Nucleotide
Amino acid
Phenotype
CM920309
203
aTGC-CGC
Cys-Arg
Trichromacy, deutan
Nucleotide substitutions (missense / nonsense)
Accession
Number
Codon
Nucleotide
Amino acid
Phenotype
CM951111
203
aTGC-CGC
Cys-Arg
Blue cone
monochromatism
ColorMax has recently introduced
a tinted lens for glasses.
ColorMax lenses are designed to
improve the vision of specific
colors that look the same to
people with red green color
deficiencies. However, the vision
of other colors has actually been
impaired. Other than these lenses,
there isn’t much that can be done
to cure color blindness, thus
making research obsolete.
Rhodospin, the receptor protein in rod cells, crosses the disc
membrane seven times. Its odd shape is shared by three
receptor proteins in cone cells. Retinal (which absobs light) is
shown in purple. The other balls (yellow) represent amino
acids which make up the rhodospin structure.
Unfortunately, there is nothing that can be done
once diagnosed with color blindness. Color
blindness is a life long condition that can exclude
people from certain jobs such as a pilot or a job
that would include electronics. If you suspect
colorblindness, you can visit an ophthalmologist
or your health care provider. Being aware of the
disease is the best way to help someone overcome
this disease.
Документ
Категория
Презентации
Просмотров
5
Размер файла
330 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа